ID: 932373491

View in Genome Browser
Species Human (GRCh38)
Location 2:71213044-71213066
Sequence TCCCCACTGCTCCCCAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1402
Summary {0: 1, 1: 0, 2: 5, 3: 90, 4: 1306}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932373491 Original CRISPR TCCCCACTGCTCCCCAGGCC AGG (reversed) Intronic
900288362 1:1912988-1913010 GCGCCACTGCACCCCAGCCCGGG - Intergenic
900316099 1:2057165-2057187 TGCCCGGTGCTCCCTAGGCCCGG + Intronic
900419775 1:2550909-2550931 TCCCAACCCCTCCCCAGCCCTGG + Intergenic
900425196 1:2575129-2575151 TCCCAACCCCTCCCCAGCCCTGG - Intergenic
900510220 1:3055593-3055615 TCACCACTGCACCCCAGCCTGGG - Intergenic
900634461 1:3655342-3655364 ACCCCACTGCACTCCAGCCCGGG + Intronic
900648153 1:3718233-3718255 TCCACAGTGCTCCCCGCGCCTGG + Intronic
900648999 1:3721962-3721984 TCCCAACTGCACCCCTGTCCAGG - Intronic
900828266 1:4944272-4944294 TCGCCACTGATCCCCAGCCTCGG - Intergenic
900936879 1:5771622-5771644 TTCCCACTGGCCCCCATGCCGGG - Intergenic
900962564 1:5934605-5934627 TCCCCACTGCTCCCAGTCCCGGG + Intronic
900991021 1:6098415-6098437 CCCCACCTCCTCCCCAGGCCAGG + Intronic
901009201 1:6189514-6189536 ACCCCACTGCTCTCCAGCCTTGG + Intronic
901022350 1:6261620-6261642 TTCACGCTGCTCCCCGGGCCTGG + Intergenic
901042086 1:6370530-6370552 GCACCACTGCACTCCAGGCCAGG - Intronic
901044348 1:6386457-6386479 TCCCACCTGCTCCCCATGCCAGG + Intronic
901229583 1:7634347-7634369 TTCCCACAGCTGCCCAGGTCTGG - Intronic
901325084 1:8360860-8360882 TCCCCAGGCCTCCCAAGGCCAGG - Exonic
901709554 1:11102984-11103006 GCACCACTGCCCCCCAGCCCGGG + Intergenic
901794674 1:11673439-11673461 TACCCACTCCTCCCAGGGCCAGG + Intronic
901801398 1:11710140-11710162 GCCCCACTGCACACCAGCCCGGG + Intronic
901907460 1:12426259-12426281 TCTGCTCTGCTTCCCAGGCCAGG - Intronic
901980253 1:13028752-13028774 TCACCACTGCTCTCCAGCCTGGG - Intronic
902001833 1:13200179-13200201 TCACCACTGCTCTCCAGCCTGGG + Intergenic
902021060 1:13345904-13345926 TCACCACTGCTCTCCAGCCTGGG + Intronic
902067203 1:13698685-13698707 GCCCCACTGCTCTCCAGCCTGGG - Intergenic
902067260 1:13699030-13699052 GCCCCACTGCTCGCCAGCCTGGG - Intergenic
902109816 1:14068839-14068861 GCGCCACTGCACTCCAGGCCTGG - Intergenic
902352205 1:15865092-15865114 TCACCACTGCACTCCAGCCCGGG - Intronic
902414183 1:16229386-16229408 TCCCCGTTTCTCCCCAGCCCCGG - Intergenic
902420718 1:16277679-16277701 TCGCCACTGCACTCCAGGCCGGG + Intronic
902427552 1:16336399-16336421 ACGCCACTGCTCCCCAGCCTGGG - Intronic
902432089 1:16371232-16371254 TCCCCACTGCACCCCAGCCTGGG - Intronic
903036200 1:20494195-20494217 ACCCGAATGCTCCCTAGGCCTGG - Intergenic
903270699 1:22186415-22186437 ACCCCACTGCACTCCAAGCCTGG - Intergenic
903345639 1:22682486-22682508 TGGCCACTGATCCCCAGGCCAGG + Intergenic
903471513 1:23590940-23590962 TCCCCACTGCACTCCAGCCTGGG - Intronic
903606264 1:24577093-24577115 GCGCCACTGCACTCCAGGCCTGG + Intronic
903777182 1:25800465-25800487 TCCCCCCTGCTGCCGAGGCTGGG - Intronic
903808219 1:26020499-26020521 TCTCCAATGCTCCGCAGGCTGGG - Intronic
903872964 1:26450196-26450218 GCCCCACTGCACTCCAGCCCAGG - Intronic
904088533 1:27928399-27928421 TCACCACTGCACTCCAGGCTGGG - Intergenic
904478250 1:30778000-30778022 TGGCCACTGCTCCCCCTGCCGGG - Intergenic
904615197 1:31745802-31745824 TGCCCCCTGCTGCCCAGCCCGGG + Intronic
904635742 1:31879540-31879562 TCGCCACTGCACCCCAGCCTGGG + Intergenic
904768301 1:32867378-32867400 TCCCCTGAGCTTCCCAGGCCTGG + Intronic
904783586 1:32968687-32968709 TCCTCCCTGCTCCCCAAGCTTGG - Intergenic
905053544 1:35073836-35073858 TCACCACTGCACTCCAGGCTGGG - Intronic
905230596 1:36512775-36512797 TCCCCACTGCACTCCAGCCTGGG + Intergenic
905457637 1:38099424-38099446 GCACCACTGCACTCCAGGCCAGG - Intergenic
905485390 1:38292434-38292456 TGCCCAGGGCTCCCCAGGCTGGG - Intergenic
905486548 1:38301277-38301299 TCCCCTCTGCTGCCCCGGCCAGG + Intergenic
906421700 1:45673814-45673836 ACGCCACTGCACTCCAGGCCAGG + Intronic
906518022 1:46450924-46450946 CCCCCACTGCTCCCCAGACAGGG + Intergenic
906690795 1:47791571-47791593 TCCCCACTGCCCGGCAGTCCGGG + Intronic
907239321 1:53071756-53071778 GCCCCACTGCTAGCCTGGCCCGG - Intronic
908962086 1:69710234-69710256 ACGCCACTGCTCCCCAGCCTGGG + Intronic
909089401 1:71206726-71206748 TCCCCACTGCACTCCAGCCTGGG + Intergenic
909603101 1:77481102-77481124 TCTCCTCTGCTCACCTGGCCAGG - Intronic
910179342 1:84464070-84464092 TCCACTCAGCTCCACAGGCCAGG + Intergenic
910985836 1:93003788-93003810 ACCCCACTGCACTCCAGGCTGGG - Intergenic
911762825 1:101636180-101636202 TCACCACTGCACCCCAGCCTGGG - Intergenic
911957662 1:104258909-104258931 ACACCACTGCTCTCCAGGCTGGG - Intergenic
912253251 1:108032503-108032525 TCACCACTGCACTCCAGGCTGGG + Intergenic
912272048 1:108221303-108221325 TCCCCAGTGTTCCCTAGCCCTGG - Intergenic
912490814 1:110061698-110061720 TCCACACTGTTCTCCAGGCCAGG + Intronic
912558252 1:110531665-110531687 ACAGCACAGCTCCCCAGGCCAGG + Intergenic
913501515 1:119476419-119476441 TCCCCACTCCATCCCTGGCCTGG - Intergenic
914707884 1:150186199-150186221 GCCCCACTGCACTCCAGCCCAGG - Intergenic
915293536 1:154902915-154902937 ACACCACTGCTCCCCAGCCTGGG + Intergenic
915602052 1:156928611-156928633 ACACCACTGCTCTCCAGCCCAGG - Intronic
915735342 1:158081028-158081050 GCCCCCCAGCTCCCCAGGCCAGG + Intronic
915740211 1:158113505-158113527 TCCGCGCTGCTCTCCACGCCTGG + Intergenic
915915363 1:159937405-159937427 TCCCTCCTGCTTCCCTGGCCAGG - Intronic
916562930 1:165948817-165948839 TCACCACTGCTCTCCAGCCTGGG + Intergenic
916720420 1:167481242-167481264 ACGCCACTGCACCCCAGGCTGGG + Intronic
917034703 1:170735650-170735672 TCCCCACTGCTCCCACAGGCTGG + Intronic
917552905 1:176054200-176054222 TGCCCACTGCACCCCAGCCTGGG - Intronic
917818496 1:178736206-178736228 TCACCACTGCACTCCAGGCTGGG - Intronic
917943537 1:179946949-179946971 GCGCCACTGCACCCCAGGCCGGG + Intergenic
918262787 1:182811269-182811291 ACACCACTGCACCCCAGGCTGGG - Intronic
919179441 1:194061746-194061768 GCGCCACTGCACTCCAGGCCAGG - Intergenic
919216242 1:194559719-194559741 TCACCACTGCACTCCAGGCTTGG - Intergenic
919980083 1:202637556-202637578 TCCCCACTGCTCGGCTGGGCTGG - Intronic
920048554 1:203149509-203149531 TCCCCACCTCCACCCAGGCCGGG + Intronic
920205588 1:204288606-204288628 TTCCCACTGCTTCCCATCCCAGG - Intronic
920223615 1:204422560-204422582 TCACCACTGCACTCCAAGCCTGG + Intergenic
920248369 1:204605455-204605477 TCCCCACCCATCCCCAGGCAGGG - Intergenic
920309431 1:205040110-205040132 TCCCCACTTGTCCCCAGGGATGG + Intergenic
920383570 1:205550405-205550427 ACGCCACTGCACCCCAGCCCAGG + Intergenic
920390341 1:205596332-205596354 TCCTCTCTGGTCCCCATGCCTGG - Intronic
920398529 1:205663055-205663077 GCCCCACTGCTGTCCATGCCGGG - Exonic
920524926 1:206659466-206659488 ACCCCACAGCTCCTCATGCCAGG - Intronic
920549610 1:206847296-206847318 GCTCCACTGTTCCCCAGGGCAGG - Intergenic
920841189 1:209555373-209555395 ACCCCGCTGATCCCCAGGGCAGG + Intergenic
921058001 1:211558875-211558897 GCACCACTGCACTCCAGGCCTGG + Intergenic
921178838 1:212615830-212615852 ACCCCACTGCACCCCAGCCTGGG - Intronic
921365536 1:214370247-214370269 TCCCCTCTGTTGCCCAGGCTGGG - Intronic
922296336 1:224253192-224253214 GCCCCCCTGCCCCCCACGCCCGG + Intronic
922318201 1:224461043-224461065 GCCCCACTGCACTCCAGGCTGGG - Intronic
922420642 1:225459092-225459114 GCGCCACTGCACCCCAGGCTGGG + Intergenic
922533807 1:226364972-226364994 TGCCCACCCCTCGCCAGGCCAGG + Intronic
922651638 1:227345029-227345051 GCCCCACTGCACCCCATCCCAGG + Intergenic
922938269 1:229437476-229437498 CCACCACTGCACGCCAGGCCTGG + Intergenic
923094152 1:230761394-230761416 TCCCCACTGCTCCCCTGCTCAGG + Intronic
923358076 1:233180845-233180867 TCCACACAGCTCCCCACACCAGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923628969 1:235637013-235637035 TCCCCACTGCACTCCAGCCTGGG + Intronic
923738989 1:236638315-236638337 TCGCCACTGCTCTCCAGCCTGGG + Intergenic
923952054 1:238967181-238967203 TCACCACTGCACTCCAGCCCAGG + Intergenic
923998581 1:239525294-239525316 CCACCACTGCTCTCCAGCCCTGG + Intronic
924007747 1:239630894-239630916 TCCCCACTGCTGCCCTCCCCCGG - Intronic
924163993 1:241263232-241263254 TCGCCACTGCACCCCAGCCTGGG + Intronic
924176459 1:241396199-241396221 TCACCACTGCACTCCAGGCTGGG + Intergenic
924259488 1:242214917-242214939 TCGCCACTGCACTCCAGCCCGGG - Intronic
924383265 1:243482528-243482550 TCCCCAGTCCTACCCAGGCAGGG + Intronic
924585773 1:245359913-245359935 TCACCACTGCACTCCAGCCCGGG - Intronic
924606444 1:245539693-245539715 GCGCCACTGCTCTCCAGGCTGGG - Intronic
1062866805 10:862715-862737 TCACCACTGCACTCCAGGCTGGG + Intronic
1063106782 10:2998982-2999004 ATCCCACTGCACCCCAGCCCGGG + Intergenic
1063298105 10:4826440-4826462 GCCGCACTTCTCCCCAGCCCCGG - Intronic
1063424867 10:5942975-5942997 TCACCACTGCACTCCAGGCTGGG - Intronic
1063461741 10:6219193-6219215 TCCGCAATGCTCCCCGTGCCGGG - Intronic
1063572545 10:7229550-7229572 TCCCCACTGCACTCCAGCCTGGG + Intronic
1063623316 10:7667518-7667540 TCCCCCCACCTCCCCAGTCCCGG + Intergenic
1063665728 10:8059020-8059042 TCCCCTCTGCTTCCGAGGCCAGG - Intronic
1063896610 10:10688959-10688981 ACACCACTGCACCCCAGGCTGGG + Intergenic
1064054766 10:12088068-12088090 TCACCACTGCACTCCAGGCTGGG + Intronic
1064080597 10:12304860-12304882 TCGCCACTGCACTCCAGCCCGGG + Intergenic
1064129964 10:12700775-12700797 TCCCCTCTGCTCCCATGTCCAGG + Intronic
1064145333 10:12822355-12822377 TCCCCACTGCTGCACAGCCCAGG + Intronic
1064277871 10:13923833-13923855 TCTCCATTCCTCCCCAGGGCTGG - Intronic
1064458721 10:15512581-15512603 GCCCCACTGCACCCCAGCCTGGG - Intergenic
1064995960 10:21296862-21296884 TCCCCACTGCACTCCAGGCTGGG - Intergenic
1065018304 10:21481645-21481667 TCCCCACTGCACTCCAGCCTAGG + Intergenic
1065054348 10:21829071-21829093 ACCTCACTGCACTCCAGGCCTGG - Intronic
1065129702 10:22608319-22608341 CCCTCACTGCTCCCCCTGCCTGG - Intronic
1065311413 10:24419125-24419147 ACACCACTGCTCTCCAGGCTGGG + Intronic
1065359268 10:24873948-24873970 GCACCACTGCTCTCCAGGCTAGG - Intronic
1065625278 10:27623625-27623647 TCATCAATGTTCCCCAGGCCAGG + Intergenic
1065875388 10:29993357-29993379 CCCCCAGCGCTCCCCAGGACAGG + Intergenic
1066374152 10:34842386-34842408 ACCCCACTGCACACCAGGCTGGG + Intergenic
1066392959 10:34993542-34993564 GCACCACTGCACTCCAGGCCTGG + Intergenic
1066425153 10:35301669-35301691 ATGCCACTGCTCTCCAGGCCTGG - Intronic
1066431154 10:35352966-35352988 TCACCACTGCACTCCAGTCCAGG - Intronic
1067007660 10:42680158-42680180 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1067027956 10:42860112-42860134 GCACCACTCCTCCCCAGACCTGG - Intergenic
1067081338 10:43214266-43214288 ACCCAGCTGCTGCCCAGGCCTGG - Intronic
1067141478 10:43660877-43660899 TCTCCACTGCACCCCAGCCTGGG - Intergenic
1067446337 10:46349982-46350004 GCGCCACTGCACTCCAGGCCGGG - Intergenic
1067474489 10:46556805-46556827 TCCCGACCCCTCCTCAGGCCGGG + Intergenic
1067591043 10:47510785-47510807 GCGCCACTGCACTCCAGGCCGGG + Intronic
1067638161 10:48018882-48018904 GCGCCACTGCACTCCAGGCCGGG + Intergenic
1068688583 10:59893561-59893583 ACCCCACTGCACTCCAGCCCGGG + Intronic
1068955165 10:62814950-62814972 TCCCGGCTGCTCCCCATCCCCGG + Intronic
1069190085 10:65476860-65476882 GCGCCACTGCTCTCCAGCCCGGG - Intergenic
1069408009 10:68122857-68122879 GCGCCACTGCTCTCCAGCCCGGG + Intronic
1069513903 10:69062421-69062443 TCCCACCTCCTCCCCATGCCTGG - Intergenic
1069626378 10:69870353-69870375 GCACCACTGCTCCCCAGCCTGGG - Intronic
1070041237 10:72782411-72782433 GCGCCACTGCACCCCAGCCCAGG - Intronic
1070134764 10:73683308-73683330 GCGCCACTGCACTCCAGGCCGGG + Intronic
1070281319 10:75050940-75050962 TCCTCACTGCTCAGCAGCCCAGG - Intronic
1070326048 10:75389933-75389955 GCACCACTGCTCCCCAGCCTAGG - Intergenic
1070331593 10:75421396-75421418 TCACCACTGCACTCCAGGCTGGG + Intergenic
1070567362 10:77614041-77614063 TCCCTACCACTGCCCAGGCCTGG + Intronic
1070591757 10:77806724-77806746 GCCCCACCCCACCCCAGGCCCGG + Intronic
1070675460 10:78408765-78408787 TCCCCCCTGCTCCCCTGCCATGG + Intergenic
1070677585 10:78422860-78422882 GCCCCACTGCTCTCCAGCCTGGG + Intergenic
1070959092 10:80486401-80486423 TCACCTCTGCTCCCCTGCCCGGG - Intronic
1071402238 10:85285157-85285179 TCCCCACTGCTCCCAGAGCGAGG - Intergenic
1071406632 10:85340674-85340696 ACACCACTGCTCCCCAACCCTGG + Intergenic
1071606970 10:87001100-87001122 GCGCCACTGCACTCCAGGCCGGG - Intergenic
1071806332 10:89124911-89124933 TCACCACTGCACTCCAGGCTGGG + Intergenic
