ID: 932368081

View in Genome Browser
Species Human (GRCh38)
Location 2:71165969-71165991
Sequence CTGATCCTGTGAGCCTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932368075_932368081 13 Left 932368075 2:71165933-71165955 CCCGGATGCCTGTGTAAATGCAA No data
Right 932368081 2:71165969-71165991 CTGATCCTGTGAGCCTAGGATGG No data
932368076_932368081 12 Left 932368076 2:71165934-71165956 CCGGATGCCTGTGTAAATGCAAA No data
Right 932368081 2:71165969-71165991 CTGATCCTGTGAGCCTAGGATGG No data
932368077_932368081 5 Left 932368077 2:71165941-71165963 CCTGTGTAAATGCAAATTCCCAG No data
Right 932368081 2:71165969-71165991 CTGATCCTGTGAGCCTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932368081 Original CRISPR CTGATCCTGTGAGCCTAGGA TGG Intergenic
No off target data available for this crispr