ID: 932368076

View in Genome Browser
Species Human (GRCh38)
Location 2:71165934-71165956
Sequence TTTGCATTTACACAGGCATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932368076_932368081 12 Left 932368076 2:71165934-71165956 CCGGATGCCTGTGTAAATGCAAA No data
Right 932368081 2:71165969-71165991 CTGATCCTGTGAGCCTAGGATGG No data
932368076_932368080 8 Left 932368076 2:71165934-71165956 CCGGATGCCTGTGTAAATGCAAA No data
Right 932368080 2:71165965-71165987 GATTCTGATCCTGTGAGCCTAGG No data
932368076_932368083 14 Left 932368076 2:71165934-71165956 CCGGATGCCTGTGTAAATGCAAA No data
Right 932368083 2:71165971-71165993 GATCCTGTGAGCCTAGGATGGGG No data
932368076_932368082 13 Left 932368076 2:71165934-71165956 CCGGATGCCTGTGTAAATGCAAA No data
Right 932368082 2:71165970-71165992 TGATCCTGTGAGCCTAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932368076 Original CRISPR TTTGCATTTACACAGGCATC CGG (reversed) Intergenic
No off target data available for this crispr