ID: 932381400

View in Genome Browser
Species Human (GRCh38)
Location 2:71287133-71287155
Sequence GAGGCTGTTAAGACCCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932381400 Original CRISPR GAGGCTGTTAAGACCCAGCT AGG Intronic
900341101 1:2189754-2189776 GTGGCTGTCAACATCCAGCTGGG + Exonic
900605826 1:3523134-3523156 GAGGCTGCTCAGAGCCGGCTTGG + Intronic
900959555 1:5910279-5910301 GAGGCTGTCATGAGCCAGGTGGG - Intronic
900988102 1:6085065-6085087 CAGGCTGTTAACACCCGCCTTGG - Intronic
903666948 1:25013925-25013947 GTGGCTGTTAAGTCCCAACTCGG - Intergenic
903932118 1:26868548-26868570 GAGGCGTTCAAGACCCACCTGGG - Intergenic
903982212 1:27197341-27197363 GAGCCTGTTAACATCAAGCTGGG - Intergenic
904501211 1:30913815-30913837 GAGGCTGTGTAGACTCAGCAGGG + Intergenic
906472678 1:46144325-46144347 GAGCTTCTTAAGGCCCAGCTTGG + Intronic
906613712 1:47220949-47220971 GAGGCTGTGAAGAAACAGCCAGG + Intronic
911146130 1:94554182-94554204 GAGGCTGATCTGAGCCAGCTTGG - Intergenic
912750363 1:112282538-112282560 GAGCCTGTTAGGAACCAGCAGGG - Intergenic
912893193 1:113557501-113557523 CTGGCTGTGAAGAGCCAGCTGGG - Intronic
913516920 1:119612813-119612835 GAGTCTGCAAAGACCCAGGTGGG + Intergenic
915368331 1:155327899-155327921 GAGCCTGTCTAGACCCTGCTGGG + Intronic
916247696 1:162705261-162705283 GGGGCTGTTAAGACGCAGTCAGG - Intronic
918138765 1:181702289-181702311 TAGACTGTGAAGACACAGCTAGG - Intronic
920044763 1:203126191-203126213 GAGACTGTGAAGACCCAGATGGG - Intronic
920200389 1:204256669-204256691 GAGGCTGCTAAAAACCAGCCAGG + Intronic
921069541 1:211647838-211647860 GTGTCTGGTCAGACCCAGCTTGG + Intergenic
922179871 1:223225236-223225258 GAGGAAGAGAAGACCCAGCTGGG + Intronic
923783261 1:237043545-237043567 GAGGCTCTCCAGTCCCAGCTTGG - Intronic
1064992693 10:21269891-21269913 AAAGTGGTTAAGACCCAGCTAGG + Intergenic
1065201528 10:23317222-23317244 GGCGCTGTTATGACCCAGCCAGG - Exonic
1067437923 10:46291958-46291980 GAGCTTGTTAAGAGCCTGCTGGG + Intronic
1070940189 10:80337673-80337695 GAAGGTGTGAAGACCCAGATAGG - Intronic
1071263282 10:83940519-83940541 GAGGTTGTTAAGACAGAGGTTGG + Intergenic
1071299716 10:84247541-84247563 GGGGCTGCTGAGGCCCAGCTGGG - Intronic
1073362198 10:102908764-102908786 GAGGCTGTGATGCCCCACCTTGG + Intergenic
1075540818 10:123312279-123312301 GAGGATGTGAAGACTCATCTTGG - Intergenic
1079413307 11:20209537-20209559 GAGGCTGTTAAGTACCATTTTGG + Intergenic
1081268521 11:41057250-41057272 GAGTGTGTGAACACCCAGCTGGG - Intronic
1081739086 11:45425622-45425644 GAGGCTGTTTGAGCCCAGCTGGG + Intergenic
1085606299 11:77902558-77902580 GAGGCAGTTAAGGCTCAGCAAGG - Intronic
1086690718 11:89786836-89786858 GAGGCTGTTCAGGCCCAGTCAGG + Intergenic
1088328887 11:108629431-108629453 GGTGCTGTCACGACCCAGCTGGG - Intergenic
1088988567 11:114930486-114930508 GAGACTGTTAAGACAAGGCTTGG + Intergenic
1095489314 12:42716655-42716677 GAGGCTATTAAGTCCCAGAGAGG - Intergenic
1097265477 12:57741985-57742007 GAGGCGGTTTAGAGCCTGCTTGG + Intronic
1098139240 12:67434796-67434818 GAGGCTGGAAAGTCCCAGCCTGG - Intergenic
1102454607 12:113063809-113063831 TAGGCTGTTACCACCCAGATGGG + Intronic
