ID: 932374966

View in Genome Browser
Species Human (GRCh38)
Location 2:71227330-71227352
Sequence AGCCGGCATCTCCCTCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 87}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932374966_932374977 29 Left 932374966 2:71227330-71227352 CCTCCTTGAGGGAGATGCCGGCT 0: 1
1: 0
2: 1
3: 4
4: 87
Right 932374977 2:71227382-71227404 CTGGGATAGGCATTGGGCCAAGG 0: 1
1: 0
2: 2
3: 35
4: 223
932374966_932374972 11 Left 932374966 2:71227330-71227352 CCTCCTTGAGGGAGATGCCGGCT 0: 1
1: 0
2: 1
3: 4
4: 87
Right 932374972 2:71227364-71227386 AAAGGACGCTACGCTAGCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 35
932374966_932374969 -7 Left 932374966 2:71227330-71227352 CCTCCTTGAGGGAGATGCCGGCT 0: 1
1: 0
2: 1
3: 4
4: 87
Right 932374969 2:71227346-71227368 GCCGGCTCTGATTGGCTGAAAGG 0: 1
1: 0
2: 0
3: 5
4: 82
932374966_932374971 10 Left 932374966 2:71227330-71227352 CCTCCTTGAGGGAGATGCCGGCT 0: 1
1: 0
2: 1
3: 4
4: 87
Right 932374971 2:71227363-71227385 GAAAGGACGCTACGCTAGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 31
932374966_932374973 16 Left 932374966 2:71227330-71227352 CCTCCTTGAGGGAGATGCCGGCT 0: 1
1: 0
2: 1
3: 4
4: 87
Right 932374973 2:71227369-71227391 ACGCTACGCTAGCCTGGGATAGG 0: 1
1: 0
2: 0
3: 3
4: 24
932374966_932374974 22 Left 932374966 2:71227330-71227352 CCTCCTTGAGGGAGATGCCGGCT 0: 1
1: 0
2: 1
3: 4
4: 87
Right 932374974 2:71227375-71227397 CGCTAGCCTGGGATAGGCATTGG 0: 1
1: 0
2: 0
3: 1
4: 70
932374966_932374975 23 Left 932374966 2:71227330-71227352 CCTCCTTGAGGGAGATGCCGGCT 0: 1
1: 0
2: 1
3: 4
4: 87
Right 932374975 2:71227376-71227398 GCTAGCCTGGGATAGGCATTGGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932374966 Original CRISPR AGCCGGCATCTCCCTCAAGG AGG (reversed) Intergenic
900604020 1:3515909-3515931 AGGCTGCATCTCCCTGGAGGAGG + Intronic
901494163 1:9611938-9611960 AGCCACCATCTCCCCCAGGGGGG + Intronic
904113823 1:28147430-28147452 AGCCGGCAGGTCCCTGGAGGCGG + Exonic
906862548 1:49377170-49377192 AGCCCCCATCTCCTTCAAGATGG - Intronic
918067312 1:181110022-181110044 AGCCCCCATCTACCTCACGGAGG - Intergenic
918443447 1:184592503-184592525 AGCCGTCCTCTCCTTCAAAGAGG + Intronic
1062907558 10:1189071-1189093 AGCCTGAGTCACCCTCAAGGAGG + Intronic
1066733024 10:38450746-38450768 AGCCTGCTCCTCCCTCACGGTGG - Intergenic
1071217900 10:83429173-83429195 AGCCAGCAGCCCACTCAAGGGGG + Intergenic
1076909141 10:133378866-133378888 GGCCGGCTTCTCCCTCCATGGGG + Intergenic
1078607449 11:12789614-12789636 ACCCGACATCTCCCTCCAGATGG + Intronic
1083157485 11:60833468-60833490 AGCAGGCATCTCTCTCAAGGGGG - Intergenic
1083324497 11:61866472-61866494 AGCCGGCCCCTCCCTGAACGTGG - Exonic
1088579099 11:111299179-111299201 AGCAGGGATCCCCCTCAAGCCGG - Intronic
