ID: 932380581

View in Genome Browser
Species Human (GRCh38)
Location 2:71278035-71278057
Sequence CCTAGAAACCAGAGCCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932380581_932380585 24 Left 932380581 2:71278035-71278057 CCTTCTTGGCTCTGGTTTCTAGG 0: 1
1: 0
2: 0
3: 21
4: 199
Right 932380585 2:71278082-71278104 AGCTTGCTTTGCCCTTTCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932380581 Original CRISPR CCTAGAAACCAGAGCCAAGA AGG (reversed) Intronic
900978659 1:6034007-6034029 CCAACACACCAGACCCAAGAGGG - Intronic
901028445 1:6291840-6291862 CCCAGAACCCAGAGCCAGCAGGG + Intronic
901530061 1:9847078-9847100 CTTGGAAACCGGAGCCAAGCGGG - Intergenic
903072835 1:20735992-20736014 ACTGAAAACCAGAGCCAAGATGG + Intergenic
904809884 1:33156559-33156581 CCTAGAAGTCAGGGACAAGAGGG - Intronic
905324263 1:37139423-37139445 GCTAGAAACCTGAGTCAGGAAGG + Intergenic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907111743 1:51932829-51932851 CCTAGCAACCTTTGCCAAGAGGG - Intronic
908305433 1:62809748-62809770 CCAAGAAAAATGAGCCAAGATGG + Intronic
908793324 1:67804726-67804748 CGTAGGAACCAGCACCAAGATGG + Intronic
910975463 1:92901589-92901611 CTTGGAAACCTGAGCCAATACGG + Intronic
913316284 1:117555838-117555860 ACAAGAATCCAGAGACAAGAAGG + Intergenic
915110745 1:153563448-153563470 TTGAGAAACCAGAGCCCAGAAGG - Intronic
915849165 1:159302567-159302589 GCTAGAAAGCAGAGGCAAGTGGG + Intronic
916165922 1:161967363-161967385 CCAGGAAACCAGAGACAATATGG - Intergenic
918264498 1:182828748-182828770 CCCAGAGACCAGAGTCATGATGG - Exonic
920228004 1:204451819-204451841 CAGAGAAACCAAAACCAAGAGGG + Intronic
920857608 1:209675666-209675688 CCGAGAGCCCAGAGCCGAGATGG + Exonic
921226962 1:213030183-213030205 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
921426007 1:215001795-215001817 CAAGGCAACCAGAGCCAAGAGGG - Intergenic
922616597 1:226964680-226964702 CCTATAAAACAGGGCCAAGAAGG - Intronic
923258602 1:232244617-232244639 CCTGGGAACCAGTGCCAGGAAGG + Intergenic
924815511 1:247438252-247438274 CCTAAAAATAAGAGCGAAGAAGG - Intronic
1062973056 10:1662870-1662892 CGTAGAAACCAGAGCAGAGGTGG - Intronic
1066413030 10:35192196-35192218 CCCAAAAAACTGAGCCAAGAAGG - Intronic
1067059334 10:43069885-43069907 CCTGGAAGCCAGGGCCCAGAGGG + Intergenic
1067129902 10:43554002-43554024 CCCAGATACCAAAGCCAAAAAGG - Intergenic
1070484992 10:76921887-76921909 GCTAGAATCCAGAGTCAGGAAGG + Intronic
1071540691 10:86480799-86480821 CCTAGAAGCCAGGACCCAGAAGG - Intronic
1071730169 10:88240084-88240106 CTTTGAAAACAGAGCGAAGAAGG - Intergenic
1072196120 10:93118579-93118601 CCAAGGACCCAGAGCCAGGAAGG - Intergenic
1074147231 10:110727586-110727608 CTTATAAATAAGAGCCAAGAGGG - Intronic