1071824655 10:89312764-89312786 GCACCACTGCTCTCCAGGCTGGG + Intronic
1072142668 10:92603306-92603328 GCGCCACTGCACTCCAGGCCTGG - Intronic
1072518630 10:96210909-96210931 TCCCCACTGCACTCCAGCCTGGG - Intronic
1072547937 10:96454984-96455006 ATCCCACTGTTCCCCAGGCATGG + Intronic
1072735737 10:97878145-97878167 AGCCCACTGCTCCCCAGGCCAGG - Intronic
1072916948 10:99543204-99543226 TCACCACTGCACTCCAGCCCGGG + Intergenic
1073046718 10:100643517-100643539 TCCCAACAGCTCCCCAGGGTAGG + Intergenic
1073138733 10:101233980-101234002 GCCTCCCTGCTCCCCAGGCCTGG - Intergenic
1073162804 10:101415216-101415238 TCACCACTGCACTCCAGCCCAGG - Intronic
1073328901 10:102658336-102658358 TCCCCTATCCCCCCCAGGCCTGG + Exonic
1073330949 10:102669528-102669550 TCAGCACTGTTCCCCAGCCCAGG - Intergenic
1073461282 10:103667309-103667331 TCCCCACGACTCCCCAACCCTGG + Intronic
1073731216 10:106290889-106290911 GCCCCACTGCTCTCCAGCCTGGG - Intergenic
1073786144 10:106891909-106891931 TACCTCCTGCTCCCCAGCCCTGG - Intronic
1075177206 10:120176574-120176596 TCCCCACTGTTCCTCAGCACCGG - Intergenic
1075335226 10:121604032-121604054 TGCCCACTGCTCCCCAGCAGCGG + Intergenic
1075455249 10:122580857-122580879 TTCTCACAGCTCCCCAGTCCCGG + Exonic
1075782398 10:125026038-125026060 TCCCCCCAGGTCCCCAGGCAGGG + Intronic
1075799620 10:125145329-125145351 TCCCCAAGGCACCCCTGGCCAGG - Intronic
1076398025 10:130155696-130155718 TCCCAACTTCTTCCCAGCCCAGG - Intronic
1076437696 10:130457689-130457711 GCACCACTGCACTCCAGGCCAGG - Intergenic
1076487977 10:130836373-130836395 TGGCCACAGCTCCCCAGTCCAGG - Intergenic
1076584718 10:131537796-131537818 TCCCCACTGCACGCCAGCCTGGG - Intergenic
1076615070 10:131749683-131749705 GCCCACCTCCTCCCCAGGCCTGG - Intergenic
1076624528 10:131813342-131813364 TCCCACCTCCGCCCCAGGCCCGG + Intergenic
1076692836 10:132232522-132232544 TGCCCTCAGCCCCCCAGGCCTGG - Intronic
1076790333 10:132773804-132773826 TCACCACTGCACTCCAGCCCGGG - Intronic
1077027545 11:447937-447959 ACGCCACTGCACTCCAGGCCTGG + Intergenic
1077047255 11:552073-552095 TCCCTTTTCCTCCCCAGGCCAGG + Exonic
1077059553 11:611834-611856 TCCCGACAGCTCCCCGGGCATGG - Exonic
1077059567 11:611873-611895 TCCCGACAGCTCCCCGGGCATGG - Exonic
1077078385 11:711591-711613 TCCCCCCTCCTAGCCAGGCCTGG + Intronic
1077101571 11:824813-824835 GCACCCCTGCTCCCGAGGCCCGG + Exonic
1077151618 11:1075423-1075445 GCCGCACTCCTCACCAGGCCGGG + Intergenic
1077390434 11:2298547-2298569 CCCCCAGTCCTGCCCAGGCCCGG + Intronic
1077445179 11:2587473-2587495 CCCTCCCTGTTCCCCAGGCCTGG - Intronic
1077465925 11:2733636-2733658 CCCCCAGGGCTGCCCAGGCCTGG - Intronic
1077470932 11:2760138-2760160 CCCCCAGTGCTGCCCAGGCTGGG - Intronic
1077472757 11:2771961-2771983 TCTCCACTGCTCCCTGGCCCTGG + Intronic
1077514193 11:2992026-2992048 TCCCGCCAGCGCCCCAGGCCCGG + Intronic
1077760445 11:5090356-5090378 GCCCCACTGCACTCCAGCCCGGG - Intergenic
1077927445 11:6695906-6695928 TCACCACTGCACCCCAGCCTGGG - Intergenic
1078877029 11:15409253-15409275 GCCCGGCTGCTCCCCAAGCCTGG + Intergenic
1079035272 11:17014668-17014690 TCCCCTTTGCCCCCGAGGCCGGG + Intergenic
1079044346 11:17086322-17086344 TCGCCACTGCACTCCAGGCCTGG + Intronic
1079368251 11:19828109-19828131 ACCCCACTGCACCCCAGCCTGGG + Intronic
1079396476 11:20067915-20067937 GCCACCCTGCTCCCCAGGCGGGG - Intronic
1079473613 11:20805560-20805582 TCACCACTGCACCCCAGCCTGGG - Intronic
1079724768 11:23867404-23867426 TCGCCACTGCACTCCAGGCTGGG - Intergenic
1079908926 11:26284860-26284882 GCCCCACTGCACCCCAGCCTGGG + Intergenic
1080360323 11:31506269-31506291 GCGCCACTGCACTCCAGGCCTGG - Intronic
1080567156 11:33521126-33521148 TCGCCACTGCACGCCAGCCCAGG + Intergenic
1081263392 11:40988757-40988779 TCCCCACTGCACTCCAGCCTGGG - Intronic
1081574502 11:44310632-44310654 TCCCCAGGGCTCCCGAGGCTAGG + Intergenic
1081904817 11:46661473-46661495 TCCCCACTGCACTCTAGCCCGGG + Intronic
1082015495 11:47483220-47483242 TTCCCACTGCACTCCAGCCCAGG + Intronic
1082615700 11:55356838-55356860 GCCCCACTGTTCACCAGGCAGGG + Intergenic
1082890175 11:58130762-58130784 ACGCCACTGCACCCCAGCCCAGG + Intronic
1083057227 11:59834432-59834454 TGCCCACTGCTCTCCAGCCTGGG - Intronic
1083406152 11:62458709-62458731 CCTCCACTGCTCCCAAGGACAGG + Intronic
1083639359 11:64136903-64136925 TCCCCGCTGCTCCCGGGGGCTGG - Intronic
1083652101 11:64209689-64209711 ACCCCACTGCTGCACATGCCGGG - Intronic
1083889509 11:65588919-65588941 TCCTCAGGGCTCCCCAGACCTGG - Intronic
1083955066 11:65978471-65978493 TTCCCACTGCACCCCAGGCCTGG + Intronic
1084018366 11:66401177-66401199 TCACCACTGCACTCCAGGCTAGG + Intergenic
1084106144 11:66981923-66981945 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1084441433 11:69176289-69176311 GCACCACTGCACCCCAGCCCAGG - Intergenic
1084571632 11:69963268-69963290 GCCCCACTGCACTCCAGGCTGGG + Intergenic
1084627587 11:70320472-70320494 ACACCACTGCACTCCAGGCCGGG - Intronic
1085063398 11:73469952-73469974 ACCCCACTGCTCTCCAGGCTAGG - Intronic
1085305673 11:75484395-75484417 TCTCCACTCCTACCCAGGCGTGG + Intronic
1085623969 11:78057910-78057932 TGCCCACTGCTCACCAATCCTGG + Intronic
1086080261 11:82896634-82896656 TCACCACTGCACCCCAGCCTGGG + Intronic
1087039149 11:93781964-93781986 TCACCACTGCACTCCAGGCTGGG - Intronic
1087138160 11:94740647-94740669 ACCCCGCGGCTCCCCCGGCCGGG - Intronic
1087558643 11:99754921-99754943 TCCCCTCTGCCCCCAAGCCCTGG + Intronic
1087641585 11:100760656-100760678 GCGCCACTGCACCCCAGCCCAGG + Intronic
1088817151 11:113429285-113429307 GCCCCACTGCACTCCAGCCCGGG - Intronic
1088971598 11:114779341-114779363 CCCCCACACCGCCCCAGGCCAGG - Intergenic
1089133326 11:116229438-116229460 TTTCCACTGCTCCACAGTCCTGG + Intergenic
1089191981 11:116660106-116660128 TCCCCGCCCCTCCTCAGGCCAGG + Intergenic
1089231608 11:116982329-116982351 GCCCCACTGCACTCCAGCCCGGG - Intronic
1089448474 11:118572674-118572696 GCCACACTGCTCCCCGAGCCCGG - Intronic
1089527026 11:119103664-119103686 TCCCCTCTGTTGCCCAGGCTGGG - Intronic
1089528011 11:119109327-119109349 TCCGCACTGCTCTCCAGGTGGGG + Intronic
1089533504 11:119147352-119147374 TCACCACTGCTCTCCAGCCTGGG + Intergenic
1089757175 11:120695599-120695621 TACCCACTGCCTCCCAGGCCTGG + Intronic
1089759322 11:120711456-120711478 TCAGCACTGATCCCCAGACCAGG - Intronic
1090036324 11:123252704-123252726 TCCCCTCTGGTTCCCAGGACAGG + Intergenic
1090800116 11:130165375-130165397 TCACCACTGCCAACCAGGCCAGG - Intronic
1090849898 11:130562776-130562798 TCCCCACTGCCTCCCAGACAGGG - Intergenic
1091242706 11:134064589-134064611 TCTCACCTTCTCCCCAGGCCAGG + Intergenic
1091427426 12:403534-403556 GCCCCACTGCTCTCCAGCCTAGG - Intronic
1091761946 12:3093297-3093319 TCCCTACTGCCCCCCACGCCTGG - Intronic
1091773413 12:3168530-3168552 TCCCCACCGCCCCCCAGCTCTGG - Intronic
1091927297 12:4364622-4364644 GCCCCACTGCACTCCAGGCTGGG - Intergenic
1092190242 12:6514164-6514186 TCCCTACTGCTCCCAAAGTCAGG - Intronic
1092588957 12:9932731-9932753 TCCCCACTGCACTCCAGCCTGGG - Intergenic
1092625243 12:10319906-10319928 GCCCCACTGCACTCCAGCCCAGG - Intergenic
1092656827 12:10694338-10694360 GCGCCACTGCACCCCAGCCCGGG + Intergenic
1092872510 12:12818476-12818498 TCGCCACTGCACCCCAGCCTGGG + Intronic
1092895390 12:13005458-13005480 GCACCACTGCTCCCCAGCCTGGG - Intergenic
1093102293 12:15041537-15041559 GCCCCATTGCACTCCAGGCCAGG + Intergenic
1093515703 12:19984463-19984485 GCCCCACTGCACCCCAGCCTGGG + Intergenic
1093979445 12:25459705-25459727 GCCCCATTGCCCCTCAGGCCTGG + Intronic
1094224633 12:28031095-28031117 GCGCCACTGCTCTCCAGCCCGGG + Intergenic
1094285108 12:28783746-28783768 TCACCACTGCACTCCAGCCCAGG + Intergenic
1094562052 12:31564629-31564651 TCGCCACTGCTCTCCAGACTGGG - Intronic
1094576086 12:31687051-31687073 ACCCCACTGCACCCCAGTCTGGG - Intronic
1095332238 12:40980404-40980426 TCCCCACTGCACTCCAGCCTGGG + Intronic
1095671648 12:44868075-44868097 TCACCACTGCTCTCCAGCCTAGG + Intronic
1095892547 12:47248137-47248159 TCGCCACTGCACTCCAGGCTGGG + Intergenic
1096159846 12:49367381-49367403 TCCCCACTTCTCTCCTGGGCCGG - Intronic
1096173980 12:49499356-49499378 TCCCCAGAGCTCACCAGGCCAGG - Intronic
1096174122 12:49500727-49500749 TCGCCACTGCACTCCAGGCTGGG + Intronic
1096385422 12:51192005-51192027 TCCCCCATTCTCCCTAGGCCTGG + Intronic
1096466178 12:51848635-51848657 GCGCCACTGCCCCCCAGCCCAGG - Intergenic
1096748066 12:53741457-53741479 GCACCACTGCTCTCCAGCCCGGG - Intergenic
1096854447 12:54469729-54469751 ACACCACTGCACCCCAGGCTGGG - Intronic
1097052198 12:56230362-56230384 TCCCCCCTCCTCCCCAGGTTAGG + Intronic
1097115157 12:56691569-56691591 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1097160294 12:57041532-57041554 CCCCCTCTGCACACCAGGCCAGG + Intronic
1097180653 12:57169832-57169854 TCCCCACCGCCCCCGAGGCTGGG - Intronic
1097552861 12:61098250-61098272 TCCCTGCTGGGCCCCAGGCCAGG + Intergenic
1097793709 12:63841796-63841818 TCCCCAGTGCTCCCAAGACTGGG + Intergenic
1097869764 12:64591431-64591453 CCGCCACTGCACTCCAGGCCCGG + Intergenic
1098366101 12:69705098-69705120 GCACCACTGCACTCCAGGCCGGG - Intergenic
1099072019 12:78056684-78056706 TCACCACTGCACCCCAGCCTGGG + Intronic
1100032769 12:90213612-90213634 GCCCCATTGCACCCCAGCCCGGG - Intergenic
1100195622 12:92241168-92241190 TTCCCTATTCTCCCCAGGCCTGG - Intergenic
1100253425 12:92856812-92856834 TCACCACTGCTCTCCAGCCTGGG - Intronic
1100442995 12:94634695-94634717 TCCCTACTGCTCCCCAGGTAGGG + Intronic
1100641540 12:96486259-96486281 GCGCCACTGCACCCCAGGCTGGG - Intergenic
1100656210 12:96648631-96648653 TCGCCACTGCACTCCAGCCCAGG - Intronic
1100679978 12:96908004-96908026 ACCCCGCAGCTCACCAGGCCTGG + Intronic
1100842766 12:98630338-98630360 TCCCCACTGCACTCCAGCCTGGG + Intronic
1101002670 12:100372388-100372410 TCGCCACTGCACTCCAGGCTGGG - Intronic
1101560491 12:105853131-105853153 ACCCCTCTGCTCCCCACCCCTGG - Intergenic
1101960161 12:109242921-109242943 TCACCACTGCACTCCAGGCTGGG + Intronic
1101997794 12:109537418-109537440 TTCTCGCTGCTCCCCTGGCCTGG + Intergenic
1102068172 12:109996126-109996148 TCCCCTCTGCTTTCCTGGCCCGG - Intronic
1102092480 12:110203474-110203496 TCCCCACTGATCCCCAAGCCTGG + Intronic
1102249224 12:111374684-111374706 ACCCCACTGCACTCCAGCCCGGG + Intergenic
1102348251 12:112173231-112173253 GCCCCACTGCACTCCAGCCCAGG - Intronic
1102509946 12:113408435-113408457 TCACCACTGCACTCCAGGCTGGG - Intronic
1102556178 12:113728126-113728148 ACCCCACTGCCCCCCTGGCCTGG - Intergenic
1102706097 12:114881916-114881938 TCACCACTGCACTCCAAGCCTGG - Intergenic
1102745337 12:115244419-115244441 TCCCTCCTGCTCCCCAGCCCTGG - Intergenic
1102858380 12:116314650-116314672 ACTCAACTGCTCCCCAGCCCAGG + Intergenic
1102892528 12:116571521-116571543 GCCCCACTGCACCCCAGCCTGGG - Intergenic
1103276505 12:119716333-119716355 ACACCACTGCTCTCCAAGCCTGG + Intronic
1103302860 12:119941454-119941476 GCCCCACTGCACTCCAGGCTGGG + Intergenic
1103342507 12:120228604-120228626 TCCCCACTGCGCCCATGGCCAGG - Intronic
1103354434 12:120309452-120309474 TCACCACTGCTCTCCAGCCTAGG - Intronic
1103626439 12:122223841-122223863 TCACCACTGCTCTCCAGCCTGGG - Intronic
1103631906 12:122268242-122268264 TCACCACTGCACTCCAGGCTGGG + Intergenic
1103841589 12:123869672-123869694 CCCCCACTGCACCCCAGCCAAGG + Intronic
1103894587 12:124264634-124264656 TCACCACTGCACTCCAGGCTGGG - Intronic
1103905945 12:124327199-124327221 TACCCTCTGCCCCCCAGCCCCGG - Intronic
1103927877 12:124433731-124433753 TCTTCCCTGCTACCCAGGCCAGG - Intronic
1104099095 12:125589437-125589459 GCGCCACTGCACCCCAGCCCGGG + Intronic
1104410047 12:128550343-128550365 ACACCACTGCACCCCAGGCTGGG - Intronic
1104620477 12:130308150-130308172 TTCCTCCTGCCCCCCAGGCCTGG + Intergenic
1104798486 12:131536767-131536789 TGCCCTCTGCTCCCCCGGCAAGG + Intergenic
1104990473 12:132621458-132621480 ACCCCCATTCTCCCCAGGCCGGG + Exonic
1105014974 12:132781128-132781150 GCCCCACGGCTCCAGAGGCCAGG + Intronic
1105416792 13:20220349-20220371 TCCACACCCCTCCCCAGCCCTGG - Intergenic
1105642841 13:22284220-22284242 TCCCCACCGCTCCCCGGCCCTGG + Intergenic
1105945723 13:25187843-25187865 TCCCCACTTCCCCGCAGGGCAGG - Intergenic
1106231048 13:27821256-27821278 GCCCCACTGCGCCCCAGCCCAGG + Intergenic
1106470015 13:30045933-30045955 TCTCCACTGCTCACCTGGCTCGG - Intergenic
1107066235 13:36216570-36216592 ACACCACTGCTCTCCAGGCTGGG + Intronic
1107140421 13:36992877-36992899 GCCCCACTGCTCCCAAGGTTGGG - Intronic
1107225665 13:38045022-38045044 TCACCACTGTTCACCAGGCAAGG + Intergenic
