ID: 932368083

View in Genome Browser
Species Human (GRCh38)
Location 2:71165971-71165993
Sequence GATCCTGTGAGCCTAGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932368076_932368083 14 Left 932368076 2:71165934-71165956 CCGGATGCCTGTGTAAATGCAAA No data
Right 932368083 2:71165971-71165993 GATCCTGTGAGCCTAGGATGGGG No data
932368075_932368083 15 Left 932368075 2:71165933-71165955 CCCGGATGCCTGTGTAAATGCAA No data
Right 932368083 2:71165971-71165993 GATCCTGTGAGCCTAGGATGGGG No data
932368077_932368083 7 Left 932368077 2:71165941-71165963 CCTGTGTAAATGCAAATTCCCAG No data
Right 932368083 2:71165971-71165993 GATCCTGTGAGCCTAGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932368083 Original CRISPR GATCCTGTGAGCCTAGGATG GGG Intergenic
No off target data available for this crispr