1074388929 10:113040378-113040400 CCTATAAACTAGAGCCCACAAGG - Intronic
1074459381 10:113623543-113623565 CCTGGCAGCCAAAGCCAAGAGGG - Exonic
1078031404 11:7754935-7754957 CCTAGAAGCCAGGGCTGAGATGG - Intergenic
1078881165 11:15450368-15450390 CCTAGTACATAGAGCCAAGAGGG - Intergenic
1079858583 11:25638449-25638471 GCTAGCAACCAGAGACAGGAAGG + Intergenic
1081729140 11:45356255-45356277 CCTAGTGAGCAGAGCCAGGAAGG + Intergenic
1084979297 11:72820830-72820852 CCTTCAACCCAGAGCCAAGCAGG - Intronic
1085457611 11:76674133-76674155 CCTAGAAGGCAGGGCCCAGAAGG - Intergenic
1086375197 11:86193100-86193122 ACTAGCAACCAGAGCATAGAAGG + Intergenic
1088592835 11:111418057-111418079 CCTAGAAATCTAAGCTAAGAAGG + Intronic
1088631525 11:111778458-111778480 CCCAGAAAGCAGGGCCCAGAGGG + Intergenic
1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG + Intergenic
1091388628 12:111446-111468 CCTAGAGAACAGAGGAAAGAGGG - Intronic
1092258872 12:6941859-6941881 CCTGCCACCCAGAGCCAAGAGGG + Exonic
1099265794 12:80446141-80446163 CCTAGAAACCACAGTAAAAAGGG + Intronic
1100357873 12:93849050-93849072 AACAGAAGCCAGAGCCAAGAGGG - Intronic
1102179970 12:110904946-110904968 CCAAGTGACCACAGCCAAGATGG - Intronic
1103244956 12:119448771-119448793 CCTAGAAACCAGAGCTGTGGTGG + Intronic
1103952720 12:124559804-124559826 CCTAGTAGCCAAAGCAAAGAGGG + Intronic
1104347305 12:128012219-128012241 CCTAGAAACAGGAGCAAAGCAGG + Intergenic
1104379220 12:128292039-128292061 CCTAGATACCAGCGACAGGAGGG - Intronic
1104739992 12:131165155-131165177 CCTAGAAACAAGGCCTAAGATGG + Intergenic
1104743926 12:131198638-131198660 CTTACAAGCCAGAGCCAAAATGG - Intergenic
1104765171 12:131325757-131325779 CCTAGAAACAAGGCCCAAGAGGG + Intergenic
1104792486 12:131492810-131492832 CCTAGAAACAAGGCCTAAGATGG - Intergenic
1104814194 12:131636644-131636666 CCTAGAAACAGGGCCCAAGAGGG - Intergenic
1106307456 13:28526031-28526053 ACTGAAAACCAAAGCCAAGAGGG + Intergenic
1107731834 13:43356463-43356485 CCTAGAAGCCAGGGAGAAGAAGG - Intronic
1107952852 13:45480103-45480125 TCTAGAAAACAGAACCAAAAGGG - Exonic
1108526038 13:51286834-51286856 CCTGGAAGCCAGAGCGAAAAGGG + Intergenic
1109454286 13:62563909-62563931 CTTAGAAAACAGAGCAAAGAAGG + Intergenic
1109671585 13:65615163-65615185 GCTAGAAACAAGAGCCCAGATGG + Intergenic
1110275776 13:73640512-73640534 CCAAGAAAGGGGAGCCAAGATGG + Intergenic
1111114763 13:83760683-83760705 CCTAGAGACGTGAACCAAGAAGG - Intergenic
1111483590 13:88865735-88865757 ACTTGAATCCAGAGGCAAGATGG - Intergenic
1111942640 13:94628167-94628189 CTTAGAATCCAGTGCCAACACGG - Exonic
1112092790 13:96099900-96099922 CCTAGAAAGAAGAGCAAACACGG + Intronic