1107232189 13:38123630-38123652 TCACCACTGCACACCAGCCCGGG - Intergenic
1107632055 13:42352241-42352263 GCACCACTGCTCCCCAGCCTGGG - Intergenic
1107797499 13:44067515-44067537 GCGCCACTGCACTCCAGGCCTGG + Intergenic
1108044745 13:46373014-46373036 GCCCCACTGCACTCCAGGCTGGG - Intronic
1108229458 13:48320786-48320808 GCCCCACTGCTCTCCAGCCTGGG + Intronic
1108684065 13:52803801-52803823 TCCTCCCTGCTCACCAGGTCTGG + Intergenic
1108779614 13:53813337-53813359 TCCCCACTGCACTCCAGCCTGGG - Intergenic
1109145326 13:58772980-58773002 GCGCCACTGCACTCCAGGCCGGG + Intergenic
1110849217 13:80225004-80225026 TGCTCACTGCTCTCCAGCCCGGG - Intergenic
1111103539 13:83615942-83615964 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1111124601 13:83898138-83898160 GCGCCACTGCACCCCAGCCCGGG - Intergenic
1111499307 13:89094716-89094738 GCCCCACTGCACTCCAGGCTGGG + Intergenic
1111530847 13:89536258-89536280 TCACCACTGCACTCCAGGCTGGG - Intergenic
1112322789 13:98422325-98422347 TCCCCACTGCTCCCCTGAAAAGG - Intronic
1112523317 13:100118590-100118612 TCACCACTGCACTCCAGCCCGGG - Intronic
1112900489 13:104352264-104352286 TCCCTTCTGCTCCCCATCCCTGG + Intergenic
1113066130 13:106375580-106375602 GCGCCACTGCTCTCCAGGCTGGG - Intergenic
1113568805 13:111339008-111339030 TGCCCACTGCTCAGCAGGCAGGG - Intronic
1113756220 13:112812830-112812852 TCGCGGCTGTTCCCCAGGCCAGG - Intronic
1113847629 13:113401635-113401657 TCCCCACAGCTCCCCCGACAGGG - Intergenic
1113950081 13:114066870-114066892 GCCCCAGAGCACCCCAGGCCAGG - Intronic
1114206650 14:20578455-20578477 TCCCCACTGTGCCCCAGCTCTGG - Intergenic
1114468417 14:22941450-22941472 GCGCCACTGCACTCCAGGCCTGG - Intergenic
1114547227 14:23512075-23512097 TCCCCTCTGCACCCCCAGCCTGG + Intergenic
1114664058 14:24368295-24368317 TCCCCCCTCCCACCCAGGCCGGG + Exonic
1115628110 14:35215721-35215743 TCACCACTGCACTCCAGCCCAGG + Intronic
1115659268 14:35475630-35475652 TCCCCACTGCACTCCAGCCCAGG - Intergenic
1116731663 14:48630492-48630514 TCCCCACCCCTCAACAGGCCTGG + Intergenic
1116791935 14:49348434-49348456 TCTCCACTGCCCCCCAGCCTGGG + Intergenic
1117183437 14:53216326-53216348 TCACCACTGCACCCCAGCCTGGG - Intergenic
1117225501 14:53654142-53654164 TCCCCACTGCACTCCAGCCTAGG + Intergenic
1118032720 14:61834171-61834193 GCACCACTGCTCTCCAGCCCAGG - Intergenic
1118784118 14:69031566-69031588 TCGCCACTGCTCTCCAGCCTGGG - Intergenic
1118968438 14:70610334-70610356 TAGCCACTGCACCCCAGCCCGGG + Intergenic
1119255061 14:73188602-73188624 GCACCACTGCACCCCAGGCTGGG + Intronic
1119280402 14:73401900-73401922 ACCCCACTGCTCTCCAGCCTGGG - Intronic
1119395540 14:74323539-74323561 GCCCCACTGCACTCCAGGCTGGG + Intronic
1119395720 14:74324842-74324864 TCCCCACTGCACTCCAGCCTGGG + Intronic
1119463461 14:74832512-74832534 TCACCACTGCACTCCAGGCTGGG - Intronic
1119529937 14:75352990-75353012 ACCCCACTGCACTCCAGCCCAGG + Intergenic
1119845138 14:77823613-77823635 ACACCACTGCACCCCAGACCGGG - Intronic
1119871742 14:78023645-78023667 CCCCCACTGCTACCCAGGGCAGG - Intergenic
1120008173 14:79383596-79383618 TACTCACTGCTCCTCAGTCCTGG + Intronic
1120795035 14:88623461-88623483 ACACCACTGCACTCCAGGCCAGG - Exonic
1120887242 14:89461292-89461314 ACACCACTGCACTCCAGGCCAGG + Intronic
1121235248 14:92387217-92387239 TCGCCACTGCTCTCCAGCCTGGG - Intronic
1121366994 14:93322153-93322175 ACCCCACTGCACTCCAAGCCTGG - Intronic
1121586172 14:95064498-95064520 TACCCAAGGATCCCCAGGCCTGG - Intergenic
1122023252 14:98856790-98856812 GCTCCCCTGCTCCCCTGGCCAGG - Intergenic
1122058284 14:99119747-99119769 TCCCCAGTGCTCGACAGGCAGGG + Intergenic
1122205242 14:100145075-100145097 TCCCTGCCGCCCCCCAGGCCAGG + Exonic
1122244742 14:100394544-100394566 TCCCCTCTGATCCCAGGGCCTGG - Intronic
1122274824 14:100586166-100586188 CCCCCACTACTCCCAGGGCCAGG - Intronic
1122359565 14:101151413-101151435 TCCCGAGTCCTCCCCACGCCCGG - Intergenic
1122621058 14:103057754-103057776 CCCGCGCCGCTCCCCAGGCCCGG - Intergenic
1122626065 14:103085875-103085897 ACCCCACTCCACCCCAGCCCAGG - Intergenic
1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG + Intergenic
1122737515 14:103851581-103851603 GCCCCACTGCACCCCAGCCTTGG + Intergenic
1122863918 14:104595009-104595031 TCCCGACTGCTCCCACTGCCTGG + Intronic
1122882928 14:104698091-104698113 TCCTCAGAGCTCCCCAGCCCCGG - Intronic
1122884352 14:104703982-104704004 CCCCTCCTGCTCCCAAGGCCAGG + Intronic
1122903921 14:104793287-104793309 TCCTCCCTGCTCCCCAGACTAGG + Exonic
1122962953 14:105106800-105106822 TCACCACTGCACTCCAGCCCGGG + Intergenic
1123052167 14:105549794-105549816 GCCCCGCCGCCCCCCAGGCCTGG + Intergenic
1123053836 14:105560107-105560129 TCCCAGCTGCTCCACAGCCCAGG - Intergenic
1123078419 14:105680524-105680546 TCCCAGCTGCTCCACAGCCCAGG - Intergenic
1123718066 15:23044055-23044077 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123718944 15:23047120-23047142 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123719158 15:23047863-23047885 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123735052 15:23176642-23176664 TCACCACTGCACTCCAGGCTGGG + Intergenic
1124220443 15:27846227-27846249 ACCCCACTCCTTCCCTGGCCAGG + Intronic
1124495696 15:30185601-30185623 TCCCCACTGCTCGGCTGGGCTGG - Intergenic
1124598609 15:31112500-31112522 TCCCAAATGCTCCCCAGTCCTGG + Intronic
1124704237 15:31948550-31948572 GCGCCACTGCACTCCAGGCCTGG - Intergenic
1124747877 15:32353045-32353067 TCCCCACTGCTCGGCTGGGCTGG + Intergenic
1124782861 15:32652247-32652269 CCCCCACTACTCCCCAGAGCCGG - Intronic
1125439108 15:39682493-39682515 TTCTCACTGCTCCCCAGGAAGGG + Intronic
1125759998 15:42089752-42089774 GCTCCCCTGCTCCCCCGGCCAGG + Intronic
1126007660 15:44273803-44273825 ACACCACTGCTCTCCAGCCCGGG - Intergenic
1126603910 15:50456529-50456551 CCACCACTGCTCTCCAGCCCAGG + Intronic
1126735744 15:51730471-51730493 TCGCCACTGCGCTCCAGGTCAGG + Intronic
1127154785 15:56112070-56112092 TCGCCACTGCACTCCAGGCTGGG + Intronic
1127968599 15:63942118-63942140 TCCCTACTGCTCCATAGTCCTGG - Intronic
1128091482 15:64922046-64922068 TCCCCTCGGCTCCCCTGGCCTGG + Intronic
1128102635 15:65015792-65015814 TCTCCACTGTACTCCAGGCCTGG + Intronic
1128214365 15:65924165-65924187 TCCCCTCTCCTCGCCAGCCCAGG - Intronic
1128237701 15:66079075-66079097 TGCCCACTGCCCCTCAGACCAGG - Intronic
1128265825 15:66265896-66265918 TCCCCACTGCACTCCAGCCTGGG - Intergenic
1128310048 15:66624881-66624903 GCGCCACTGCTCTCCAGGCTGGG - Intronic
1129022363 15:72533169-72533191 TCACCACTGCACCCCAGCCTGGG - Intronic
1129107240 15:73318795-73318817 TCCCCACAGCCCCAGAGGCCAGG + Intergenic
1129111572 15:73340142-73340164 TCCCCACTGCCACCCTGGCCAGG - Intronic
1129177091 15:73847985-73848007 TCCCCACTTCCCCCCTTGCCTGG - Intergenic
1129332827 15:74836572-74836594 TCCTGAGTGCTCCCTAGGCCAGG + Exonic
1129421704 15:75432996-75433018 GCACCACTGCACCCCAGGCTGGG + Intronic
1129605963 15:77025194-77025216 TCCCCACTGCCCACCCCGCCGGG + Intronic
1129788233 15:78323108-78323130 TTCCCCCTCATCCCCAGGCCAGG - Intergenic
1129954571 15:79623709-79623731 TCTCCACTGTGCCTCAGGCCTGG + Intergenic
1130034134 15:80342224-80342246 TCCCAACCCCACCCCAGGCCTGG + Intergenic
1130044113 15:80430822-80430844 TGCCCACTGCTGCCCTGGACAGG - Intronic
1130132168 15:81153295-81153317 TCCCCACTTCTCCCCAGGAGAGG - Intergenic
1130255107 15:82322347-82322369 CCACCTCTGCTCCCCACGCCTGG - Intergenic
1130512811 15:84603409-84603431 TCGCCACTGCACTCCAGCCCAGG - Intronic
1130554270 15:84911814-84911836 GCACCACTGCACTCCAGGCCAGG + Intronic
1130599867 15:85267659-85267681 CCGCCTCTGCTCCCCACGCCTGG + Intergenic
1130639155 15:85654779-85654801 TCACCACTGCACCCCAGCCTGGG + Intronic
1131025530 15:89138109-89138131 GCCTCCCTGCTCCACAGGCCTGG - Intronic
1131516410 15:93080530-93080552 TCACAGCTGCTCCCCAGGCACGG + Intronic
1131793600 15:95990952-95990974 TTCTCACTGCTCCCCAGCTCAGG - Intergenic
1131873127 15:96780636-96780658 TCCTTTCTCCTCCCCAGGCCTGG + Intergenic
1132404335 15:101533294-101533316 CCCCCTCTGCTCCCCAGGGCTGG - Intergenic
1132509752 16:333287-333309 GCACCACTGCACCCCAGCCCGGG + Intronic
1132661267 16:1062530-1062552 TCCCCTCGGCTCCCACGGCCGGG - Intergenic
1132684092 16:1154980-1155002 TCTCCACCCGTCCCCAGGCCCGG - Intronic
1132731976 16:1367168-1367190 TCCCCACAGCCCCGCAGCCCCGG + Intronic
1132820138 16:1862575-1862597 GCCCCACTGCTCTCCAGCCTGGG + Intronic
1132841124 16:1978992-1979014 TCCCCGCTCCTCCCCAGCCCTGG + Exonic
1133011632 16:2915752-2915774 TAGCCACTGCTCCCCAGCCTGGG + Intronic
1133173478 16:3996905-3996927 TCCCCACTGCACTCCAGCCTGGG - Intronic
1133205157 16:4228788-4228810 TCCCCACCTTTCCCCAGCCCCGG - Intronic
1133207057 16:4240125-4240147 TCCCATCTGCTTCCTAGGCCAGG - Intronic
1133235627 16:4386145-4386167 TCCCCTCTGCCCCCGAGCCCTGG - Intronic
1133794159 16:9032926-9032948 GCCCCACTGCACTCCAGCCCGGG + Intergenic
1133798112 16:9063067-9063089 ACGCCACTGCACTCCAGGCCAGG + Intergenic
1133961400 16:10496614-10496636 GCCCCACTGCACTCCAGCCCAGG + Intergenic
1133965819 16:10531013-10531035 TCACCACTGCACTCCAGCCCAGG - Exonic
1134013084 16:10869558-10869580 TCACCACTGCACTCCAGGCTGGG - Intergenic
1134028550 16:10973609-10973631 ACCCCACTGCTCTCCAGCCTGGG - Intronic
1134058547 16:11185106-11185128 GCCCCACTGCTCTCCAGCCTTGG - Intergenic
1134131645 16:11654362-11654384 TGCCCACTGCTCCCCTGGGGTGG + Intergenic
1134232251 16:12438111-12438133 TCCCCACTCCTGCCCAAGCTAGG - Intronic
1134284871 16:12852048-12852070 TCCCCACTGCTCTCCAGCCTGGG + Intergenic
1134322842 16:13179267-13179289 ACACCACTGCACCCCAGCCCAGG + Intronic
1134454217 16:14382374-14382396 GCACCACTGCTCTCCAGGCTGGG - Intergenic
1134483501 16:14638338-14638360 GCACCACTGCCCTCCAGGCCTGG + Intronic
1134537814 16:15040743-15040765 TCCCCCCAGCACCCCAGGCCCGG - Intronic
1135003550 16:18799060-18799082 TCCCCACTGCACTCCAGCCTGGG - Intronic
1135120056 16:19758288-19758310 TCCCCACTGTTCCACATGTCTGG + Intronic
1135209361 16:20510976-20510998 GCCCCACTGCACTCCAGCCCAGG + Intergenic
1135270282 16:21063583-21063605 GCACCACTGCACTCCAGGCCGGG - Intronic
1135698999 16:24615020-24615042 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1136122114 16:28144441-28144463 TGGCCACTGCTCTCCAGGCTGGG - Intronic
1136234609 16:28905924-28905946 TCCCCGCTGCTGCCCACGCCTGG + Intronic
1136342087 16:29650754-29650776 GCCCCACTGCACCCCAGCCTAGG + Intergenic
1136395887 16:29992165-29992187 CCACGACTGCCCCCCAGGCCTGG - Intronic
1136561443 16:31041583-31041605 GCGCCACTGCACCCCAGGCTGGG - Intronic
1136575917 16:31125147-31125169 TCCCCACTGCACTCCAGCCTGGG + Intronic
1136632302 16:31496124-31496146 ACCCCACTGCACTCCAGCCCAGG - Intronic
1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1138044149 16:53703727-53703749 TCCCCACTGCAGCGCGGGCCGGG - Intronic
1138141921 16:54576097-54576119 TCGCCACTGCACTCCAGGCTGGG + Intergenic
1138473486 16:57256954-57256976 TGCCTACTCCTCGCCAGGCCTGG + Exonic
1138886178 16:61082056-61082078 TCACCACTGCACCCCAGCCTGGG - Intergenic
1138952672 16:61932162-61932184 GCGCCACTGCACTCCAGGCCTGG + Intronic
1139077064 16:63464441-63464463 TCACCACTGCACTCCAGCCCAGG - Intergenic
1139442152 16:66973762-66973784 TCCTCTCTGCTGCCCAGTCCTGG + Exonic
1139563183 16:67756658-67756680 GCACCACTGCACCCCAGGCTGGG + Intronic
1140026016 16:71290674-71290696 TCACCACTGCACACCAGCCCGGG + Intergenic
1140403667 16:74692955-74692977 TCCCCAGAGCTCCTCAGTCCTGG - Intronic
1140424343 16:74848372-74848394 GCCCCACTGCACCCCAGCCTGGG + Intergenic
1140696844 16:77543190-77543212 TCACCACTGCACTCCAGCCCGGG + Intergenic
1140781327 16:78299559-78299581 TCGCCACTGCACTCCAGGCTGGG - Intronic
1140785067 16:78333091-78333113 ACACCACTGCACTCCAGGCCTGG - Intronic
1140829913 16:78741513-78741535 TCACCACTGCACCCCAGCCTGGG + Intronic
1141033415 16:80608746-80608768 GCCCCACCTCTCCACAGGCCGGG - Intronic
1141225145 16:82107862-82107884 CCTCCACTGGACCCCAGGCCAGG + Intergenic
1141351133 16:83298198-83298220 GCCCCACTGCACTCCAGGCTGGG + Intronic
1141441326 16:84031517-84031539 TCCTCACTGTTCCCCTGCCCCGG + Intronic
1141454493 16:84131140-84131162 TCTGCTCTGCTCCCCAGGCGGGG + Exonic
1141519033 16:84565275-84565297 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1141721616 16:85759181-85759203 GCGCCACTGCACTCCAGGCCGGG + Intergenic
1141829414 16:86501377-86501399 TCCCCACTTCTGCTCATGCCTGG + Intergenic
1141993770 16:87624318-87624340 TTCCCACGGCTCCCCACCCCTGG + Intronic
