ID: 932368080

View in Genome Browser
Species Human (GRCh38)
Location 2:71165965-71165987
Sequence GATTCTGATCCTGTGAGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932368077_932368080 1 Left 932368077 2:71165941-71165963 CCTGTGTAAATGCAAATTCCCAG No data
Right 932368080 2:71165965-71165987 GATTCTGATCCTGTGAGCCTAGG No data
932368075_932368080 9 Left 932368075 2:71165933-71165955 CCCGGATGCCTGTGTAAATGCAA No data
Right 932368080 2:71165965-71165987 GATTCTGATCCTGTGAGCCTAGG No data
932368076_932368080 8 Left 932368076 2:71165934-71165956 CCGGATGCCTGTGTAAATGCAAA No data
Right 932368080 2:71165965-71165987 GATTCTGATCCTGTGAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932368080 Original CRISPR GATTCTGATCCTGTGAGCCT AGG Intergenic
No off target data available for this crispr