ID: 932380421

View in Genome Browser
Species Human (GRCh38)
Location 2:71276859-71276881
Sequence CGTCCCCGCGTCGCGGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 17}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932380417_932380421 -1 Left 932380417 2:71276837-71276859 CCGGCAGGGCGTCGCACGTTGGC 0: 1
1: 0
2: 1
3: 0
4: 29
Right 932380421 2:71276859-71276881 CGTCCCCGCGTCGCGGGAATGGG 0: 1
1: 0
2: 0
3: 2
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932380421 Original CRISPR CGTCCCCGCGTCGCGGGAAT GGG Intronic
923106404 1:230857180-230857202 TGTCCCCGCTTCTTGGGAATAGG - Intronic
1065099919 10:22321928-22321950 GGTCCCGGCGCCGCGGGAGTCGG - Intronic
1067972831 10:50991775-50991797 TGGCCCCGCGGCCCGGGAATGGG + Intronic
1073196193 10:101694320-101694342 CGGCCCCGCGTCCCGGGAAAGGG - Intronic
1074865430 10:117542121-117542143 CGGCCCCGCGTCGGGAGAACTGG - Intergenic
1077446180 11:2591993-2592015 CGTACCCGCCTTGCGGGAGTGGG - Intronic
1084121494 11:67071614-67071636 CGTCCCAGCGACGCGGGAAGGGG + Exonic
1106108941 13:26760478-26760500 CGTCCCCGCCGCCAGGGAATCGG - Intronic
1124640240 15:31392374-31392396 CGTCCCCGCGACCCGTGACTCGG - Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1150802178 17:68291262-68291284 GGTGCCCGAGTCGCGGGAGTGGG - Intronic
932380421 2:71276859-71276881 CGTCCCCGCGTCGCGGGAATGGG + Intronic
1170557952 20:17530888-17530910 CGTCCCGGCGGCGCGGGGCTGGG - Intronic
1171367843 20:24638474-24638496 AGTCCCAGCGTCTCGGGAAGGGG - Intronic
1173062873 20:39679051-39679073 CTTCCCCACCTAGCGGGAATGGG - Intergenic
1179675135 21:42975399-42975421 GGTTCCGGCGTCCCGGGAATTGG + Intronic
1011277096 6:85642482-85642504 GGTCGCCGCGGCGCGGGAGTGGG - Intronic
1020461515 7:8434119-8434141 CTTCCCAGCGTCGCGGGTAGAGG + Exonic
1038808070 8:30812660-30812682 CGGCCGCGCGCCGCGGGAGTCGG + Exonic
1040423426 8:47261022-47261044 CTTCCCCGCAACGCGGGAAACGG - Intronic