1142122632 16:88394600-88394622 TCCCGGCCCCTCCCCAGGCCAGG + Intergenic
1142141180 16:88473532-88473554 GCCCCACTTCTCCCATGGCCGGG + Intronic
1142176221 16:88646678-88646700 TCCCCACTGTCCCACCGGCCGGG - Intronic
1142209312 16:88800561-88800583 CCCCCGCTGCTCCCTTGGCCAGG - Intergenic
1142376362 16:89708951-89708973 TCCGCACTGCGCCCCAGACAGGG + Exonic
1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1142476686 17:193173-193195 ACCACACTCCTCCCCATGCCCGG - Intergenic
1142531962 17:585597-585619 TCACCACTGCACCCCAGCCTGGG + Intronic
1142699906 17:1652843-1652865 ACCCCACTGCACTCCAGGCTGGG - Intronic
1142764477 17:2057639-2057661 TCGCCATAGCTACCCAGGCCCGG - Exonic
1142962376 17:3558849-3558871 TCCTGCCTCCTCCCCAGGCCAGG - Intergenic
1143181333 17:4986251-4986273 TCCCCCCGGCCCCTCAGGCCGGG - Exonic
1143355662 17:6326148-6326170 TCCCCAATGCTGCCCAGTGCTGG - Intergenic
1143386704 17:6535223-6535245 TGCCCTCTGCTCTCCAGCCCAGG - Intronic
1143618001 17:8064813-8064835 TCCCCTCCTCTCCCCAGACCTGG - Intergenic
1143711877 17:8741282-8741304 TCCCCAGTGCCCCCCAGGGCTGG + Intronic
1144569931 17:16391035-16391057 TCCCCACTGCTCTCCAGCCTGGG + Intergenic
1144693392 17:17284173-17284195 TCGCCACTGCACCCCAGCCTGGG + Intergenic
1144931140 17:18859785-18859807 GCGCCACTGCTCTCCAGCCCGGG - Intronic
1144933677 17:18880439-18880461 ACACCACTGCACCCCAGCCCGGG - Intronic
1144963592 17:19061336-19061358 ACCCCACTGCACCCCAGCCTGGG - Intergenic
1144964098 17:19064704-19064726 ACCCCACTGCACCCCAGCCTGGG + Intergenic
1144971567 17:19113190-19113212 ACCCCACTGCACCCCAGCCTGGG + Intergenic
1144983868 17:19187440-19187462 ACCCCACTGCACCCCAGCCTGGG - Intergenic
1144984357 17:19190799-19190821 ACCCCACTGCACCCCAGCCTGGG + Intergenic
1145362080 17:22220819-22220841 TCCCCACTGCTCTCCAGCCTGGG + Intergenic
1145839213 17:27979756-27979778 ACGCCACTGCACCCCAGGCTGGG + Intergenic
1145974525 17:28976566-28976588 TCCCCATGGCTCCTCAGGCTTGG - Intronic
1146201456 17:30862289-30862311 TCGCCACTGCACTCCAGCCCAGG + Intronic
1146566289 17:33915894-33915916 TCCCCACGGGGCCTCAGGCCTGG - Intronic
1146913288 17:36661659-36661681 TCCCCACCTCTCCCCACCCCAGG + Intergenic
1146963296 17:37003516-37003538 GCCCCACTGCACTCCAGCCCTGG - Intronic
1147139640 17:38453914-38453936 GCCCCAGTACGCCCCAGGCCGGG - Intronic
1147180426 17:38681354-38681376 TCACCACTGCACTCCAGCCCAGG + Intergenic
1147326733 17:39673250-39673272 CCCCCACTGGCACCCAGGCCTGG - Exonic
1147395435 17:40139149-40139171 ACCCCACTGCACCCCAGCCTGGG + Intergenic
1147520951 17:41172824-41172846 TCGCCACTGCGCCCCAGCCTGGG + Intergenic
1147566402 17:41538953-41538975 TCCCCCTTAGTCCCCAGGCCTGG - Intergenic
1147597528 17:41726517-41726539 TCGCCACTGCACTCCAGTCCAGG + Intronic
1147696038 17:42354210-42354232 GCCCCACTGCACACCAGCCCGGG - Intronic
1147719672 17:42531293-42531315 ACACCACTGCACTCCAGGCCAGG - Intergenic
1147730290 17:42595856-42595878 ACGCCACTGCACCCCAGGCTGGG + Intronic
1147741571 17:42673494-42673516 CCGCCTCTGCTCCCCACGCCAGG - Exonic
1147840054 17:43365001-43365023 TCCCCACTGCACTCCAGCCTGGG - Intergenic
1147965749 17:44193464-44193486 GCCCCACTCCTCACCAGCCCTGG + Exonic
1147966437 17:44196733-44196755 TCACCACTGCACCCCAGCCTGGG + Intronic
1148074670 17:44928444-44928466 ACCCAACTGCACCCCAGCCCAGG - Exonic
1148089208 17:45012853-45012875 TCCACACTCCTCCCCAGGCAGGG + Intergenic
1148133481 17:45276424-45276446 TGCCCACTGGTTGCCAGGCCTGG - Intronic
1148248621 17:46054073-46054095 TGTCCACTGCACTCCAGGCCTGG + Intronic
1148466058 17:47865974-47865996 TCTACACTGATCACCAGGCCAGG + Intergenic
1148507460 17:48139222-48139244 TCACCACTGCACTCCAGACCGGG - Intronic
1148657631 17:49299717-49299739 ACACCACTGCACCCCAGCCCTGG - Intronic
1148767131 17:50046040-50046062 ACGCCACTGCACCCCAGCCCGGG + Intergenic
1148946815 17:51269896-51269918 GCCCCACTGCACTCCAGCCCTGG - Intronic
1149304710 17:55336276-55336298 CACCCCCTGCTCCCCAGGCCAGG + Intergenic
1149628145 17:58094764-58094786 TTCCCTCTTCTCCCCAGCCCTGG + Exonic
1149638330 17:58187262-58187284 TGGCCACTGATCCCCAGTCCTGG - Intergenic
1149658447 17:58322595-58322617 TCCCACTTGCTCCCCATGCCAGG + Intronic
1149786580 17:59440592-59440614 GCCCCACTGCACCCCAGCCTGGG + Intergenic
1150123732 17:62623247-62623269 TCACCTCCACTCCCCAGGCCTGG + Intergenic
1150249737 17:63699194-63699216 TCTCCCCTTCACCCCAGGCCAGG + Intronic
1150363342 17:64558354-64558376 GCACCACTGCACCCCAGGCTGGG + Intronic
1150613708 17:66753177-66753199 TCCCCACCAGTCCCCAGGCTGGG + Intronic
1150789218 17:68187017-68187039 GCGCCACTGCTCCCCAGCCTGGG + Intergenic
1150810271 17:68350740-68350762 TCCCCACTGCACTCCAGCCTGGG + Intronic
1150910939 17:69386789-69386811 GCCCCACTGCACACCAGCCCGGG + Intergenic
1151240306 17:72752285-72752307 ACGCCACTGCTCTCCAGCCCGGG - Intronic
1151441703 17:74133505-74133527 TTCTCCCTGCCCCCCAGGCCAGG + Intergenic
1151583837 17:74996399-74996421 GCCCCACTGCTCTCCAGCCTGGG + Intronic
1151750669 17:76035685-76035707 ACACCACTGCTCTCCAGCCCGGG + Intergenic
1151953544 17:77369189-77369211 GCCCCACTGCACTCCAGACCGGG + Intronic
1152077981 17:78170265-78170287 TCCCCACCCCTCCCCGGTCCAGG + Intronic
1152138303 17:78520066-78520088 ACACCACTGCACTCCAGGCCTGG + Intronic
1152208983 17:78992983-78993005 TGCCCACAGCTGCACAGGCCAGG - Exonic
1152305008 17:79515246-79515268 CTCCCACTGCTCCCCAGGCCAGG + Intronic
1152313991 17:79569239-79569261 TCCCCACTCCCCCCAAGCCCTGG + Intergenic
1152516142 17:80826017-80826039 TCCTCAGAGCTCCCCAGGGCCGG - Intronic
1152527210 17:80895216-80895238 TCCCCACCGATGCCCAGGCTGGG - Intronic
1152540484 17:80972015-80972037 CACCAACTGCTCCCCAGTCCTGG + Intergenic
1152629561 17:81404440-81404462 TCCCCACTCTGGCCCAGGCCAGG - Intronic
1152639770 17:81444651-81444673 TGCCCTCTGCCTCCCAGGCCTGG + Exonic
1152698058 17:81806099-81806121 TCAGCCCTGCTCTCCAGGCCAGG + Intronic
1152920530 17:83064328-83064350 GCCCTCCAGCTCCCCAGGCCTGG - Intergenic
1152963362 18:94445-94467 GCGCCACTGCTCTCCAGCCCAGG - Intergenic
1152995984 18:406744-406766 TCCTCAGTGCTCTCCAGGACTGG + Intronic
1153358433 18:4164635-4164657 GCACCACTGCTCCCCAGCCTGGG + Intronic
1153734382 18:8049752-8049774 GCGCCACTGCACTCCAGGCCAGG - Intronic
1153925064 18:9828180-9828202 TTCCCACTATTCCCCAGGGCAGG - Intronic
1154261556 18:12838544-12838566 TCCCTACTGCCTCCCAGGACTGG - Intronic
1154326807 18:13397184-13397206 TCACCACTGCTCTCCAGCCTGGG - Intronic
1155278938 18:24218484-24218506 ACCCCACTGCTCTCCAGCCTGGG - Intronic
1155397340 18:25400545-25400567 GCACCACTGCACTCCAGGCCAGG + Intergenic
1155889999 18:31255750-31255772 TCCCCCATGCTCCCCAGGAGCGG + Intergenic
1156179569 18:34587003-34587025 ACACCACTGCACTCCAGGCCTGG - Intronic
1157339366 18:46765721-46765743 TCCCCACTGAAGCCCAGACCAGG + Intergenic
1157456200 18:47830531-47830553 GCCCCACTGCACCCCAGCCTGGG + Exonic
1157620602 18:49015253-49015275 TCACCACTGCACTCCAGGCTAGG - Intergenic
1158318837 18:56241358-56241380 GCCCCACTGCACCCCATCCCAGG - Intergenic
1158456697 18:57614456-57614478 TCCCCACTGCACTCCAGCCTGGG + Intronic
1158543071 18:58374448-58374470 TCCCCACTGCCCCCCTTTCCCGG + Intronic
1158733776 18:60056138-60056160 GCACCACTGCTCTCCAGCCCAGG - Intergenic
1158832537 18:61296031-61296053 TCCCCACTACCCCCCACCCCTGG - Intergenic
1159383973 18:67698447-67698469 TCGCCACTGCACTCCAGGCTGGG + Intergenic
1160228505 18:77029094-77029116 TCGCCACTGCACCCCAGCCTGGG + Intronic
1160297786 18:77654051-77654073 ACCCCACTGCTACCCAGGCAGGG + Intergenic
1160594433 18:79964301-79964323 TCGCCACTGCACCCCAGCCTGGG + Intergenic
1160747984 19:720489-720511 CCCTCACCTCTCCCCAGGCCCGG - Intronic
1160835063 19:1120932-1120954 GCCCCACTGCTCTCCAGCCCAGG - Intronic
1161143610 19:2664092-2664114 CCTCCACCGCCCCCCAGGCCCGG + Intronic
1161161055 19:2762125-2762147 GCCCCACTCACCCCCAGGCCAGG + Intronic
1161174323 19:2831638-2831660 ACACCACTGCACCCCAGGCTGGG - Intronic
1161438235 19:4276782-4276804 GCACCACTGCACTCCAGGCCCGG + Intergenic
1161542564 19:4860926-4860948 TCACCACTGCACTCCAGGCTGGG + Intronic
1161647796 19:5464989-5465011 GCGCCACTGCACTCCAGGCCGGG + Intergenic
1161768810 19:6220591-6220613 TCCGCTCTGCTCACCCGGCCTGG - Intronic
1161777298 19:6270511-6270533 TCTTCACTCCTCCCAAGGCCAGG - Intronic
1161863495 19:6817089-6817111 TCCCCACTGCACTCCAGCCTGGG - Intronic
1161919922 19:7258366-7258388 ACCCCACTGCACTCCAGCCCAGG + Intronic
1162019321 19:7861509-7861531 TGCCCTCTGGCCCCCAGGCCAGG - Intronic
1162153715 19:8662988-8663010 TCACCACTGCACACCAGCCCTGG - Intergenic
1162455540 19:10782073-10782095 ACCCCACTGCACTCCAGCCCGGG - Intronic
1162539626 19:11286835-11286857 GCCCCACTGCTCTCCAGCCTGGG - Intergenic
1162613431 19:11775370-11775392 GCCCCACTGCACCCCAGCCTGGG - Intronic
1162813518 19:13179400-13179422 ACACCACTGCACCCCAGCCCAGG - Intergenic
1162855800 19:13467645-13467667 ACCCCACTGCGCCCCAGCCTGGG - Intronic
1162932707 19:13965375-13965397 TCTCCTCTGCTCCCCAGGGGCGG - Intronic
1163078780 19:14920463-14920485 TCCCCACTGCACTCCAGCCTGGG - Intergenic
1163121275 19:15219582-15219604 TCACCACTGCACTCCAGCCCGGG + Intergenic
1163190433 19:15673168-15673190 TCCCCTCTTCATCCCAGGCCAGG - Intronic
1163315505 19:16538127-16538149 TCCTCACTCCTCTCCAAGCCAGG + Intronic
1163315511 19:16538151-16538173 CCCCGACTCCTCCCCAAGCCAGG + Intronic
1163322828 19:16584569-16584591 TCCCCACTGCTCCCAGGGTGTGG - Intronic
1163329697 19:16628394-16628416 TCCCAACGGCTGCCTAGGCCGGG - Intronic
1163345651 19:16740376-16740398 TTCCCACTGCACCCCAGCCTGGG - Intronic
1163445438 19:17343382-17343404 GCGCCACTGCACTCCAGGCCGGG - Intergenic
1163629076 19:18407783-18407805 GCGCCACTGCACCCCAGGCTGGG - Intergenic
1163960421 19:20684975-20684997 ATGCCACTGCACCCCAGGCCTGG - Intronic
1164467127 19:28496898-28496920 GCACCACTGCTCCCCAGCCTGGG + Intergenic
1164720697 19:30429725-30429747 TCTCCACTGCACACCAGGCACGG - Intronic
1164990993 19:32683837-32683859 TCACCACTGCACTCCAGCCCGGG - Intergenic
1165021446 19:32927645-32927667 TCACCACTGCACTCCAGCCCGGG - Intronic
1165034563 19:33023389-33023411 ACGCCACTGCACTCCAGGCCTGG + Intronic
1165326916 19:35119264-35119286 CCTCCCCTGCTCCCCAGGCAGGG - Intronic
1165480861 19:36063290-36063312 GCCCCACTGCACTCCAGCCCGGG - Intronic
1165544251 19:36520815-36520837 GCCCCACTGCACCCCAGCCTGGG + Intronic
1165730051 19:38139474-38139496 TCCCCACCTCTGCCCGGGCCTGG + Intronic
1165751268 19:38261800-38261822 GCCCCACTGCACACCAGCCCGGG - Intronic
1165890001 19:39106125-39106147 TCCTCTCTGCTCCTCATGCCTGG + Intronic
1165945376 19:39438485-39438507 TCGCCACTGCACCCTAGGCTGGG + Intronic
1166007534 19:39917683-39917705 CCACCCCTGCTCCCCAGGCTGGG + Intronic
1166007683 19:39918303-39918325 TCCCGCCTGCACCCCAGGCCAGG - Exonic
1166321304 19:42020926-42020948 TCCCCACTGCACTCCAGCCTGGG - Intronic
1166365865 19:42278204-42278226 TCCCGCCTGCTCCCCAGGAGAGG + Intronic
1166366604 19:42281212-42281234 CCCACCCTGCTCTCCAGGCCCGG - Intronic
1166515372 19:43442808-43442830 ACACCACTGCACCCCAGGCTGGG + Intergenic
1166534452 19:43563537-43563559 GTCTGACTGCTCCCCAGGCCAGG + Intronic
1166853333 19:45770627-45770649 TCCCCGCAGGTCCCTAGGCCTGG - Exonic
1166940912 19:46365023-46365045 GCGCCACTGCACCCCAGGCTGGG - Intronic
1166999312 19:46736641-46736663 TCCCTCCCTCTCCCCAGGCCAGG + Intronic
1167166471 19:47802975-47802997 TCCCCTCTGCCCCCCAGGTGTGG - Exonic
1167175372 19:47860785-47860807 TCCCCTCTGCCCCCCAGGTGTGG + Intergenic
1167231625 19:48288449-48288471 GCCCCACTGCTCTCCAGCCTGGG - Intergenic
1167304907 19:48702362-48702384 TCACCACTGCACTCCAGCCCAGG + Intronic
1167343567 19:48931098-48931120 GCACCACTGCTCTCCAGCCCGGG - Intergenic
1167560228 19:50222623-50222645 TCCCCACTCCCCTCCATGCCTGG + Intronic
1167899814 19:52611546-52611568 TCGCCACTGCACCCCAGTCTGGG + Intronic
1167905518 19:52657483-52657505 TCCCCACTGCACTCCAGCCTGGG + Intronic
1167936228 19:52910921-52910943 ACCCCACTGCACTCCAGCCCGGG - Intergenic
1168091576 19:54088992-54089014 TCACCACTGCACTCCAGCCCGGG - Intergenic
1168216567 19:54930417-54930439 ACCCCACTGCACTCCAGGCTGGG + Intronic
1168253205 19:55152840-55152862 TCACCACTGCACTCCAGCCCAGG - Intronic
1168259960 19:55187765-55187787 TCCCCAGTGCCCCACAGGGCAGG - Intronic
1168301870 19:55409401-55409423 TCGCCACTGCACCCCAGCCTGGG + Intergenic
1168418914 19:56188018-56188040 TCCCAACTGCACTCCAGCCCAGG - Intergenic
1168513601 19:56992916-56992938 TCACCACTGCACTCCAGGCTGGG + Intergenic
1168677893 19:58292035-58292057 TCCCCACTGCAAGCCAGCCCTGG - Intronic