1102601000 12:114030331-114030353 GAGGCAGTTAGGGCCCAGCTGGG + Intergenic
1104725594 12:131073679-131073701 GAGGCTGTGAAGTCCAAGCTCGG + Intronic
1107308349 13:39047706-39047728 GAGCCTGCTAAGATTCAGCTGGG - Exonic
1108910271 13:55540981-55541003 GAGGCAGTTAGAAGCCAGCTAGG - Intergenic
1110172061 13:72512731-72512753 GAGGGTGATAAGGCTCAGCTAGG - Intergenic
1110980283 13:81889243-81889265 GATACTATTGAGACCCAGCTGGG + Intergenic
1111595313 13:90403754-90403776 GACGCTGTTGAGACCTGGCTGGG + Intergenic
1116060641 14:39920460-39920482 GAGGCTGGCAAAACCCAGGTAGG + Intergenic
1117459217 14:55927848-55927870 GTGGCAGTGAAGCCCCAGCTTGG + Intergenic
1118328306 14:64796459-64796481 GAGGCTGTGAGAAGCCAGCTTGG + Intronic
1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG + Intronic
1120286813 14:82513370-82513392 AATGCTGTTAAGACTCAGCAAGG - Intergenic
1122471470 14:101969939-101969961 TAGGATTTTAAGACCCAGTTGGG + Intronic
1126925160 15:53577084-53577106 GATGCTGTTAGGACACAGCCAGG + Intronic
1127356102 15:58201443-58201465 GATGCTGTTAAGACCCATGTGGG + Intronic
1128737507 15:70061551-70061573 GTGGCTGTTACCACCGAGCTGGG + Intronic
1129665430 15:77576949-77576971 GAGGCTGTGATGACCCAAGTGGG - Intergenic
1133153855 16:3857904-3857926 GAGGCTGGGAAGACCCAGTGAGG + Intronic
1134419216 16:14070910-14070932 GAGGCTGGTAATACCCACTTTGG + Intergenic
1137305266 16:47192666-47192688 GACTCTGGTAAAACCCAGCTTGG + Intronic
1139951794 16:70676024-70676046 GAGGCTCTTCAGACCCTGCGTGG - Intronic
1142239485 16:88938689-88938711 GCGGGTGTTCAGACCCAGCATGG - Intronic
1143368850 17:6425891-6425913 GAGGCTGGTGAGTCCCAGCTGGG - Intronic
1145272910 17:21414102-21414124 GAGGGTGGTGGGACCCAGCTTGG + Intronic
1145311113 17:21701538-21701560 GAGGGTGGTGGGACCCAGCTTGG + Intronic
1147674118 17:42193137-42193159 GAGGATGTAAGGACCCAGCATGG + Intronic
1149679297 17:58493990-58494012 GAGGCAGTTGAGACCCAGATTGG - Intronic
1150559301 17:66281093-66281115 GAGGCTGAAAGGACCCAGCGTGG - Intergenic
1151386717 17:73759546-73759568 GAGGGTGTGAAGACACAGCTTGG + Intergenic
1151658472 17:75506687-75506709 GTGGCTGTTCAGAAGCAGCTGGG + Exonic
1151758923 17:76089862-76089884 GAGGCTGGTAAGTCCCAGAGAGG + Intronic
1152095799 17:78270874-78270896 GAGGCTCTGCAGACCCAGCTGGG - Intergenic
1152228112 17:79102017-79102039 GAGGCTGCCAAGGCCCACCTAGG + Intronic
1154021639 18:10668698-10668720 GAGGCTGTTGCCACCCAGCCAGG + Intronic
1160017945 18:75158496-75158518 AAGGGCGTTAAGACACAGCTGGG + Intergenic
1160056194 18:75483351-75483373 GAGGCAGTTAGAAGCCAGCTAGG + Intergenic
1160563337 18:79772311-79772333 GGGGCAGTTAGGACCCTGCTGGG + Intergenic
1161297677 19:3527932-3527954 GAGGCTGGGAGGCCCCAGCTAGG - Intronic
1161341773 19:3746919-3746941 GACGCTGTGCAGGCCCAGCTGGG + Intronic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1166718465 19:44984115-44984137 GAGGCTGTGAATCCCCAGCCAGG - Intronic
1167086068 19:47310432-47310454 GAGGCTGGAAAGAACCAGTTTGG + Intronic
1167590394 19:50401709-50401731 GAGGCTGTGGAGACACACCTTGG + Intronic
925333317 2:3075300-3075322 GACGCTGTTAGGACCCAGAGTGG + Intergenic
928411022 2:31053875-31053897 AAGGCTGGTAAGACCCTTCTGGG + Intronic
