ID: 932368086

View in Genome Browser
Species Human (GRCh38)
Location 2:71165988-71166010
Sequence ATGGGGCCCAGAAATCTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932368079_932368086 5 Left 932368079 2:71165960-71165982 CCAGAGATTCTGATCCTGTGAGC No data
Right 932368086 2:71165988-71166010 ATGGGGCCCAGAAATCTCTATGG No data
932368078_932368086 6 Left 932368078 2:71165959-71165981 CCCAGAGATTCTGATCCTGTGAG No data
Right 932368086 2:71165988-71166010 ATGGGGCCCAGAAATCTCTATGG No data
932368084_932368086 -9 Left 932368084 2:71165974-71165996 CCTGTGAGCCTAGGATGGGGCCC No data
Right 932368086 2:71165988-71166010 ATGGGGCCCAGAAATCTCTATGG No data
932368077_932368086 24 Left 932368077 2:71165941-71165963 CCTGTGTAAATGCAAATTCCCAG No data
Right 932368086 2:71165988-71166010 ATGGGGCCCAGAAATCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932368086 Original CRISPR ATGGGGCCCAGAAATCTCTA TGG Intergenic
No off target data available for this crispr