924962582 2:46914-46936 TCCCCTCTGCTCCCCCTCCCCGG - Intergenic
924969689 2:114125-114147 ACACCACTGCTCTCCAGCCCGGG + Intergenic
925183288 2:1830717-1830739 CCTCCACAGTTCCCCAGGCCTGG - Intronic
925699833 2:6625109-6625131 GCTCCACTGCACTCCAGGCCTGG + Intergenic
925718264 2:6804631-6804653 TCTCCACTGCTCCTCAAGACCGG + Intergenic
925766599 2:7242379-7242401 TCTCCACTGCCCCCCAGAGCAGG - Intergenic
926116712 2:10218079-10218101 TCCCCACTGCTGCCAGTGCCCGG + Intergenic
926148950 2:10413997-10414019 TCCCCTCTGCTGCCCATGCAAGG + Intronic
926242817 2:11101285-11101307 TCCCAACTTCCACCCAGGCCAGG + Intergenic
926681298 2:15665897-15665919 TCCCCACGCCTCCCCAGCACTGG + Intergenic
927165920 2:20321326-20321348 TCCCCCCCGCTTCCCAGCCCAGG - Intronic
927191301 2:20519031-20519053 TCCTCACTGATCCCCATGGCAGG + Intergenic
927249385 2:20984059-20984081 GCCCCTCTGCTTCCCTGGCCAGG + Intergenic
927672766 2:25082713-25082735 TCCCCACTGTGTCCCAGGGCTGG - Intronic
927853942 2:26516372-26516394 TGCCCACTGCTCCCAAGACACGG - Intronic
927857450 2:26536398-26536420 TCCCCACTGCTATGCAGGACAGG - Intronic
927865449 2:26584785-26584807 TCCCCAGGGCTCCCCACGGCCGG - Intronic
927893534 2:26767161-26767183 CTCTCACAGCTCCCCAGGCCAGG + Intronic
927901871 2:26825911-26825933 ACCCCACTGCACCCCAGCCTGGG - Intergenic
928172070 2:29010398-29010420 TCGCCATTGCTCCCAGGGCCAGG - Intronic
928422631 2:31150804-31150826 ACCCCACTGCACCCCAGCCTGGG - Intronic
928496721 2:31840253-31840275 TCACCACTGCACTCCAGGCTAGG + Intergenic
928511916 2:32010554-32010576 TCCCCGCTGCTGCCCAGCCGGGG + Exonic
928968978 2:37007101-37007123 TACCCACTGCTCCTGATGCCTGG + Exonic
928986001 2:37182294-37182316 TCGCCACTGCTCTCCAGCCTGGG - Intronic
929452672 2:42047798-42047820 TCCGCGCCGCTTCCCAGGCCCGG + Intergenic
929543503 2:42840832-42840854 TCCCCACTGCCCCCCACTGCAGG - Intergenic
929672301 2:43886144-43886166 ACGCCACTGCTCTACAGGCCGGG + Intergenic
930112967 2:47694782-47694804 TCCCCACTGCACTCCAGCCTGGG + Intergenic
930534759 2:52631833-52631855 GCGCCACTGCACCCCAGCCCGGG - Intergenic
931018915 2:58020252-58020274 ACACCACTGCCCTCCAGGCCGGG - Intronic
931051329 2:58418380-58418402 GCCCCACTGCTCTCCAGACTGGG - Intergenic
931527044 2:63168067-63168089 ACGCCACTGCACTCCAGGCCAGG + Intronic
932083056 2:68732676-68732698 TCCCCACTGCTGCTGAGGACTGG + Intronic
932229847 2:70074089-70074111 TCGCCACTGCACTCCAGCCCGGG + Intergenic
932259266 2:70313421-70313443 TCCCCACTGCACTCCAGCCTGGG + Intergenic
932373491 2:71213044-71213066 TCCCCACTGCTCCCCAGGCCAGG - Intronic
932462379 2:71891298-71891320 TCCCCACTGTCCCCCAAGGCAGG - Intergenic
932583762 2:73009366-73009388 TCACCACTCCTCCCCACCCCTGG - Intronic
932587254 2:73038583-73038605 GCCCCACTGCACTCCAGGCCTGG + Intronic
932666293 2:73701375-73701397 TCCTCTCTCTTCCCCAGGCCTGG - Intergenic
932668565 2:73717775-73717797 TCCTCTCTCTTCCCCAGGCCTGG - Intergenic
932941039 2:76165662-76165684 GCGCCACTGCTCTCCAGGCTGGG + Intergenic
933624398 2:84582492-84582514 GCGCCACTGCACTCCAGGCCGGG - Intronic
933805688 2:85996864-85996886 CCCCTCCAGCTCCCCAGGCCTGG - Intergenic
933982310 2:87561196-87561218 ACGCCACTGCTCTCCAGCCCGGG + Intergenic
934679932 2:96276462-96276484 GCCCCACTGCACACCAGCCCAGG - Intronic
934784939 2:96998381-96998403 TCCCCACTGCACTCCAGCCTGGG - Intronic
934876584 2:97926067-97926089 GCGCCACTGCACTCCAGGCCTGG + Intronic
934933501 2:98447068-98447090 GCCCCACTGATCCCCAGCCCAGG + Intronic
935087089 2:99858506-99858528 TCCCCACTGCACTCCAGCCCAGG + Intronic
935274107 2:101461218-101461240 ACGCCACTGCACCCCAGCCCGGG + Intronic
935469506 2:103440136-103440158 ACCCCACTGCACTCCAGGCTAGG + Intergenic
935540893 2:104347414-104347436 GCGCCACTGCTCCCCAGCCTGGG + Intergenic
936262885 2:110977339-110977361 TCGCCACTGCACCCCAGCCTGGG + Intronic
937280807 2:120716104-120716126 TCCCCACTCCTCAGCAGTCCTGG + Intergenic
937307893 2:120883442-120883464 GCACCACTGCACCCCAGCCCAGG + Intronic
937336164 2:121063593-121063615 GCCACACTGCTGCCCTGGCCTGG + Intergenic
937336499 2:121065594-121065616 ACCCCACTGCCACCCAGACCAGG - Intergenic
937349690 2:121153073-121153095 TCACCACTTATGCCCAGGCCTGG - Intergenic
937678436 2:124617846-124617868 TTCCCACTGCACACCAGGCTAGG - Intronic
937911689 2:127078717-127078739 TCCCCACTGCTGCCCCTCCCTGG + Intronic
937943844 2:127312921-127312943 TCCCCATTGCACTCCAGCCCTGG + Intronic
938085393 2:128396546-128396568 TGTCCACAGCTCCCCAGTCCTGG - Intergenic
938103607 2:128514605-128514627 GACCCACTGCTGCCCAGTCCCGG + Intergenic
938171364 2:129079668-129079690 TCCCCACTTCTCCTCACTCCAGG + Intergenic
938339344 2:130525059-130525081 GCGCCACTGCACCCCAGCCCGGG - Intronic
938350495 2:130595693-130595715 GCGCCACTGCACCCCAGCCCGGG + Intronic
938375781 2:130805512-130805534 GCACCACTGCACTCCAGGCCTGG - Intergenic
939342459 2:140915983-140916005 TCGCCACTGCACTCCAGCCCGGG + Intronic
939543037 2:143516990-143517012 GCGCCACTGCCCTCCAGGCCTGG - Intronic
939939791 2:148335674-148335696 GCACCACTGCTCTCCAGGCTAGG + Intronic
940302499 2:152189872-152189894 TTCCCACAGCTCCAAAGGCCTGG + Intergenic
940308174 2:152248386-152248408 ACCCCACTGCACTCCAGGCTGGG + Intergenic
940323393 2:152400391-152400413 GCGCCACTGCACTCCAGGCCTGG + Intronic
940482034 2:154245061-154245083 TCCCCACTGCACTCCAGCCTGGG + Intronic
941523236 2:166574997-166575019 GCACCACTGCACTCCAGGCCTGG + Intergenic
942238195 2:173932947-173932969 GCACCACTGCACTCCAGGCCTGG + Intronic
942754422 2:179322529-179322551 ACGCCACTGCACTCCAGGCCAGG + Intergenic
943359013 2:186895802-186895824 GCACCACTGCTCTCCAGCCCGGG - Intergenic
943380201 2:187135306-187135328 CCCCCACTGCTCGACAGGCCTGG + Intergenic
943672350 2:190676638-190676660 GCCCCACTGCACTCCAGCCCGGG + Intronic
944061260 2:195571119-195571141 TCACCACTGCACCCCAGCCTGGG + Intergenic
944462194 2:199961419-199961441 GCGCCACTGCACCCCAGCCCGGG + Intronic
944711963 2:202342454-202342476 TCCCCACTGCACTCCAGCCTGGG + Intergenic
945066257 2:205949858-205949880 TCACGACTGCTCCCTGGGCCAGG - Intergenic
945069094 2:205973207-205973229 ACATCACTGCTCCCCAGGCTGGG + Intergenic
945306277 2:208261919-208261941 GCCCCACTGCACTCCAGCCCGGG + Intronic
945935292 2:215897728-215897750 ACGCCACTGCACTCCAGGCCTGG - Intergenic
946038814 2:216766243-216766265 GCCCCGCTTCTCCCCAGGGCTGG - Intergenic
946404871 2:219486904-219486926 ACCCCACTGCTCCCCAAGGAGGG - Intronic
946548246 2:220770170-220770192 TCACCACTGCACCCCAGCCTGGG + Intergenic
946713379 2:222528657-222528679 TCACCACTGCACTCCAGCCCAGG - Intronic
947514500 2:230790197-230790219 TCACCACTGCACTCCAGGCCTGG + Intronic
947518936 2:230829158-230829180 TCTGCACTGCACCCCAAGCCAGG - Intergenic
947528528 2:230894064-230894086 TCCCCAGGCCTCCCCAGGCCAGG + Intergenic
947713362 2:232328275-232328297 TCCCCACTAGTCCCCAGGGGAGG + Intronic
947765280 2:232633785-232633807 TCCCCTCGGCGCCCCAGCCCCGG + Exonic
947804813 2:232958876-232958898 CACCCACTCCTCCCCAGGCCTGG + Intronic
948204230 2:236154000-236154022 GCCCCACTGCACCCCCAGCCTGG - Intergenic
948479634 2:238241281-238241303 TCCCCACTACTCACCCGGGCTGG + Intergenic
948484337 2:238270993-238271015 TCCCCACTGCCCCCACGACCCGG + Intronic
948613371 2:239183717-239183739 TCCCCACCGCACCCCTGTCCTGG + Intronic
948791232 2:240377915-240377937 GCCCGACCGCTCCCCAGGGCTGG - Intergenic
948808206 2:240461983-240462005 GGGCCCCTGCTCCCCAGGCCAGG + Intronic
948901472 2:240958737-240958759 TCCCCACTGCACCCCTGCCCAGG - Intronic
948956644 2:241298003-241298025 TCGCTACTGCACTCCAGGCCTGG + Intronic
949010536 2:241675956-241675978 TCCCCAGTGCACCCCAGCTCCGG + Exonic
949021704 2:241744505-241744527 TCCCCACTGCCCCCGACCCCGGG + Intronic
1169127099 20:3136988-3137010 GCCCCACTGCACTCCAGCCCGGG - Intronic
1169159565 20:3365432-3365454 ACGCCACTGCTCCCCAGCCTGGG - Intronic
1169235794 20:3928891-3928913 TCCCCACTGCACTCCAGCCTGGG - Intronic
1169996058 20:11558082-11558104 TCGCCACTGCTCTCCAGCCTGGG - Intergenic
1170198564 20:13716858-13716880 TCGCCACTGCACTCCAGCCCAGG - Intronic
1170367735 20:15616144-15616166 ACACCACTGCACTCCAGGCCCGG - Intronic
1170608939 20:17895702-17895724 TCCCCAGTGCACCCCAGACTTGG + Intergenic
1170665040 20:18379464-18379486 TCCCCACTGCACTCCAGCCTGGG - Intergenic
1170843985 20:19946668-19946690 TCACCACTGCACTCCAGCCCTGG + Intronic
1170969138 20:21102058-21102080 TCAGCACTGCCCTCCAGGCCTGG - Intergenic
1171506683 20:25642108-25642130 GCACCACTGCACTCCAGGCCGGG - Intergenic
1172035398 20:32007207-32007229 TCCCCACTCCTGCCCATGGCAGG + Intergenic
1172055805 20:32153433-32153455 GCCACACTGATCACCAGGCCAGG - Intronic
1172154994 20:32818212-32818234 ACGCCACTGCACTCCAGGCCTGG - Intergenic
1172313466 20:33935392-33935414 GACCCCCTGCTCCCCAGCCCTGG + Intergenic
1172421832 20:34825115-34825137 TCCCGCCTGTTCCCCAGGCCTGG + Intronic
1172589678 20:36108860-36108882 TCCCCACCTCACCCCAGCCCGGG + Intronic
1172992971 20:39049677-39049699 TCCCCACTGCACTCCAGCCTGGG - Intergenic
1173031490 20:39365220-39365242 GCACCACTGCACTCCAGGCCTGG + Intergenic
1173111438 20:40194229-40194251 TCCCTCCTACTCCCCAGGCTAGG - Intergenic
1173135272 20:40433615-40433637 TCCCCAAGCTTCCCCAGGCCAGG - Intergenic
1173519052 20:43685710-43685732 GCCCCACTGCACCCCAGCCTGGG + Intronic
1173586467 20:44186811-44186833 TCACCACTGCACCCCAGGAGGGG + Exonic
1173635181 20:44549780-44549802 GCCCCACTGCACCCCAGCCTGGG + Intronic
1173734520 20:45349687-45349709 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1173840321 20:46152780-46152802 GCACCACTGCACTCCAGGCCTGG - Intergenic
1173965913 20:47112912-47112934 TCACCACTGCACTCCAGCCCGGG - Intronic
1174030388 20:47619836-47619858 CCGCCACTGCACTCCAGGCCTGG - Intronic
1174250921 20:49218969-49218991 TCTCCACTGCACCCCAGCCTGGG + Intergenic
1174463132 20:50697321-50697343 TCACCATTGCACCCCAGCCCGGG - Intergenic
1175229633 20:57465578-57465600 CCACTACTGCTACCCAGGCCAGG + Intergenic
1175269730 20:57725374-57725396 TGGCCACTGCTTCCCACGCCAGG + Intergenic
1175949646 20:62576524-62576546 GCCCCACAACTACCCAGGCCAGG - Intergenic
1176143289 20:63554306-63554328 TCCCCTTGGCTCCCCTGGCCCGG - Exonic
1176875748 21:14125598-14125620 GCGCCACTGCTCTCCAGGCTGGG - Intronic
1177047564 21:16189483-16189505 GCCCCACTGCACTCCAGCCCAGG - Intergenic
1177697897 21:24597345-24597367 TCCCCACTGCACTCCAGCCTGGG - Intergenic
1177871096 21:26573306-26573328 CCCCGACTCCTCCCCAAGCCCGG + Intergenic
1177915975 21:27088604-27088626 TCCCCACTGCACTCCAGCCTGGG - Intergenic
1178132487 21:29589462-29589484 TCCCCACTGCACTCCAGGCTGGG - Intronic
1178332261 21:31708335-31708357 GCGCCACTGCACGCCAGGCCAGG + Intronic
1178415760 21:32403789-32403811 TCCCCACCTCTCCCCAGCCCTGG - Intergenic
1178597691 21:33969607-33969629 GTCCCACTGCTTCCCTGGCCTGG + Intergenic
1178684310 21:34699292-34699314 TCCCCACTGCACTCCAGCCTGGG - Intronic
1178839910 21:36130160-36130182 TCCCCGCTGCTGCCCAGCCGGGG - Intergenic
1178857341 21:36261320-36261342 TCACCACTGCTCTCCAGCCTGGG + Intronic
1178950127 21:36979227-36979249 GCGCCACTGCCCTCCAGGCCTGG + Intronic
1179142411 21:38737570-38737592 TCACCACTGCACTCCAGACCAGG + Intergenic
1179199924 21:39207384-39207406 TCACCACTGCTCTCCAGCCTGGG + Intronic
1179207434 21:39295227-39295249 GCCCCACTGCTCTCCAGCCTGGG - Intronic
1179397298 21:41053008-41053030 TCCCCACTGCACCCCTGGATGGG + Intergenic
1179677499 21:42993773-42993795 GCACCACTGCACTCCAGGCCAGG - Intronic
1179817095 21:43913541-43913563 ACCCCACTGCACCCCAGCCTGGG + Intronic
1179902172 21:44399948-44399970 TCCCCAGGCCTCCCTAGGCCTGG - Intronic
1180549177 22:16527798-16527820 CCCCTACTGCTGCCCTGGCCTGG + Intergenic
1181238642 22:21463603-21463625 GCGCTACTGCTCCCCAGCCCGGG + Intergenic
1181312969 22:21955450-21955472 TCCTCATTGCTCCCAAGGCCAGG + Intergenic
1181330671 22:22088182-22088204 TTCCCTCTGCTCTCTAGGCCTGG + Intergenic
1181346076 22:22221522-22221544 TCCTCATTGCTCCCAAGGCCAGG + Intergenic
1181695550 22:24591120-24591142 GCACCACTGCGCCCCAGCCCGGG - Intronic
1181717198 22:24740007-24740029 TGCCCACTGCACCCCAGCCTGGG + Intronic
1181813226 22:25418083-25418105 GCACCACTGCACCCCAGGCTGGG - Intergenic
1181823385 22:25493568-25493590 ACCCCACAGCTCTGCAGGCCAGG - Intergenic
1181951135 22:26554553-26554575 TCCCCACTGACCCCCAACCCAGG - Intronic
1182119855 22:27779584-27779606 TCCACACTGCACCCCTGGGCAGG + Intronic
1182139282 22:27938896-27938918 GCACCACTGCACTCCAGGCCAGG + Intergenic
1182166455 22:28179200-28179222 GCACCACTGCACTCCAGGCCTGG - Intronic
1182300772 22:29335710-29335732 GCCCATCTGCTCCCCAGGCTTGG + Intronic