928630696 2:33188798-33188820 GTGGCTGCTAAGACACAGCTTGG + Exonic
928797066 2:35034933-35034955 GGTGCTGTTATGACCCAGCCAGG - Intergenic
931757115 2:65384207-65384229 GAGGCTGATAACACCACGCTGGG - Intronic
932381400 2:71287133-71287155 GAGGCTGTTAAGACCCAGCTAGG + Intronic
932429619 2:71666305-71666327 GAGGCTGGTAAGACCAAGAGTGG + Intronic
932905948 2:75751365-75751387 GAGCCTGTTAAAACACAGATTGG - Intergenic
933258091 2:80103210-80103232 GAGGCTGAAAAGTCCCAGATTGG + Intronic
936499257 2:113052889-113052911 GAGGATGTGAAGAGCCAGGTTGG - Intergenic
937229823 2:120391186-120391208 GAGGTTCTGAAGCCCCAGCTTGG + Intergenic
938120741 2:128631485-128631507 GAGGCTGTGGGGACCGAGCTTGG + Intergenic
938729918 2:134139299-134139321 GTGGCTGTTAAGATCCAGAATGG + Intronic
939192360 2:138931602-138931624 GAGGCTGTTGAGACTCTGCACGG - Intergenic
940091023 2:149917083-149917105 GAGGCTGTCAACACCTGGCTTGG + Intergenic
946942193 2:224781009-224781031 GAGGCTGTAAGGACCGCGCTTGG + Intronic
947102719 2:226638731-226638753 GAGGCTGTGTTGCCCCAGCTGGG - Intergenic
948660997 2:239506353-239506375 GATGCTGTGAGGACCCAGCTCGG + Intergenic
1171190034 20:23152206-23152228 GAGGCAATGAAGACCCAGCCCGG + Intergenic
1171869877 20:30516134-30516156 GAGGCTATTTAAACCCAGCCTGG - Intergenic
1172805238 20:37607237-37607259 CTGGCTGTTAAGCCCCACCTTGG + Intergenic
1173352658 20:42259523-42259545 AGGGCTGCCAAGACCCAGCTGGG + Intronic
1173384535 20:42575349-42575371 AAGGCTGTGAAGAGCCAGCCAGG + Intronic
1174343717 20:49914750-49914772 GCGGCTGCTAAGTCCCAGCTCGG + Intronic
1175939506 20:62531559-62531581 GAGGCTGGTAGGACCCACCATGG + Intergenic
1176034622 20:63030119-63030141 GAGGCTGCTCCGACCCTGCTCGG + Intergenic
1180928797 22:19574664-19574686 CAGACTGTTGAGCCCCAGCTCGG + Intergenic
1185233831 22:49699777-49699799 GAGGCTCTCAAGCCCCGGCTGGG + Intergenic
951319475 3:21227089-21227111 GAGTCATTGAAGACCCAGCTGGG - Intergenic
951508957 3:23480240-23480262 GAGCATGTTCATACCCAGCTGGG + Intronic
953748260 3:45591441-45591463 GATACTGTCACGACCCAGCTGGG - Intronic
953885336 3:46711848-46711870 GGGGCTGCCAGGACCCAGCTGGG - Intergenic
954623991 3:52012458-52012480 GAGGGTGTGAAGACCCAGACAGG - Intergenic
954716435 3:52529087-52529109 GAGGCTGGCCAGACCCACCTTGG - Intronic
959576407 3:107939068-107939090 GAGGCTGCTGAGACCAAGGTAGG + Intergenic
961754404 3:129119551-129119573 GAGGCTGTTGGGAATCAGCTGGG - Intronic
962445389 3:135459329-135459351 GAGGCTGTTAAGAGCACACTGGG - Intergenic
965466853 3:169040458-169040480 GAGGCTGTGATGATACAGCTAGG - Intergenic
966528526 3:180946790-180946812 GTGGCTGTTAACAGCCATCTGGG - Intronic
966918710 3:184598747-184598769 CTGGCTGAGAAGACCCAGCTAGG + Intronic
966946348 3:184779578-184779600 GAGGATGTTAAGACTCTCCTGGG + Intergenic
968809108 4:2792254-2792276 GAGGCTGGGGAGACCAAGCTGGG - Intergenic
969859673 4:10025798-10025820 GAGGCTGTTAAGGTGAAGCTGGG - Intronic
975977525 4:80116024-80116046 CTGGCTGGGAAGACCCAGCTGGG - Intronic
982901103 4:161003630-161003652 GCTGCTGTTGCGACCCAGCTGGG - Intergenic
985748642 5:1661926-1661948 GAGCCTGTTTAGCCCCTGCTGGG + Intergenic