1091389522 12:117572-117594 CCCCGGCCACTCCCTCAAGGTGG - Intronic
1092333519 12:7607297-7607319 AGTCCTCATCTCCCTCAAGCAGG + Intergenic
1095236680 12:39805032-39805054 AGCAGGCTTCTCCCTCCAGCAGG - Intronic
1097342289 12:58453050-58453072 AGCCTGTATCTCCTTCAAGGAGG + Intergenic
1098652558 12:72991437-72991459 AGGCCCCATCTGCCTCAAGGAGG + Intergenic
1102459661 12:113092883-113092905 AGCCGGCTCCTCCCTCGAGAGGG - Intronic
1104099677 12:125595184-125595206 AGCTGGCAGCTCCATGAAGGGGG + Intronic
1104174631 12:126318140-126318162 TGTCCGCACCTCCCTCAAGGGGG - Intergenic
1105894831 13:24709070-24709092 TGCCGTCCTCTCCCTCCAGGTGG - Intronic
1106675345 13:31952678-31952700 GGCCGGCGCCTCCCTCCAGGAGG + Intergenic
1125192287 15:37007476-37007498 TGCCGGCACCACCCTCAGGGAGG - Intronic
1128082607 15:64865383-64865405 AGCCTGCATCTCACCCATGGAGG - Exonic
1130557777 15:84935062-84935084 GGCCGCCATCTCCGTGAAGGTGG + Exonic
1131628226 15:94147355-94147377 TGCATGCATCTCCCACAAGGAGG - Intergenic
1132543512 16:522488-522510 GGCCGGCTTCTTCCTCCAGGGGG + Exonic
1135510874 16:23081832-23081854 AGCAGGGATCTCCCACACGGGGG - Intronic
1136401508 16:30021721-30021743 AGCAGGCGTCTCCCACTAGGTGG - Intronic
1138554305 16:57762951-57762973 CTCCGTCATCTCCCTCAGGGAGG + Intronic
1139797676 16:69496610-69496632 AGCCTCCATCCCCCTCAAGGCGG - Intergenic
1142255865 16:89013679-89013701 AGCCGGCAGCTCCTTCCATGGGG + Intergenic
1153872595 18:9334661-9334683 AGCCGCCAGCTCCCGCCAGGAGG - Intergenic
1155511754 18:26584909-26584931 AGACGGCAGCTCCCTGTAGGAGG + Intronic
1161203182 19:3027543-3027565 ACCAGGCATCCCCATCAAGGAGG - Intronic
1162783767 19:13021566-13021588 AGCCGCCCTCTCCCTCAGCGAGG - Intronic
1163219309 19:15903044-15903066 AGCCTTCATCACCCGCAAGGTGG - Intergenic
927011919 2:18912583-18912605 AGCCGGTATGACCCTCAAGTAGG + Intergenic
928103626 2:28453583-28453605 AGCCGCCAGCTCCCTGAGGGTGG - Intergenic
931232544 2:60387003-60387025 AGATGGCCTCTCCCTCACGGGGG - Intergenic
931710896 2:64988830-64988852 CGCCGGCCTCTCCCGCCAGGGGG - Intronic
932024846 2:68122550-68122572 TGCCCACATCTCCCACAAGGGGG + Intergenic
932374966 2:71227330-71227352 AGCCGGCATCTCCCTCAAGGAGG - Intergenic
1169727376 20:8750742-8750764 AGCCAGCCTTTCCCTTAAGGAGG - Intronic
1172992606 20:39047642-39047664 TCCCCGCATCTCCTTCAAGGTGG + Intergenic
1174776908 20:53351786-53351808 AACAGACATCTTCCTCAAGGAGG + Intronic
1179583559 21:42360620-42360642 AGGGGGCATCTCCTTGAAGGTGG - Intergenic
1179792075 21:43761567-43761589 AGCCAGCATCTCCGTGAAGGTGG + Exonic
1179880011 21:44289638-44289660 AGCCGGCATCTCCTCCCAGGCGG + Exonic
1180000984 21:44995423-44995445 AGCCTGCATCTTCCTCTGGGAGG - Intergenic
1181713577 22:24707235-24707257 AGCAGCCATGTCCCTCTAGGTGG - Intergenic