1182472568 22:30557454-30557476 CCCCCAAGGCTGCCCAGGCCTGG + Intronic
1182520185 22:30880702-30880724 ATCTCACTGCTCCCCAGGCCAGG - Intronic
1182648751 22:31833103-31833125 ACTCCACTGCTCCCCAGCCTGGG - Intronic
1182726328 22:32448892-32448914 GCCCCACTGCACACCAGCCCGGG + Intronic
1183302434 22:37064933-37064955 TCCCCACTGCTCCTGGGGTCAGG + Intergenic
1183323909 22:37181069-37181091 TACCCACTGCTCCCCAAGGCTGG - Exonic
1183391287 22:37546810-37546832 ACCCCACTGCCACCAAGGCCTGG + Intergenic
1183477418 22:38043124-38043146 GGCCCCTTGCTCCCCAGGCCAGG - Intergenic
1183510315 22:38230788-38230810 ACCCCACTGTTCCCAAGTCCTGG - Intronic
1183616429 22:38948618-38948640 TCCCCGCTGCTGGCCAGCCCTGG + Intergenic
1183616629 22:38949931-38949953 TCCCCACTGCTGGCCAGCCCTGG + Intergenic
1183755489 22:39758465-39758487 GCCCCACTGCACCCCAGCCTGGG - Intronic
1183787038 22:40035546-40035568 TCACCATGGATCCCCAGGCCGGG - Exonic
1183861745 22:40675276-40675298 TCACCACTGCACCCCAGCCTGGG + Intergenic
1183870334 22:40736971-40736993 GCCCCAAGGCTGCCCAGGCCCGG - Intergenic
1183955373 22:41377038-41377060 ACCACACTGCTCTCCAGCCCAGG - Intronic
1184066503 22:42124658-42124680 TCCCCTCCCCTCCCCAGGTCAGG - Intergenic
1184068971 22:42136810-42136832 TCCCCTCCCCTCCCCAGGTCAGG - Intergenic
1184116063 22:42423068-42423090 TCGCCACTGCACTCCAGGCTAGG + Intronic
1184267497 22:43357005-43357027 TCCCCACAGCTGCGCATGCCGGG + Intergenic
1184339744 22:43879730-43879752 ACGCCACTGCACCCCAGCCCAGG - Exonic
1184341787 22:43890152-43890174 TCCCAACTGCTACACAGGCAAGG - Intronic
1184380917 22:44144323-44144345 TCCCCACTGCCACCCAGCCCTGG - Intronic
1184467060 22:44674901-44674923 TCGCCACTGCACTCCAGCCCAGG + Intronic
1184533447 22:45071156-45071178 TCCTCCCTGATGCCCAGGCCAGG + Intergenic
1184686170 22:46097344-46097366 TGCCCATCTCTCCCCAGGCCTGG - Intronic
1185045604 22:48527273-48527295 CCCCAACTGCAGCCCAGGCCTGG + Intronic
1185073577 22:48670413-48670435 TACCCAGTGCCCACCAGGCCTGG - Intronic
1185128148 22:49023119-49023141 ACCCCACTGCACCCCAAGCCCGG + Intergenic
1185129401 22:49029760-49029782 ACACCACTGCTCCCCAGCCTGGG - Intergenic
1185139689 22:49093392-49093414 CCCCCACCGGTCCCCACGCCTGG + Intergenic
1185183990 22:49381697-49381719 GCCCCACTGTTCCCCAGCTCAGG + Intergenic
1185208948 22:49555836-49555858 TGCCCACCACTCCCCAGCCCAGG + Intronic
1185233814 22:49699711-49699733 TCCTTGCTGCTCCACAGGCCCGG + Intergenic
1185275519 22:49948874-49948896 TCCCCGCTGTCCCCCAGCCCTGG + Intergenic
1185341854 22:50294549-50294571 TCCCCACTTCCATCCAGGCCAGG + Intronic
1185380176 22:50504336-50504358 TTACCCCTGCTCCCCAGGCTGGG + Exonic
949323138 3:2834099-2834121 TCGCCACTGCTCTCCAGCCTGGG + Intronic
949364109 3:3262129-3262151 ACGCCACTGCACCCCAGGCTGGG - Intergenic
949531799 3:4963031-4963053 GCACCACTGCACCCCAGGCTGGG + Intergenic
950306758 3:11921312-11921334 TCCCCACTGCACTCCAGGCTGGG - Intergenic
950423242 3:12910890-12910912 GGCCCCCTGCTCCCCAGCCCAGG + Intronic
950518680 3:13483414-13483436 TCCCCACTGACCTCAAGGCCAGG - Intronic
951230726 3:20175754-20175776 GCACCACTGCTCTCCAAGCCTGG + Intronic
951231170 3:20181112-20181134 ACACCACTGCACCCCAGGCTGGG + Intronic
952196042 3:31076195-31076217 TCCCCACTGAGCCCCTGGACTGG + Intergenic
952278385 3:31900066-31900088 TCACCACTGCACCCCAGCCTGGG - Intronic
952357687 3:32599928-32599950 TCCCCAATGCTGACCAGGCATGG - Intergenic
952784980 3:37144111-37144133 TCACCACCACTGCCCAGGCCAGG - Intronic
953050948 3:39342724-39342746 ACCCCACTGCACTCCAGCCCGGG + Intergenic
953158246 3:40394613-40394635 TCCCTTCTGTTCCCAAGGCCAGG + Intronic
953289736 3:41649430-41649452 ACCCCTGTGCTCTCCAGGCCTGG + Intronic
953606400 3:44415747-44415769 TCCCTAGTGAGCCCCAGGCCTGG - Intergenic
953773072 3:45793587-45793609 TCCTTCCTGCTCCCCAGGCCAGG - Intronic
953804722 3:46058588-46058610 TCACCACTGCACTCCAGCCCTGG - Intergenic
953904404 3:46861232-46861254 TCCTCACTGCTACCCCTGCCAGG - Intronic
953984472 3:47430823-47430845 TCCCGACTGCAGCCCAGGCGTGG - Intronic
954042295 3:47897897-47897919 CCACCACTGCACTCCAGGCCAGG + Intronic
954222086 3:49161113-49161135 TCGCCACTGCACTCCAGGCTGGG - Intergenic
954253601 3:49387694-49387716 ACACCACTGCACCCCAGCCCGGG + Intronic
954261440 3:49441934-49441956 TCGCCACTGCACTCCAGCCCAGG + Intergenic
954380336 3:50215828-50215850 TCCCCTCCCCTCCCCACGCCAGG - Intronic
954409290 3:50363385-50363407 TCCCCACTGGCCCCCAGGCTGGG + Intronic
954581496 3:51705640-51705662 ACCCCTCTGCTCCAGAGGCCTGG + Intergenic
954581957 3:51707696-51707718 CCCCCTCAGCTCCCCAGGGCAGG - Intronic
954691087 3:52395979-52396001 GCACCACTGCACCCCAGCCCCGG - Intronic
954721599 3:52568925-52568947 TCACCACTGCACTCCAGGCTGGG - Intronic
954752730 3:52822887-52822909 CCCTCCCTGATCCCCAGGCCAGG + Intronic
954921599 3:54195656-54195678 TCCCCACGTCTCCCTAGACCTGG - Intronic
955484213 3:59419291-59419313 TCCTCACTGCCCCCCAACCCTGG - Intergenic
955601902 3:60654364-60654386 TCCCCATTGCTCTCCAGGGTTGG - Intronic
956092268 3:65680457-65680479 GCACCACTGCTCCCCAGCCTGGG - Intronic
956790122 3:72673695-72673717 GCCCCACTGCTCCCTAGGGTGGG - Intergenic
957819165 3:85347682-85347704 TCCCCACTGCACTCCAGCCTAGG - Intronic
959067280 3:101670662-101670684 TACCCACTGCTCTCCAGACGGGG - Intronic
959476856 3:106822144-106822166 TCCCCACTGCTCACCAGTCGTGG + Intergenic
959500990 3:107105905-107105927 TCACCACTGCACTCCAGGCTGGG - Intergenic
959557031 3:107732093-107732115 GCAACACTGCACCCCAGGCCTGG - Intronic
959706725 3:109344907-109344929 TCACCACTGCACCCCAGCCTGGG - Intergenic
959777313 3:110182352-110182374 TCACCACTGCACTCCAGCCCCGG - Intergenic
960397450 3:117154537-117154559 GCGCCACTGCACCCCAGGCTGGG - Intergenic
960530028 3:118753711-118753733 GCGCCACTGCTCCCCAGCCTGGG + Intergenic
961236176 3:125369938-125369960 GCACCACTGCTCCCCAGCCTGGG + Intronic
961394583 3:126578219-126578241 GCCCCCCTGCTCCACAGCCCCGG - Intronic
961408390 3:126699726-126699748 TCACCACTGCACTCCAGCCCTGG - Intergenic
961537100 3:127576933-127576955 TCCCCAGCCCACCCCAGGCCAGG + Intronic
961787644 3:129357273-129357295 GCCCCATTGGTCACCAGGCCTGG - Intergenic
961915009 3:130365318-130365340 TCGCCACTGCTCTCCAGCCTGGG - Intronic
962225617 3:133604874-133604896 GCCCCACTGCACTCCAGGCTGGG + Intronic
962276442 3:134018226-134018248 TGCCCACTCCTCCCCAGGGGTGG - Intronic
962408354 3:135119493-135119515 GCCCCACTGCACCCCAGCCTGGG - Intronic
963472490 3:145759442-145759464 GCGCCACTGCACCCCAGGCTGGG - Intergenic
964121783 3:153192750-153192772 CAACCACTGCACCCCAGGCCTGG - Intergenic
965173378 3:165298095-165298117 TCCCCACTGCACTCCAGCCTGGG - Intergenic
966402321 3:179561063-179561085 TCCCCACTGCACTCCAGCCTGGG - Intergenic
966534536 3:181016965-181016987 TTGCCACTGCTCTCCAGGCTGGG + Intergenic
967052043 3:185793859-185793881 ACCTTACTGCTCCCCAGGCAGGG - Intronic
967103709 3:186238251-186238273 ACACCACTGCACTCCAGGCCAGG + Intronic
967817510 3:193811892-193811914 TCACCACAGCTCCCTAGCCCCGG + Intergenic
968028123 3:195460198-195460220 TTCCCACTGCTGCCGATGCCTGG + Intergenic
968255238 3:197263742-197263764 TCACCACTGCACTCCAGGCTGGG + Intronic
968431022 4:558859-558881 GCGCCACTGCACCCCAGGCTGGG + Intergenic
968472767 4:789659-789681 TCCCTCCTGCTCCCTGGGCCCGG + Intronic
968481070 4:833350-833372 GGCCCACAGCTCCACAGGCCTGG + Intergenic
968511842 4:999160-999182 GCGCCACTGCACCCCAGGCTGGG + Intronic
968656212 4:1779512-1779534 TGCCCCCTTCTCCCCACGCCAGG - Intergenic
968703738 4:2068852-2068874 CCCCCTGTGCTCCCCAAGCCTGG - Exonic
968900724 4:3430605-3430627 CTCCCACTGCTCGCCAGGCTGGG - Exonic
968905197 4:3447671-3447693 GGCCCTGTGCTCCCCAGGCCAGG + Intronic
969329936 4:6468670-6468692 TCATCACTGCTGCCCAGGGCAGG + Intronic
969330445 4:6471339-6471361 TCCCCACTGTTCCCCTAGCGAGG + Intronic
969345457 4:6567140-6567162 TCCCCACTTCTGCCCCGGCCGGG + Intergenic
969525835 4:7703609-7703631 CCCTCCCTGCTCCCCAGGCTGGG - Intronic
969608145 4:8212452-8212474 TCCCCACCACTCCACAGGACAGG + Intronic
969633196 4:8350519-8350541 TCCCCTCTGTTCCCCTGACCAGG - Intergenic
969644052 4:8416224-8416246 TCCTCTCTGCACCCCAGGACAGG - Intronic
971326685 4:25650313-25650335 TTGCCACTGCTCCCCAGCCTGGG - Intergenic
971331704 4:25686756-25686778 TCCCCATTGGTGGCCAGGCCTGG - Intergenic
971374064 4:26041986-26042008 TCACCACTGCACCCCAGTCTGGG + Intergenic
971611952 4:28737061-28737083 TCCCCACTGCACTCCAGCCTGGG + Intergenic
971808835 4:31396671-31396693 TCGCCACTGCACTCCAGCCCGGG + Intergenic
971925882 4:33009112-33009134 GCGCCACTGCACCCCAGGCTGGG - Intergenic
972173256 4:36374336-36374358 GCGCCACTGCACCCCAGGCTGGG - Intergenic
972593269 4:40508021-40508043 ACCCCACTGCACCCCAGCCTGGG + Intronic
973070475 4:45852083-45852105 TCTCCACTGCACTCCACGCCAGG - Intergenic
973767940 4:54180803-54180825 TCCCCACTGCACTCCAGCCTGGG - Intronic
973895069 4:55404083-55404105 TGCCCACTGCACTCCAGGCTGGG - Intronic
974321783 4:60359090-60359112 ACACCACTGCACTCCAGGCCGGG + Intergenic
975632725 4:76418986-76419008 TTCCCTCTTTTCCCCAGGCCTGG + Intronic
975680347 4:76869227-76869249 GCCCCACTGCTCTCCAGCCTGGG + Intergenic
975852720 4:78588788-78588810 TCCCCTCTACTCCCCAGTACTGG + Intronic
975903929 4:79187334-79187356 GGCCCACTGCTGCCCAGGGCTGG + Intergenic
976270838 4:83229054-83229076 ACCCCACTGCACCCCAGCCTGGG - Intergenic
976275944 4:83277924-83277946 GCACCACTGCACTCCAGGCCTGG + Intronic
976355007 4:84106818-84106840 GCCCCACTGCACTCCAGCCCAGG - Intergenic
976625901 4:87181361-87181383 GCGCCACTGCTCCCCAGCCTGGG + Intronic
976793707 4:88909426-88909448 TCCCCACTCCTCCCAACCCCTGG - Intronic
977405843 4:96597601-96597623 GCGCCACTGCTCCCCAGCCTGGG + Intergenic
978759649 4:112343003-112343025 TCCCTTCAGCTCCCCAGTCCTGG + Intronic
979127049 4:116986890-116986912 TCGCCACTGCACCCCAGCCTGGG - Intergenic
979279330 4:118847588-118847610 TCCCCACTGCACTCCAGCCTGGG - Intergenic
979734679 4:124068627-124068649 TCCCCACATCTCCCCAGTCTTGG - Intergenic
980113980 4:128661719-128661741 TCCCCACTCCTCCCCACCCCAGG + Intergenic
980230039 4:130037216-130037238 GCGCCACTGCTCTCCAGGCCGGG + Intergenic
980905344 4:138943166-138943188 TCGCCACTGCACTCCAGCCCAGG + Intergenic
981268643 4:142818209-142818231 TCCCCCCTACTCCCCTGCCCTGG + Intronic
982231230 4:153210105-153210127 TCGCCACTGCTCTCCAGCCTGGG - Intronic
982250444 4:153400775-153400797 TTCCCACTTCTCTCCAGGCCTGG - Intronic
982488506 4:155999050-155999072 TGCCCACTGCTCTCCAGCCTGGG - Intergenic
983637193 4:169909825-169909847 CCAGCACTGCTCCCCAGGGCTGG - Intergenic
984434770 4:179695583-179695605 GCGCCACTGCACCCCAGGCTGGG - Intergenic
984601423 4:181731394-181731416 TCACCACTGCACTCCAGCCCGGG - Intergenic
984731762 4:183075118-183075140 TGCCCACTGCACTCCAGCCCGGG + Intergenic
984804636 4:183739949-183739971 TCACCACTGCACCCCAGCCTGGG - Intergenic
984934432 4:184877995-184878017 TCGCCACTGCACTCCAGCCCGGG - Intergenic
985049012 4:185971172-185971194 TCACCACTGCACTCCAGCCCAGG + Intergenic
985064254 4:186105331-186105353 TCCCCACTGCTCCCGCGGCGCGG - Intronic
985282147 4:188298343-188298365 GCCCCACTGCACTCCAGGCTCGG - Intergenic
985656620 5:1135082-1135104 TCACCACTGCACCCCAGCCTGGG + Intergenic
986026851 5:3859129-3859151 TCACCCCTGCTCCCCTGGCTGGG + Intergenic
986722473 5:10569551-10569573 GCACCACTGCGCCCCAGGCTGGG + Intronic
986769319 5:10957451-10957473 TCGCCACTGCTCTCCAGCCTGGG + Intergenic
987049794 5:14139925-14139947 TCGCCACTGCTCTCCAGCCTGGG - Intergenic
987123551 5:14790648-14790670 GCACCACTGCTCCCCAGCCTGGG - Intronic
987418644 5:17692214-17692236 TCCCCTCTGCGCCTCAGACCAGG + Intergenic
987626093 5:20402863-20402885 GCACCACTGCACCCCAGGCTGGG + Intronic
987673561 5:21045418-21045440 ACGCCACTGCACCCCAGCCCGGG - Intergenic
988262418 5:28905666-28905688 TTGCCACTGCACTCCAGGCCGGG - Intergenic
988547422 5:32171903-32171925 GCGCCACTGCACTCCAGGCCTGG + Intronic
988573944 5:32400809-32400831 GCACCACTGCACTCCAGGCCTGG + Intronic
989384090 5:40837409-40837431 GCACCACTGCACTCCAGGCCAGG - Intergenic
989671276 5:43919493-43919515 TCCCCACTGCACTCCAGCCTGGG - Intergenic
989759854 5:45000389-45000411 TCCCCACTGCACTCCAGTCTGGG + Intergenic
990456012 5:55988721-55988743 TCGCCACTGCACTCCAGCCCAGG + Intronic
990557473 5:56951342-56951364 TCCCCCCAGCTCACCAGTCCCGG + Intronic
991424649 5:66478433-66478455 ACCCCACTGCACCCCAGCCTGGG - Intergenic
991707549 5:69372652-69372674 ACCCCACTGCACTCCAGCCCGGG - Intronic
991726099 5:69537238-69537260 ACACCACTGCACCCCAGGCTGGG - Intronic
