ID: 932368077

View in Genome Browser
Species Human (GRCh38)
Location 2:71165941-71165963
Sequence CTGGGAATTTGCATTTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932368077_932368081 5 Left 932368077 2:71165941-71165963 CCTGTGTAAATGCAAATTCCCAG No data
Right 932368081 2:71165969-71165991 CTGATCCTGTGAGCCTAGGATGG No data
932368077_932368083 7 Left 932368077 2:71165941-71165963 CCTGTGTAAATGCAAATTCCCAG No data
Right 932368083 2:71165971-71165993 GATCCTGTGAGCCTAGGATGGGG No data
932368077_932368082 6 Left 932368077 2:71165941-71165963 CCTGTGTAAATGCAAATTCCCAG No data
Right 932368082 2:71165970-71165992 TGATCCTGTGAGCCTAGGATGGG No data
932368077_932368089 29 Left 932368077 2:71165941-71165963 CCTGTGTAAATGCAAATTCCCAG No data
Right 932368089 2:71165993-71166015 GCCCAGAAATCTCTATGGGGTGG No data
932368077_932368080 1 Left 932368077 2:71165941-71165963 CCTGTGTAAATGCAAATTCCCAG No data
Right 932368080 2:71165965-71165987 GATTCTGATCCTGTGAGCCTAGG No data
932368077_932368086 24 Left 932368077 2:71165941-71165963 CCTGTGTAAATGCAAATTCCCAG No data
Right 932368086 2:71165988-71166010 ATGGGGCCCAGAAATCTCTATGG No data
932368077_932368088 26 Left 932368077 2:71165941-71165963 CCTGTGTAAATGCAAATTCCCAG No data
Right 932368088 2:71165990-71166012 GGGGCCCAGAAATCTCTATGGGG No data
932368077_932368087 25 Left 932368077 2:71165941-71165963 CCTGTGTAAATGCAAATTCCCAG No data
Right 932368087 2:71165989-71166011 TGGGGCCCAGAAATCTCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932368077 Original CRISPR CTGGGAATTTGCATTTACAC AGG (reversed) Intergenic
No off target data available for this crispr