1112509556 13:99997592-99997614 CCGCAAAACCACAGCCAAGAGGG + Intergenic
1112966499 13:105202949-105202971 CCTAGAGACCAAAGGAAAGAAGG - Intergenic
1113020613 13:105882058-105882080 CCTGAAAACTAAAGCCAAGATGG + Intergenic
1117093614 14:52274442-52274464 CCTAGAAACTTGAGCCCAGCAGG + Intronic
1118408749 14:65453934-65453956 TCTAGACACCATTGCCAAGAGGG - Intronic
1118497007 14:66316742-66316764 TTCAGAAACCAGAGCCAACAGGG - Intergenic
1119146028 14:72315163-72315185 ATTAGAAACAAAAGCCAAGAAGG + Intronic
1119397043 14:74334181-74334203 CCTGGAAGCCAAAGCCAAGAAGG + Intronic
1119555922 14:75552444-75552466 CCTAGAAACCAAGGCTAGGAGGG + Intergenic
1120861548 14:89259385-89259407 CCTAGTGACCAGAGCAAAGAGGG - Intronic
1121897908 14:97665581-97665603 GCTAGAAACCAGGACCAAGTGGG + Intergenic
1124883421 15:33662330-33662352 CATAGAAACCAGATCGAAGGAGG - Exonic
1125616576 15:41019528-41019550 CTTAGGAGCCAGAACCAAGAAGG + Intronic
1126764108 15:51996283-51996305 CCTAGAATCCAGAGACAAGCAGG - Intronic
1127530444 15:59838504-59838526 CCCAGAAAGCAGACCCGAGAAGG - Intergenic
1128302286 15:66573919-66573941 CCAAGTATCCAGAGCTAAGAGGG - Intergenic
1129693973 15:77730118-77730140 ACTAGATGCCAGAGCCAAGAGGG - Intronic
1130351809 15:83099495-83099517 CCTAGCAACCAAAGCAAGGAGGG - Intergenic
1130766468 15:86876332-86876354 CTTAGAAACCAGAGGCCAGGTGG + Intronic
1131265950 15:90915478-90915500 TCTAGAAAACAGAGCAAAGGTGG + Intronic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1132879037 16:2153163-2153185 CATGGAGACCAGCGCCAAGACGG + Exonic
1133468014 16:6046674-6046696 CTGAGAATCCAAAGCCAAGATGG - Intronic
1134691633 16:16194492-16194514 TATAGAAACCAAAGCCGAGAGGG - Intronic
1136068313 16:27773309-27773331 TCTAGGAACCAGAGCCCAGGGGG + Intronic
1137715040 16:50593389-50593411 CCAGGAAAACAGAGCCACGAGGG - Intronic
1137843526 16:51664346-51664368 CTTTCCAACCAGAGCCAAGAAGG + Intergenic
1139109920 16:63877586-63877608 TCAAGAAACCAGGGCTAAGAGGG - Intergenic
1139830603 16:69794604-69794626 CCTAGAAATCAGAAGTAAGATGG + Intronic
1143245586 17:5482693-5482715 CCCAGAAATCATAGCTAAGATGG + Intronic
1143857222 17:9860935-9860957 CCAAGAAACCAGGGCCCAGAGGG - Intronic
1143959906 17:10708039-10708061 CATATAAACCAGAGCCAGAATGG - Intronic
1144025471 17:11272883-11272905 CCTGGAATCCAGATCCAAGGTGG + Intronic
1144603011 17:16635925-16635947 CCCAGAAACCATAACCAATAAGG + Intronic
1144687218 17:17234167-17234189 CCCAGCACCCAGAGCCAACATGG + Intronic
1146458742 17:33026914-33026936 CCTAGAAAACAGAGCAAACAGGG - Intronic
1146509015 17:33429851-33429873 CCTAGAAACCATGGCTAAGGGGG + Intronic
1147252912 17:39164440-39164462 ACTAGGAGCCAGAGGCAAGAAGG + Intronic