988638479 5:33014859-33014881 GAGGCTCTTAGCACCCAGCCTGG - Intergenic
991630654 5:68653578-68653600 GCTGCTGTCAAGTCCCAGCTGGG + Intergenic
993029318 5:82686373-82686395 TAGACTGTTAAGAGCCAGCAGGG + Intergenic
993479545 5:88407440-88407462 AAAGCTGTTAAGGCCCAGCATGG + Intergenic
993556323 5:89343969-89343991 AAGGATGTTAACCCCCAGCTGGG + Intergenic
994891237 5:105639481-105639503 GACGCTGATATGACACAGCTGGG + Intergenic
999142506 5:149371788-149371810 GAGCCTGGGAAGAGCCAGCTGGG + Intronic
1002185126 5:177450857-177450879 GAGGCTGTTAAAACAGTGCTGGG - Intronic
1002426281 5:179178174-179178196 CAGGCTGGAAAGACCCGGCTTGG + Intronic
1004398188 6:15264934-15264956 GCTTCTGTTCAGACCCAGCTGGG + Intronic
1006463864 6:34179357-34179379 GGTGCTGTCATGACCCAGCTGGG - Intergenic
1012228976 6:96737791-96737813 GCTGCTGGTAAGCCCCAGCTTGG - Intergenic
1012388453 6:98708808-98708830 GAGGCTGTTGAAAGCCAGGTGGG - Intergenic
1014480806 6:121934570-121934592 TAGGCTATTAATGCCCAGCTGGG + Intergenic
1015096294 6:129417820-129417842 GAGGCTGTTGCAACCCAGCCAGG - Intronic
1015917976 6:138237584-138237606 GAGACTGGTAAGACCCAAATAGG + Intronic
1018004586 6:159609941-159609963 GAAGCTGTGGAGACCAAGCTTGG + Intergenic
1019993556 7:4708772-4708794 GAGGCTGGTAAGGCCGGGCTTGG + Intronic
1021139700 7:17008895-17008917 GATGAAGTTAATACCCAGCTTGG - Intergenic
1022467765 7:30662864-30662886 GAGGCTGTCAGGAGGCAGCTTGG + Intronic
1022497262 7:30860880-30860902 GAGGCTGTGAAGGTCCAGCAGGG - Intronic
1024292204 7:47812802-47812824 GAGACAGTAAACACCCAGCTTGG + Intronic
1024593860 7:50915896-50915918 GAGGCTTTTCAGACAAAGCTTGG - Intergenic
1025846315 7:65201479-65201501 GAGGCAGTTAAGGCTCAGCAAGG + Intergenic
1025896563 7:65707386-65707408 GAGGCAGTTAAGGCTCAGCAAGG + Intergenic
1026175245 7:67990947-67990969 GAGGCTGGGATGACCCAGCCAGG + Intergenic
1026534395 7:71228175-71228197 GGGGCTGTTTAGAGACAGCTGGG - Intronic
1027047066 7:74998109-74998131 GAGGCAGTTCAGCCCCGGCTCGG + Intronic
1027184185 7:75960517-75960539 CAGGAGGTTAAGACCCAGCCTGG - Intronic
1030491133 7:110235914-110235936 GAGGCTCTCAGGACCCAGCCTGG + Intergenic
1032343684 7:131099741-131099763 GAGTCTGTTAAAACTCAGATTGG - Intergenic
1033705454 7:143882028-143882050 GAGGCTGTCAGCACTCAGCTTGG + Intronic
1035565156 8:636232-636254 GAGGCTGTGAACGCCCAGCTCGG - Intronic
1038462407 8:27728281-27728303 GAGATTGTAAAGACCCAGTTGGG + Intergenic
1042388260 8:68202796-68202818 GAGGCTGAGAAGTCCCAGGTAGG + Intronic
1042568027 8:70132424-70132446 GAAGCTGTGATGACCCACCTGGG + Intronic
1044194602 8:89359272-89359294 GAAGCTGTCAAAATCCAGCTGGG + Intergenic
1052267915 9:26595556-26595578 GAGGCTGTTAAAACCCAGCCTGG - Intergenic
1053445004 9:38146055-38146077 GGTGCTGTCATGACCCAGCTGGG + Intergenic
1186868760 X:13748370-13748392 GTGTCTTTCAAGACCCAGCTTGG + Intronic
1188434817 X:30148292-30148314 GACGCTGTCAAGACCCGGCCAGG + Intergenic
1191055154 X:56233103-56233125 GAGTCGATTCAGACCCAGCTGGG - Exonic
1191669843 X:63738979-63739001 GAGGACATTAAAACCCAGCTGGG - Intronic
1191764491 X:64682429-64682451 GAAGTTCTTAAGACCCAGCCAGG + Intergenic
1200036552 X:153334877-153334899 GGGGCGGTTAAGCCTCAGCTTGG + Intronic