991868857 5:71090634-71090656 ACACCACTGCACCCCAGGCTGGG + Intergenic
991960015 5:72035053-72035075 TGCAGACAGCTCCCCAGGCCTGG + Intergenic
992074467 5:73177896-73177918 TCCCTTCTGCTCTGCAGGCCAGG + Intergenic
992559352 5:77934883-77934905 TCCCCACTGCACTCCAGCCTGGG - Intergenic
992759084 5:79935668-79935690 TCGCTACTGCTCCCTCGGCCTGG + Intergenic
992819754 5:80484630-80484652 TAGCCACTGCACCCTAGGCCTGG - Intergenic
992841578 5:80700336-80700358 TCCCCACTGCACTCCAGTCTGGG + Intronic
993281071 5:85924912-85924934 TCCCCACTGCACTCCAGCCTGGG + Intergenic
993308494 5:86298687-86298709 TCCCCAGTGTTCCCTAGCCCTGG + Intergenic
993320695 5:86465353-86465375 TCCCAGCCGCTCCCCAGGCCTGG + Intergenic
995234888 5:109817121-109817143 TCCCCACTGCACTCCAGCCTGGG + Intronic
996381426 5:122866190-122866212 TCGCCACTGCACCCCAGCCTGGG - Intronic
996713350 5:126565348-126565370 TCCCCACTGCACTCCAGCCTGGG + Intronic
997085256 5:130789791-130789813 ACACCACTGCCCTCCAGGCCAGG + Intergenic
997118175 5:131148257-131148279 TCCCCACTGCACTCCAGCCTGGG + Intergenic
997143635 5:131409172-131409194 TCCCCATTTCTCCCTACGCCTGG + Intergenic
997166483 5:131665630-131665652 TCACCATTGCACTCCAGGCCAGG - Intronic
997243195 5:132323586-132323608 TATTCACTGCTCCTCAGGCCGGG - Intronic
997306558 5:132841355-132841377 TCGCCACTGCACTCCAGGCTGGG - Intergenic
997335147 5:133102777-133102799 TCACCACTGCACCCCAGCCTGGG - Intronic
997379092 5:133422386-133422408 TCCTCAGTGCCCCCCAGTCCAGG - Intronic
997517003 5:134497042-134497064 TCGCCACTGCACCCCAGCCTGGG + Intergenic
997711648 5:136009453-136009475 CCCACACTGCTCCACAGGTCAGG + Intergenic
997733027 5:136194325-136194347 TTCCCACTGCACCTCATGCCTGG + Intergenic
997811178 5:136972012-136972034 TCACCACTGCTCTCCAGCCTGGG - Intergenic
997988615 5:138525198-138525220 GCCCCACTGCACTCCAGCCCGGG - Intronic
998839242 5:146235720-146235742 TCCCCACTGCACTCCAGCCTAGG - Intronic
998879800 5:146634375-146634397 GCCCCACTGCACCCCAGCCTTGG - Intronic
999439459 5:151590350-151590372 GCCTCACTGCTCCCCATGCTGGG + Intergenic
1000075188 5:157777957-157777979 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1000317489 5:160106865-160106887 TCCCCACTGCACTCCAGCCTGGG - Intronic
1001051535 5:168418289-168418311 TCCCCACTGCTCCCCAGAGCTGG + Intronic
1001342383 5:170859813-170859835 GCACCACTGCACTCCAGGCCAGG - Intergenic
1001391615 5:171384067-171384089 ACCCCACTGCACTCCAGGCTGGG + Intergenic
1001633056 5:173190933-173190955 TCACCACTGCACTCCAGCCCGGG - Intergenic
1001669780 5:173464054-173464076 GCCCCACTGCACTCCAGCCCGGG - Intergenic
1001728592 5:173930095-173930117 TCGCCACTGCTCTCCAGCCTGGG - Intronic
1001747571 5:174103528-174103550 TCCCCACCGCGCCCCAGCACTGG - Intronic
1001757346 5:174180795-174180817 TGCCCACTGGTCCCCAGGGGAGG + Intronic
1002088592 5:176791483-176791505 TCCCCAGTCCTTCCCAGCCCAGG + Intergenic
1002131047 5:177081971-177081993 GCCCCACTGCAGCCCGGGCCTGG - Intergenic
1002354085 5:178609864-178609886 GCACCACTGCACTCCAGGCCAGG + Intronic
1002555998 5:180041088-180041110 TCCTCACTGGCCCCCAGTCCAGG - Intronic
1003006043 6:2382493-2382515 TCCCCGCCGCTCCCCTGTCCTGG + Intergenic
1003706545 6:8537927-8537949 TCACCACTGCACTCCAGGCTGGG - Intergenic
1003817471 6:9858180-9858202 GCACCACTGCTCTCCAGGCTGGG + Intronic
1003944052 6:11057535-11057557 TGCCCACTGCACTCCAGCCCGGG - Intergenic
1004148681 6:13093912-13093934 GCACCACTGCACCCCAGCCCGGG - Intronic
1004331091 6:14721976-14721998 GCCCCACTGCACCCCAGCCTGGG + Intergenic
1004669867 6:17785589-17785611 TACCCACTGCTCCACAAGCTGGG + Exonic
1005098677 6:22146215-22146237 TCCCTCCTGCTCCCCCTGCCTGG + Intergenic
1005479535 6:26242055-26242077 GCGCCACTGCACTCCAGGCCTGG + Intergenic
1005487877 6:26318472-26318494 CCACCACTGCACCCCAAGCCTGG + Intergenic
1005488499 6:26323988-26324010 TCACCACTGCACTCCAGCCCTGG - Intergenic
1005495015 6:26380850-26380872 TCCCAACAGCTGCCCAGTCCTGG + Intergenic
1005604732 6:27464972-27464994 GCCCCACTGCACTCCAGGCTGGG + Intronic
1005919078 6:30382588-30382610 GCACCACTGCTCTCCAGGCTGGG + Intergenic
1006034743 6:31202537-31202559 CCCCCACAGCTGCCCAGCCCTGG - Exonic
1006133227 6:31880971-31880993 ACCCTGCTGCTCCCCAGGGCTGG - Intronic
1006537852 6:34714728-34714750 ACACCACTGCTCCACAGCCCAGG + Intergenic
1007072039 6:39045031-39045053 TCGCCACTGCACTCCAGCCCTGG + Intergenic
1007495870 6:42260070-42260092 CCCCCATTGCTCCCCAGGGACGG + Intronic
1007613227 6:43163912-43163934 TCACCACTGCACTCCAGGCTGGG + Intergenic
1007990439 6:46249613-46249635 TGCCCACCCCTCCCTAGGCCTGG - Intronic
1008054363 6:46931009-46931031 ACACCACTGCACCCCAGGCTGGG + Intronic
1008691003 6:53978558-53978580 GCCCCACTGCTCTCCAGCCTGGG - Intronic
1008790557 6:55226759-55226781 TCACCACTGCACTCCAGGCCTGG - Intronic
1008929549 6:56924079-56924101 ACGCCACTGCTCTCCAGCCCGGG + Intronic
1009914321 6:69974351-69974373 GCCACACTCCTCCCCAGGGCTGG - Intronic
1010204255 6:73308872-73308894 GCGCCACTGCTCTCCAGGCTGGG - Intronic
1010489012 6:76452329-76452351 ACCTCACGGCTCCCCACGCCAGG - Intergenic
1010750539 6:79612256-79612278 TCACCACTGCACTCCAGGCCAGG + Intergenic
1010787758 6:80024584-80024606 TCCCCACTGCTCCCAGCCCCTGG - Intronic
1010866044 6:80977851-80977873 TCGCCACTGCTCTCCAGCCTGGG + Intergenic
1011045782 6:83081162-83081184 ACACCACTGCACCCCAGCCCGGG - Intronic
1011051277 6:83152911-83152933 CCTCCACCCCTCCCCAGGCCGGG - Intronic
1011606443 6:89110823-89110845 TTCCCACTGTTGCCCAGGCATGG + Intronic
1011624090 6:89269500-89269522 TCCCCACTGGCCACCAGGCCAGG - Intronic
1012689108 6:102292290-102292312 GGCCCACTGCTCAACAGGCCAGG - Intergenic
1012897025 6:104961441-104961463 TCACCACTGCACTCCAGCCCGGG - Intronic
1012930094 6:105307653-105307675 TCACCACTGCACCCCAGCCTGGG - Intronic
1013457307 6:110342277-110342299 TCCCAACAGCTCCCCAGGCATGG - Intronic
1013718435 6:112991881-112991903 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1013791697 6:113844444-113844466 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1014010856 6:116473853-116473875 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1014801075 6:125778491-125778513 TCTCCACTGTTCCCCAGCGCAGG + Intergenic
1015192563 6:130487318-130487340 TCGCCACTGCACTCCAGGCTGGG + Intergenic
1015900289 6:138058309-138058331 TCCCCACTGCACTCCAGCCTGGG - Intergenic
1016060041 6:139620712-139620734 TCCCCACTGCACTCCAGCCTGGG - Intergenic
1017021166 6:150141880-150141902 TCGCCACTGCTCCCCAGCCTGGG + Intergenic
1017145876 6:151234437-151234459 TCCCCACTGCACTCCAGCCTGGG - Intergenic
1017736608 6:157370561-157370583 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1017756286 6:157532049-157532071 TCCCCAGTGCTTCCATGGCCAGG - Intronic
1017761703 6:157574378-157574400 GCGCCACTGCACCCCAGGCTGGG + Intronic
1018065037 6:160118769-160118791 TCCCCACTAGTCCCCATCCCAGG - Intergenic
1018146960 6:160900502-160900524 GCCCCACTCCTCACCAGGCAGGG + Intergenic
1018694607 6:166382300-166382322 TCCCCACTGCCACTCTGGCCGGG + Intronic
1019121774 6:169809845-169809867 TCCACAACCCTCCCCAGGCCAGG - Intergenic
1019176448 6:170161683-170161705 GCCCCACTGCACTCCAGCCCAGG - Intergenic
1019209137 6:170390898-170390920 TCCACACTGTTCCCAAGGCGAGG - Intronic
1019395936 7:817478-817500 TCCCCAGGGCTCCCCAGGACAGG + Intronic
1019413771 7:918257-918279 GCACCACTGCACTCCAGGCCGGG - Intronic
1019434960 7:1017804-1017826 CCCCCACTGCACACAAGGCCAGG + Intronic
1019525987 7:1480781-1480803 GCCCCACCCCTCCCCAGGCTGGG + Intronic
1019603172 7:1895426-1895448 TGCCCAGAGCTCCCCATGCCAGG + Intronic
1019703693 7:2487582-2487604 CCCACACCACTCCCCAGGCCTGG - Intergenic
1020231381 7:6321590-6321612 TCGCCACTGCACCCCAGCCTGGG + Intergenic
1020280681 7:6648487-6648509 CCTCCACTGCTCCCCGGGTCAGG - Intronic
1020661260 7:10986009-10986031 ACACCACTGCACCCCAGTCCAGG - Intronic
1021204201 7:17759877-17759899 ACCCCACTGCACTCCAGGCTGGG + Intergenic
1021221390 7:17978770-17978792 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1021387161 7:20045262-20045284 GCGCCACTGCACCCCAGCCCGGG + Intergenic
1021670747 7:23032689-23032711 GCTCCACTGCACCCCAGCCCGGG - Intergenic
1021704766 7:23355888-23355910 GCCCCACTGCACCCCAGCCTAGG + Intronic
1021908911 7:25364621-25364643 TCACCACTGCTCTCCAGCCTGGG - Intergenic
1022014565 7:26338467-26338489 ACGCCACTGCACTCCAGGCCTGG - Intronic
1022235286 7:28454850-28454872 TCTCCACTGCCCACCAGCCCTGG - Intronic
1022373674 7:29792889-29792911 TCACCACTGCACTCCAGCCCGGG + Intergenic
1022575991 7:31497682-31497704 CCACCACTGCTCCCCAGGAATGG + Intergenic
1022691174 7:32656772-32656794 TCCCTACTGTCCCCCAGGTCTGG + Intergenic
1022731672 7:33032377-33032399 TCGCCACTGCACTCCAAGCCTGG + Intronic
1022794134 7:33718672-33718694 TACTCACTTCTCCCCAGGACAGG + Intergenic
1023200048 7:37687158-37687180 TTCCCACAGCTACCCAGGGCAGG + Intronic
1023425561 7:40032097-40032119 ACACCACTGCACTCCAGGCCTGG - Intronic
1023874940 7:44281843-44281865 TGCCCACTGCTCTCCCGGCCAGG + Intronic
1023886347 7:44359988-44360010 TCCCCACTCATCACCAGACCAGG - Intergenic
1023990175 7:45124090-45124112 TCCCCACCACCCCCCTGGCCGGG - Intergenic
1024197575 7:47074024-47074046 TCCCCAAAGCTGCCCAGGTCAGG - Intergenic
1024273755 7:47660825-47660847 GCGCCACTGCACCCCAGGCTGGG + Exonic
1024283736 7:47739470-47739492 TCCCCACTGTGGCCCAGGTCAGG - Intronic
1024478208 7:49836594-49836616 TCCCCACTGCACTCCAGCCTGGG + Intronic
1025059383 7:55791564-55791586 TCGCCACTGCTCTCCAGCCTGGG + Intergenic
1025107486 7:56184295-56184317 TCCCCACTGCACTCCAGCCTGGG - Intergenic
1025716419 7:63961492-63961514 CCCCCACTGCACTCCAGGCTGGG + Intergenic
1025941236 7:66077379-66077401 TCACCACTGCACTCCAGCCCAGG + Intronic
1026053503 7:66966084-66966106 ACCCCACTGCACCCAAGGCTGGG + Intergenic
1026406135 7:70067809-70067831 ACACCACTGCTCCCCAGCCCAGG + Intronic
1026485062 7:70810949-70810971 GCACCACTGCTCCCCAGCCTGGG - Intergenic
1026707128 7:72703810-72703832 TCACCACTGCACTCCAGGCTGGG + Intronic
1026910280 7:74087630-74087652 GCGCCACTGCTCCCCAGCCTGGG - Intronic
1027045923 7:74991429-74991451 TACCCACCCCACCCCAGGCCAGG + Intronic
1027136642 7:75629209-75629231 TGCCTACTGCTACCCGGGCCTGG - Intronic
1027172338 7:75881606-75881628 TCCCTACACTTCCCCAGGCCTGG - Intronic
1027226381 7:76246519-76246541 GCACCACTGCACTCCAGGCCAGG + Intronic
1027269312 7:76511432-76511454 TGCCCGCTGCTCCCCACTCCTGG + Intronic
1027320023 7:77005327-77005349 TGCCCGCTGCTCCCCACTCCTGG + Intergenic
1027522554 7:79228298-79228320 ACACCACTGCACCCCAGGCTGGG + Intronic
1028190906 7:87850723-87850745 ACACCACTGCACTCCAGGCCTGG + Intronic
1028370331 7:90085272-90085294 TCCCCACTGCACCCCAGCCTGGG - Intergenic
1028407424 7:90491578-90491600 ACACCACTGCACCCCAGCCCGGG + Intronic
1028485307 7:91350940-91350962 TGGCCACTGCTCCCAAGACCAGG + Intergenic
1028529997 7:91828041-91828063 ACGCCACTGCTCTCCAGCCCAGG - Intronic
1028760621 7:94492057-94492079 TACCCACTTGTCCCCAGGTCTGG - Intergenic
1029366747 7:100121488-100121510 CCACCACTGCACCCCAGCCCAGG - Intronic
1029446309 7:100614814-100614836 CCCCCACTCCTGCCCAGCCCAGG - Intronic
1029481081 7:100813356-100813378 GCGCCACTGCGCTCCAGGCCTGG - Intronic
1029502757 7:100943801-100943823 TCGCCACTGCACTCCAGCCCAGG - Intergenic
1029560873 7:101302249-101302271 TCGCCACTGCACTCCAGGCTGGG + Intergenic
1029638593 7:101803231-101803253 TCGCCACTGCTCTCCAGCCTGGG + Intergenic
1029715379 7:102322579-102322601 TCCCCACAACACCCCAGACCTGG + Intergenic
1029842061 7:103375796-103375818 GCACCACTGCTCTCCAGGCTGGG - Intronic
1029980563 7:104874887-104874909 TCACCACTGCTCTCCAGCCTGGG - Intronic
1029985166 7:104916345-104916367 TCACCACTGCACTCCAGGCTGGG + Intergenic
1030388109 7:108891184-108891206 TCACCACTGCACTCCAGCCCGGG - Intergenic
1030511749 7:110491505-110491527 TCTCCACTACTCCTCATGCCGGG + Intergenic
1030999320 7:116396629-116396651 TCACCACTGTACCCCAGCCCGGG - Intronic
1031401539 7:121329971-121329993 TCGCACCTGCTCCCCAGGTCTGG - Intronic
1032087038 7:128889969-128889991 TCACCACTGCACTCCAGGCTGGG - Intronic
1032273970 7:130438514-130438536 TCCCCACTGCACTCCAGCCTGGG + Intronic
1032426529 7:131826997-131827019 TCCCCACTGATGGCCAAGCCAGG - Intergenic
1032436658 7:131906435-131906457 TCCCCACTTCAGGCCAGGCCAGG - Intergenic
1032545386 7:132737617-132737639 TCCCCACAGCTTCCCTGCCCTGG + Intergenic
1032628600 7:133622015-133622037 GCACCACTGCTCCCCAGCCTGGG - Intronic
1032683581 7:134209494-134209516 TCCCCGGGGCTCCCCTGGCCTGG - Intronic
1033222184 7:139535357-139535379 TCCCCTCCTCTCCCCAGCCCCGG - Intronic