1148101378 17:45093894-45093916 CCTAGAGAGCTGAGCCAAGGAGG + Intronic
1148543110 17:48495655-48495677 CTTAGAAACCAGGGAGAAGATGG - Intergenic
1148981665 17:51581476-51581498 CCAAGAGACCAGTTCCAAGAAGG + Intergenic
1149133982 17:53342656-53342678 CTTAGGAAACAGAGCCAAGCAGG - Intergenic
1150523675 17:65897977-65897999 CCTGGAAGCCACAGCAAAGAGGG - Intronic
1150976917 17:70097869-70097891 CCTAGGAAACAGATTCAAGAGGG - Intronic
1158299465 18:56035248-56035270 ACTAGAGACCAGAGGCCAGAAGG - Intergenic
1161516789 19:4700884-4700906 CCTGGAGGCCAGAGCCACGAGGG - Intronic
1163630017 19:18413553-18413575 CCCAGAAAACAGACCCAAGATGG + Intergenic
925711738 2:6747767-6747789 TCTAGAAACTAGAGAAAAGAAGG - Intergenic
926888815 2:17621733-17621755 CCCAGAAGGCAGAGACAAGAGGG - Intronic
928715387 2:34055045-34055067 CCTGGAAATCATACCCAAGAAGG - Intergenic
931473560 2:62564861-62564883 TCAAGGAACCAGAGCCCAGAAGG + Intergenic
932380581 2:71278035-71278057 CCTAGAAACCAGAGCCAAGAAGG - Intronic
932426844 2:71643168-71643190 TCTAGACACCAGAGCTAAGAGGG + Intronic
933832534 2:86222594-86222616 CCTTGAAACCACTGCAAAGAGGG - Intronic
936064144 2:109317830-109317852 CTGAGAAACCTGACCCAAGACGG - Intronic
937006277 2:118519657-118519679 CATGGTAAGCAGAGCCAAGAGGG - Intergenic
937733440 2:125261369-125261391 CCTAGGAAACAGAGGAAAGAAGG - Intergenic
942515813 2:176751677-176751699 CATAGAAAACAGATCCAGGAGGG - Intergenic
943255831 2:185591890-185591912 CCTAGAAGGAGGAGCCAAGATGG - Intergenic
943726046 2:191252843-191252865 TCTAGAATCCAAAGTCAAGATGG - Intronic
949043373 2:241859307-241859329 CCCAGGAACCTGAGCCCAGAGGG - Intergenic
1172126107 20:32626245-32626267 CCAGGAGACCAGAGCCAAAAGGG + Intergenic
1172493365 20:35359767-35359789 CCAAGAAAGCAGAGCCTAGATGG + Intronic
1174666761 20:52265287-52265309 CCCAGAAACCAGAGAAAGGAGGG + Intergenic
1175116418 20:56685787-56685809 CCCAGAAGCCAGAGACAGGAAGG - Intergenic
1175190942 20:57211770-57211792 CCTAGAAGCCAGAAACAACAAGG + Intronic
1175271064 20:57734480-57734502 CCTAGGAACCAGAGCCACAGCGG - Intergenic
1175281054 20:57804294-57804316 TCTCGAAACCAGAGCAAAGATGG - Intergenic
1176934677 21:14852882-14852904 CCTAGAAACCAGAAACCAGAGGG + Intergenic
1178011090 21:28288123-28288145 CCTAGAAACCAGAGTGGACATGG - Intergenic
1178194637 21:30329641-30329663 TCTAGAAGCCACAGCAAAGAAGG - Intergenic
1180920791 22:19520610-19520632 CCTCGAGACCAGAGCCACAATGG - Exonic
1180953033 22:19729333-19729355 CTAAGAAACCAGATCCCAGAAGG + Intergenic
1181438482 22:22923686-22923708 CCTAGGAACCAGTGCAAGGAGGG + Intergenic
1184654128 22:45932609-45932631 CCAAGAGTCCAGAGCCAGGATGG - Intronic
1185000425 22:48242164-48242186 CCTGGAAAGGAGAGCCCAGATGG + Intergenic