1183003573 22:34881352-34881374 AGCCAGCATCTCACCCATGGAGG + Intergenic
1185053308 22:48564951-48564973 AGCTGGCATCTCCATCCATGAGG + Intronic
950172014 3:10845265-10845287 AGCTGCCATCTCCTTCCAGGGGG + Intronic
954463197 3:50639302-50639324 AGCTGTCATCTCCCTCAACTAGG + Intronic
954797178 3:53167441-53167463 AGCCATCACCTCTCTCAAGGGGG - Intronic
954920784 3:54189084-54189106 AGCCCTCATTTCCCTCAAGCAGG - Intronic
955094800 3:55786824-55786846 TGATAGCATCTCCCTCAAGGTGG + Intronic
958722855 3:97866903-97866925 AGCCGGCATCTCAGTCAAACTGG - Intronic
959155151 3:102658190-102658212 AGCAGGCACCTCTCACAAGGTGG + Intergenic
959162224 3:102736790-102736812 AGCCAGCTTCTCCATCACGGAGG - Intergenic
961627456 3:128273861-128273883 AGCTGGCATCTCTATAAAGGGGG - Intronic
967106073 3:186256033-186256055 AGCCTACTTCTCCCTCATGGTGG + Intronic
968634355 4:1670314-1670336 AGCCAGCATCTTCCTGAATGAGG + Intronic
968894962 4:3394096-3394118 TGCCGGCATCTCTCTGAACGTGG + Intronic
969598047 4:8159853-8159875 AGCAGCCATCTCCCCCAAGAGGG + Intergenic
974336827 4:60558616-60558638 AGCAAGAATCTCCCTCCAGGTGG - Intergenic
980574638 4:134669135-134669157 AGCAGGTATATCTCTCAAGGGGG + Intergenic
994411502 5:99411941-99411963 AGCCTGCCTGCCCCTCAAGGTGG + Intergenic
994482326 5:100353306-100353328 AGCCTGCCTGCCCCTCAAGGTGG - Intergenic
1006986247 6:38177574-38177596 AGCCGGCCTCTCACTGGAGGAGG + Intronic
1008643102 6:53484829-53484851 TTCCAGCATCTCCCTCATGGTGG - Intergenic
1015496630 6:133889783-133889805 AGCCAGGATCTGCCTCAAGTGGG - Exonic
1015939486 6:138433381-138433403 AGCCAGCATCACTGTCAAGGCGG + Exonic
1018798488 6:167205416-167205438 AGCCAGGCTCTCCCTAAAGGTGG - Intergenic
1018814225 6:167318759-167318781 AGCCAGGCTCTCCCTGAAGGTGG + Intergenic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1019117956 6:169780590-169780612 AGCCGGCCCCTCCATCACGGGGG + Intronic
1024674085 7:51622582-51622604 AGCCGGCCTAACCCTGAAGGTGG + Intergenic
1025108199 7:56190674-56190696 AGCCACCATCTCCCTCTTGGAGG + Intergenic
1025108357 7:56191947-56191969 AGCCACCATCTCCCTCTTGGAGG - Intergenic
1026310031 7:69175427-69175449 AGCCACCATCTCCCTCTTGGAGG - Intergenic
1026899758 7:74030274-74030296 GCCTGGCTTCTCCCTCAAGGAGG + Intronic
1027233336 7:76284136-76284158 ATCTGGCTTCTCCTTCAAGGCGG - Intronic
1046754535 8:117959537-117959559 ATCCAGCATCTGCCTCAAGCAGG - Intronic
1051500312 9:17769604-17769626 AGACGGCATCTGACTGAAGGTGG - Intronic
1053209003 9:36211735-36211757 AGTCCTCATCTCCCTCAAGCAGG + Exonic
1061242167 9:129381082-129381104 AGCCTGCATCTGCCTGGAGGAGG + Intergenic
1191688019 X:63912654-63912676 ATCCTGCATCTTCCTCAAGTGGG + Intergenic
1196734769 X:118974175-118974197 AGCAGCCATCTCCCCCAAGAGGG + Intergenic
1198302083 X:135343218-135343240 ATCTGCCATCTTCCTCAAGGAGG - Exonic