1034133078 7:148738990-148739012 TCCCCGCTGCTCTCTATGCCTGG - Intronic
1034225227 7:149476268-149476290 GCCCCACTGCACTCCAAGCCTGG + Intronic
1034339412 7:150341971-150341993 GCCCCACTCCTACCCAGGCAGGG + Intergenic
1035031285 7:155862760-155862782 TCCCCACGGCTTACCAGGACTGG - Intergenic
1035266396 7:157692288-157692310 ACCCCCCACCTCCCCAGGCCAGG + Intronic
1035374430 7:158398013-158398035 TCCCCACTGATCCTGAGGCTGGG + Intronic
1035547542 8:495189-495211 TCACCACTGCACTCCAGGCTGGG + Intronic
1035609130 8:948641-948663 TCCACACTGCAACCCCGGCCTGG - Intergenic
1035659049 8:1333224-1333246 AACCCACTGCTACCCTGGCCAGG + Intergenic
1035769085 8:2132627-2132649 GCACCACTGCTCTCCAGCCCGGG - Intronic
1036033666 8:4996427-4996449 GACCCTCTGCTCCACAGGCCCGG - Intergenic
1036384203 8:8264255-8264277 TCCCCACTGCACTCCAGCCTGGG - Intergenic
1036523713 8:9515778-9515800 TCACCACTGCACTCCAGCCCGGG + Intergenic
1036555377 8:9855136-9855158 TCTCCACTGCTCTCCAGCCTGGG + Intergenic
1036604360 8:10292872-10292894 TCCCCCACCCTCCCCAGGCCAGG - Intronic
1036790037 8:11711060-11711082 GCTCCACTGCACTCCAGGCCTGG + Intronic
1036964175 8:13277268-13277290 CCCCCACTGCTCTCCAGCCTGGG + Intronic
1037274508 8:17163253-17163275 CCACCACTGCTCCCCCAGCCTGG + Intronic
1037308471 8:17530173-17530195 TCCCCCCTGCCCCCCATCCCCGG + Intronic
1037705750 8:21313998-21314020 TTCCCACTGCCTCCCAGCCCTGG - Intergenic
1037705791 8:21314172-21314194 TTCCCACTGCCTCCCAGCCCTGG - Intergenic
1037927313 8:22853826-22853848 TCCCAACTCCTCCTAAGGCCTGG - Intronic
1038420587 8:27431606-27431628 TCTCCACTGCTGCTCACGCCAGG - Intronic
1038566631 8:28624518-28624540 ACCCCACTGCACCCCAGCCTGGG + Intronic
1039059979 8:33565676-33565698 GCCCCATTTCTCCCCAGGCCTGG - Intronic
1039073356 8:33666208-33666230 ACACCACTGCACCCCAGCCCAGG - Intergenic
1039659227 8:39445463-39445485 ACACCACTGCACCCCAGCCCGGG - Intergenic
1039702115 8:39972565-39972587 TCGCCACTGCACTCCAGCCCGGG + Intronic
1039877293 8:41597834-41597856 TCACCAATGGCCCCCAGGCCAGG - Intronic
1040549339 8:48426684-48426706 TCCCACCTGCTCCCCATCCCAGG + Intergenic
1040558551 8:48503047-48503069 TTCCCAGTGATCCCAAGGCCTGG + Intergenic
1040862464 8:52013706-52013728 TCGCCACTGCACTCCAGGTCTGG + Intergenic
1040973055 8:53158521-53158543 GCACCACTGCACCCCAGCCCGGG - Intergenic
1040980437 8:53241452-53241474 GCCCCACTGCACCCCAGCCTGGG + Intronic
1041851621 8:62399460-62399482 GCGCCACTGCTCTCCAGCCCAGG + Intronic
1042555105 8:70027569-70027591 GCCCCACTGCACTCCAGCCCGGG - Intergenic
1042789179 8:72584397-72584419 TCACCTCTGCTCCTCAGGGCTGG + Intronic
1042918040 8:73894367-73894389 ACCTCACTGCTCTCCAGCCCCGG + Intergenic
1043457263 8:80424961-80424983 GCGCCACTGCACCCCAGCCCCGG - Intergenic
1043472115 8:80573381-80573403 TCCTCAGTGCTCCTCAAGCCTGG + Intergenic
1043813623 8:84774174-84774196 TCCCCACTGCACTCCAGCCTGGG + Intronic
1043840719 8:85100518-85100540 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1044332839 8:90941750-90941772 TCCCCACTGTGCCTCAGACCTGG + Intronic
1045206222 8:100043731-100043753 GCGCCACTGCACTCCAGGCCGGG + Intronic
1045421471 8:102020908-102020930 TACACACTGCTCCCTTGGCCAGG + Intronic
1045505970 8:102779010-102779032 TCCCCTCTCCTCCCAGGGCCTGG - Intergenic
1046772076 8:118126305-118126327 TCACCACTGCACTCCAGCCCAGG + Intergenic
1046791358 8:118325713-118325735 TCCTCACTGCTCCCAACCCCAGG + Intronic
1046805832 8:118477969-118477991 TCCCCACTGCACTCCAGCCTGGG + Intronic
1046864733 8:119135021-119135043 GCCCCACTGCTCTCCAGCCTGGG - Intergenic
1047239586 8:123073726-123073748 GCGCCACTGCACCCCAGCCCAGG - Intronic
1047247540 8:123158416-123158438 TCCCCAGGGGTCCCCACGCCTGG - Intergenic
1047466820 8:125124835-125124857 ACACCACTGCACCCCAGGCTGGG - Intronic
1047491339 8:125377134-125377156 ACACCACTGCTCTCCAGGCTGGG - Intergenic
1047590369 8:126320666-126320688 CCCCAACTGCTTCCCAGGTCGGG + Intergenic
1047740304 8:127801282-127801304 TCCCCACTGCACTCCAGCCTGGG - Intergenic
1048366148 8:133740373-133740395 TCCTCACTGCTGCCCAGCCCAGG + Intergenic
1048471915 8:134711785-134711807 TCCCCTCTGCACGCCAGGCAGGG - Intronic
1048564890 8:135585184-135585206 GCCCCACTGCACCCCAGCCTGGG + Intronic
1048888911 8:138931086-138931108 TCCCCGCCCCTCCCAAGGCCCGG + Intergenic
1049197504 8:141323817-141323839 CCCCCACTGGGGCCCAGGCCAGG - Intergenic
1049411559 8:142475920-142475942 TCACCTCTGCTCCCCCGGCTAGG - Intronic
1049444493 8:142623794-142623816 TGCCCTCTGCTCCCCACTCCAGG + Intergenic
1049470703 8:142773986-142774008 TGACCCCTGCTTCCCAGGCCTGG + Intronic
1049478267 8:142806898-142806920 ACCCCACAGTCCCCCAGGCCTGG - Intergenic
1049480065 8:142818365-142818387 TGCCCACTGCTCCCCAATGCTGG + Intergenic
1049514023 8:143044096-143044118 TCCCCAGTCCTCCCATGGCCTGG + Intronic
1049566616 8:143343548-143343570 TGCCCACTCTTCCCGAGGCCGGG - Intronic
1049583068 8:143421469-143421491 TTGCCCCTGCTCCCCCGGCCGGG - Intronic
1049593350 8:143472495-143472517 TCCCCACTGCTGAGCGGGCCAGG + Intronic
1049654827 8:143792854-143792876 TCCCCCCAGCCCCCCACGCCTGG - Exonic
1049797413 8:144503053-144503075 GCCCCTCTGGCCCCCAGGCCGGG - Intronic
1049798675 8:144507815-144507837 TCAGCCATGCTCCCCAGGCCAGG - Intergenic
1050151477 9:2622453-2622475 ACCCCGCTGTTCCCCAAGCCCGG - Intronic
1050291798 9:4162812-4162834 TCACCACTGCACTCCAGCCCGGG + Intronic
1050377502 9:4987691-4987713 TCACCACTGCACTCCAGGCTGGG + Intronic
1050390528 9:5138569-5138591 CCCCCACTGCCCAACAGGCCAGG - Intronic
1052044066 9:23774166-23774188 GCACCACTGCACCCCAAGCCTGG + Intronic
1052965826 9:34339975-34339997 GCCCCACTGCTCTCCAGCCTGGG - Intronic
1053397038 9:37784818-37784840 TCCCCACAGCGCCGAAGGCCCGG + Exonic
1054842808 9:69761086-69761108 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1055121671 9:72667035-72667057 TCCCCACTGCACTCCAGCCCGGG + Intronic
1055760384 9:79600733-79600755 TGCCCATGGCTCCCCAAGCCTGG + Intronic
1055780079 9:79811437-79811459 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1056199444 9:84260663-84260685 TCACCACTGCTCTCCAGCCTGGG - Intergenic
1056533955 9:87511751-87511773 GCGCCACTGCACTCCAGGCCGGG - Intronic
1056596979 9:88015726-88015748 GCACCACTGCTCTCCAGCCCAGG - Intergenic
1056654727 9:88499690-88499712 GCGCCACTGCACTCCAGGCCGGG + Intergenic
1056832144 9:89925542-89925564 TCCACACTTCTCCCCAGGTGAGG - Intergenic
1057117955 9:92543427-92543449 TCACCACTGCTCTCCAGCCTGGG + Intronic
1057168920 9:92949206-92949228 TCCACACTGCTCCCCTTTCCAGG - Intronic
1057171295 9:92964812-92964834 TACCCCCCGCCCCCCAGGCCTGG - Intronic
1057440113 9:95077042-95077064 CCCCCTCTCCTCCCCAGGCCTGG - Intronic
1057679678 9:97167850-97167872 ACGCCACTGCACTCCAGGCCTGG - Intergenic
1057714395 9:97479454-97479476 TCCCAACTGCCCTCCAGCCCAGG - Intronic
1057719554 9:97520920-97520942 TCTCCCCTGCTCCCTCGGCCTGG + Intronic
1057808917 9:98242396-98242418 GCGCCACTGCTCTCCAGCCCGGG + Intronic
1057836736 9:98451525-98451547 TCCCCACTGCCCCCCAGCAGTGG + Intronic
1057862248 9:98650208-98650230 TCCACACTGCTGCTCAGGCTAGG - Intronic
1058050701 9:100403411-100403433 TCGCCACTGCACCCCAGACCAGG - Intergenic
1058140168 9:101349267-101349289 TCCACCCTGCTCCCCAGAACAGG + Intergenic
1060618072 9:125037224-125037246 GCACCACTGCACTCCAGGCCTGG + Intronic
1061091651 9:128429829-128429851 GCGCCACTGCACTCCAGGCCTGG - Intronic
1061159700 9:128886178-128886200 TACCCTTTGCTCCCCAGGCTGGG - Intronic
1061184048 9:129041771-129041793 CACCCTCTGCCCCCCAGGCCTGG - Intronic
1061223568 9:129266979-129267001 GCACCACTGCTCTCCAGCCCGGG - Intergenic
1061314729 9:129787838-129787860 TCACCACTGCACTCCAGCCCAGG - Intergenic
1061348233 9:130043308-130043330 TCCCCCGGGCTCCCCCGGCCGGG + Intergenic
1061404488 9:130385816-130385838 TCCCCGCAGCTCGCCAGGGCTGG - Intronic
1061535706 9:131248323-131248345 GTGCCACTGCCCCCCAGGCCGGG + Intergenic
1061692145 9:132341826-132341848 TACCCACCGCCACCCAGGCCAGG + Intronic
1061755406 9:132808924-132808946 TCCCCACCACTCCCCAAGCCAGG - Intronic
1061824393 9:133248760-133248782 CCCCCACTCCTCTCCAGTCCCGG - Intergenic
1061897286 9:133655054-133655076 TCCGCGGTGCTCACCAGGCCTGG - Intronic
1062118515 9:134821858-134821880 TCGGCACTGCTCCCCCGGCTGGG - Intronic
1062281868 9:135755553-135755575 TCCCCAGTGCTCACCGAGCCTGG - Intronic
1062334314 9:136058327-136058349 TCCCCACGGCTCCCAGTGCCTGG + Intronic
1062448849 9:136607147-136607169 GCCCCACCGCACCCCAGGCCCGG - Intergenic
1062581505 9:137231055-137231077 TCCCTCCTGCTGCCCAAGCCTGG - Intronic
1062611544 9:137376884-137376906 GCGCCACTGCTCTCCAGGCTGGG + Intronic
1062639143 9:137508181-137508203 TCACCACTGCACCCCAGCCTGGG + Intronic
1185646885 X:1622331-1622353 TCACCACTGCACTCCAAGCCTGG - Intronic
1185818511 X:3179800-3179822 ACACCACTGCACCCCAGGCTGGG - Intergenic
1185880915 X:3740111-3740133 GCACCACTGCACCCCAGGCCTGG + Intergenic
1186172135 X:6888605-6888627 TCACCACTGCACTCCAGCCCGGG + Intergenic
1186483512 X:9914453-9914475 TTCCCACTGCTCCCCTACCCTGG - Intronic
1186484501 X:9923578-9923600 TTCCCACCTCTGCCCAGGCCTGG + Intronic
1186843346 X:13507088-13507110 GCACCACTGCACTCCAGGCCTGG - Intergenic
1187327150 X:18301353-18301375 ACACCACTGCTCTCCAGGCTGGG + Intronic
1187473562 X:19590064-19590086 GCACCACTGCACCCCAGGCTGGG + Intronic
1187493393 X:19773811-19773833 TCACCACTGCACCCCAGCCTGGG + Intronic
1188302796 X:28526340-28526362 TCGCCACTGCTCTCCAGCCTGGG - Intergenic
1188405967 X:29810231-29810253 TCCCCACTGCACTCCAGCCTGGG - Intronic
1189318968 X:40075714-40075736 GCGCCACTGCACTCCAGGCCGGG + Intronic
1189345093 X:40234790-40234812 GCCCCACTGCACTCCAGGCTGGG - Intergenic
1189437728 X:41007740-41007762 TCTCCACTGCTGCCCTGCCCTGG + Intergenic
1189722061 X:43930258-43930280 TCCCCAATGCTGACCAGGGCTGG + Intergenic
1190076855 X:47323095-47323117 ACCCCACTGCTCTCCAGCCTGGG + Intergenic
1190107118 X:47568903-47568925 CCCCCACCCCTCCCCAGGCTGGG - Intronic
1190119781 X:47650489-47650511 GCCCCACCGCCCCCCAGGCCTGG + Exonic
1190262396 X:48805614-48805636 TCCTCATCTCTCCCCAGGCCCGG + Exonic
1190369009 X:49723854-49723876 TAAAAACTGCTCCCCAGGCCGGG - Intergenic
1190391021 X:49931868-49931890 TCGCCACTGCACCCCAGCCTGGG + Intronic
1190865783 X:54383327-54383349 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1192123079 X:68475485-68475507 TCACCACTGCTCTCCAGCCTGGG - Intergenic
1192161179 X:68789074-68789096 TCCCCACTGTTCCCATGGACAGG - Intergenic
1192194498 X:69019235-69019257 TCCACACTGCTTCCTAGGGCTGG - Intergenic
1192806914 X:74519218-74519240 TCACCACTGCGCTCCAGGCTGGG - Intronic
1192861500 X:75077954-75077976 TCCCCACTGCACTCCAGCCTGGG - Intronic
1192940408 X:75905586-75905608 CCACCACTGCACCCCAGGCTGGG - Intergenic
1193116253 X:77778370-77778392 ACCCCACTGCACTCCAGGCTGGG + Intronic
1193346712 X:80412195-80412217 TCCCAGCTGCTCCCCAGCCATGG - Intronic
1194325762 X:92514686-92514708 TCCCCACTGCACTCCAGCCTGGG + Intronic
1195694676 X:107658111-107658133 TGCCCACTGCTAAGCAGGCCAGG - Intergenic
1195856576 X:109338612-109338634 CCCCCACTCCTCACCAGGCTGGG - Intergenic
1196742218 X:119035323-119035345 ACACCACTGCACCCCAGCCCAGG - Intergenic
1196891884 X:120299350-120299372 TCACCACTGCTCTCCAGCCTGGG - Intronic
1196959609 X:120986969-120986991 TCCCCACTGCACTCCAGCCTGGG + Intergenic
1196963174 X:121026203-121026225 GCGCCACTGCTCCCCAGCCTGGG - Intergenic
1197680773 X:129381821-129381843 TCACCACTGCACTCCAGGCTGGG + Intergenic
1198038169 X:132821946-132821968 TCCCCACTGCACTCCAGCCTGGG + Intronic
1198263332 X:134986497-134986519 TCACCACTGCACTCCAGGCTCGG - Intergenic
1198744269 X:139873662-139873684 TCACCACTGCACTCCAGGCTGGG + Intronic
1199162766 X:144633681-144633703 ACCCCACTGCACCCCAGCCTGGG + Intergenic
1200007074 X:153093907-153093929 TCTCCACTTCTCCTCAGGCTAGG - Intergenic
1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG + Exonic
1200142725 X:153909919-153909941 CCCCCTCTCCTCCCCAGACCTGG - Exonic
1200181987 X:154156215-154156237 TCCCCACAACTCCCTATGCCTGG + Intronic
1200187636 X:154193329-154193351 TCCCCACAACTCCCTATGCCTGG + Intergenic
1200193285 X:154230469-154230491 TCCCCACAACTCCCTATGCCTGG + Intronic
1200199040 X:154268273-154268295 TCCCCACAACTCCCTATGCCTGG + Intronic
1200233449 X:154457655-154457677 TCACCACTGCACTCCAGCCCGGG + Intergenic
1200848942 Y:7862596-7862618 GCACCACTGCACTCCAGGCCAGG + Intergenic
1201519137 Y:14852818-14852840 ACCCCACTGCACTCCAGGCTGGG + Intergenic
1202190273 Y:22235200-22235222 TCGCCACTGCTCTCCAGCCTGGG + Intergenic