949876507 3:8629377-8629399 CCTAGAGGTCAGAGCCAAGCAGG + Intronic
950250289 3:11459582-11459604 CCTGGAAGCCAGAGCCAACAGGG + Intronic
951128086 3:19007640-19007662 CTTAGAAAACAAAGGCAAGAGGG + Intergenic
952871892 3:37908144-37908166 CCTAGAAACCACATGAAAGAAGG + Intronic
957508434 3:81155809-81155831 CTTGGGAACCAGAGCCAATAGGG - Intergenic
957784465 3:84863962-84863984 CCAAGAAACAAATGCCAAGATGG - Intergenic
960161882 3:114358933-114358955 CCTAGTGAACAGAGCCAAGAGGG - Intronic
961106935 3:124250281-124250303 CCAGGAAACCAGAGCCCAGCTGG + Intronic
963289153 3:143469577-143469599 CCTAGAAACAAAAACCAGGATGG - Intronic
965942782 3:174205926-174205948 CCCAGCAACCAGAGCCCAGTAGG + Intronic
971553549 4:27982582-27982604 CCCAAACACCAGAGGCAAGAAGG - Intergenic
973535734 4:51880285-51880307 CCTAGATACCAGCACGAAGAGGG + Intronic
978363187 4:107952560-107952582 TCTGGAAAACAGAGCAAAGAAGG - Exonic
984155531 4:176191855-176191877 GCTAGAAACCAGAGAGAAAATGG + Intronic
984956301 4:185049421-185049443 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
986831530 5:11584703-11584725 CCTAGAAAACAGAGCAAAAGTGG - Intronic
987069564 5:14323011-14323033 CATAGGAACCACAGCCAGGATGG + Intronic
987365324 5:17143426-17143448 CCAAGAAACCAGAGGCCAGTAGG - Intronic
989531590 5:42513881-42513903 CCTAGAAATAAGAACAAAGAAGG - Intronic
990625421 5:57605200-57605222 CTAACAAACCAGAGACAAGAAGG + Intergenic
991959698 5:72031996-72032018 CCAAGAAAGCAGAGCCAATCGGG - Intergenic
992703147 5:79361156-79361178 CCTAGCAGCCAGAGTGAAGAGGG + Intergenic
998650148 5:144109912-144109934 CATAGAACCCAAAGACAAGAGGG + Intergenic
999666993 5:153922879-153922901 CCAAGAAGCAAAAGCCAAGATGG - Intergenic
1000987857 5:167880480-167880502 CCTAGCAACCAAAGCAAAAAGGG + Intronic
1002613279 5:180435364-180435386 CCCAGAAACCAGCCCCAAGTGGG - Intergenic
1003288242 6:4753839-4753861 CCTAGTGGCCAGAGCAAAGAGGG - Intronic
1003679391 6:8237026-8237048 CCTAGAAACACCATCCAAGATGG + Intergenic
1005186364 6:23166878-23166900 GCTAAAAAACAAAGCCAAGAAGG + Intergenic
1006132690 6:31878609-31878631 CCTAGGAAACAAAGCCGAGATGG - Intronic
1010371508 6:75114973-75114995 CCTAGAACTCCGAGCCAACATGG + Intronic
1011392440 6:86868401-86868423 CTCTGAAACCAGAGACAAGAAGG + Intergenic
1011867407 6:91847306-91847328 CCTAGGAAAAAGAGCCAAGATGG + Intergenic
1013466730 6:110424171-110424193 CCCAGAACCTTGAGCCAAGAAGG - Intergenic
1013746024 6:113347526-113347548 CATAAGAAGCAGAGCCAAGAGGG - Intergenic
1013916664 6:115347524-115347546 CCCAGACACCAGGGCCAACAAGG - Intergenic
1019337252 7:491282-491304 CCTAGAAGTCAGAGTCAAGGAGG + Intergenic
1019499841 7:1359310-1359332 CCTAGGAGCCAGAGACAAGGTGG - Intergenic
1021970789 7:25963882-25963904 GCAGGAAACCAAAGCCAAGAAGG + Intergenic
1022694347 7:32689462-32689484 CCTAGACACGAGAACCATGATGG + Intergenic
1025858783 7:65307295-65307317 CAGAGAAACCAGAGCCCTGACGG + Intergenic
1028292787 7:89088318-89088340 CCTAGAAAACAAAGGCAAGGTGG + Intronic
1029945914 7:104532657-104532679 TCTGGAAACAAAAGCCAAGAAGG + Intronic
1031139587 7:117927264-117927286 CCAAGAAACCAAAACCATGAAGG - Intergenic
1035546578 8:486389-486411 CCCAGTAGCCACAGCCAAGAAGG - Intergenic
1037514668 8:19618731-19618753 CCTAGAAACCACAGTTCAGACGG + Intronic
1037767381 8:21780520-21780542 GGTAGAAACCAGGGCCAAGGGGG - Intronic
1038146810 8:24904924-24904946 CCTAGAAACCAGAGAAGATAAGG + Intergenic
1047008941 8:120650176-120650198 TCCGGGAACCAGAGCCAAGATGG - Intronic
1047520576 8:125592625-125592647 CCTAGAAACCAGAGAAATCAAGG - Intergenic
1049576607 8:143392654-143392676 CCTAGCAGCCAGAGCCAGGGAGG + Intergenic
1050911599 9:11078518-11078540 TATAGAAACCAGAGAAAAGAAGG - Intergenic
1051667079 9:19475697-19475719 GCTAGAAACAAGAGCCAACCTGG - Intergenic
1052012766 9:23430518-23430540 CCTAGAGACCAAAGCAAAGCAGG + Intergenic
1053297801 9:36927328-36927350 CCAAGAAAGCAGAGCCAACCTGG + Intronic
1055550644 9:77429369-77429391 CCTGGATACCAGACTCAAGAGGG + Intronic
1056033884 9:82583746-82583768 CCTTGGAACCAGATCAAAGAGGG - Intergenic
1056376864 9:86023151-86023173 CTTGGAAAGGAGAGCCAAGAGGG - Intergenic
1056440084 9:86612044-86612066 ACAAAAAACTAGAGCCAAGATGG - Intergenic
1056835943 9:89955159-89955181 CCTAAAAACCCGAGGCAAAATGG + Intergenic
1059018533 9:110547964-110547986 CCCAGAAACTAGAGTCAACAAGG - Intronic
1062453808 9:136626580-136626602 CCGGGAAGCCAGAGCCACGACGG + Intergenic
1186681138 X:11875596-11875618 CCTAGAATCCAGCCCCTAGAAGG + Intergenic
1187239698 X:17501401-17501423 CCTTGAGACCATAGCCAAGGTGG + Intronic
1191593552 X:62916426-62916448 TTTGGAAAACAGAGCCAAGAAGG + Intergenic
1193029227 X:76879993-76880015 CTGAGAAACTGGAGCCAAGATGG + Intergenic
1194137163 X:90160677-90160699 CTCTGAAACCAGAGACAAGAAGG - Intergenic
1195762709 X:108264059-108264081 CCTAGAAACAAAACCCAGGAAGG - Intronic
1195901768 X:109805891-109805913 CCTAGAAATCACATCAAAGAAGG - Intergenic
1196536027 X:116845481-116845503 CCTAGATTCCAGAGCAGAGATGG + Intergenic
1197075965 X:122352605-122352627 TCTAGAAAGCAGATCCAAAAGGG + Intergenic
1199156271 X:144552035-144552057 CCTGGAAAGCAGTCCCAAGAAGG + Intergenic
1199523316 X:148762722-148762744 CCTAGCAGCCAGAGCACAGAGGG - Intronic
1199760750 X:150902382-150902404 CTTAGGGACCAGAGCCGAGAGGG + Intergenic
1199983395 X:152933497-152933519 CCAAGAAGCCAGAGCCCAGCTGG - Intronic
1200482898 Y:3730601-3730623 CTCTGAAACCAGAGACAAGAAGG - Intergenic