ID: 932390055

View in Genome Browser
Species Human (GRCh38)
Location 2:71380692-71380714
Sequence TGGCCCCTGTATTAAGCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932390053_932390055 -4 Left 932390053 2:71380673-71380695 CCAAATTACATTCTTTAATTGGC 0: 1
1: 0
2: 4
3: 28
4: 241
Right 932390055 2:71380692-71380714 TGGCCCCTGTATTAAGCAGGCGG 0: 1
1: 0
2: 1
3: 17
4: 111
932390051_932390055 -3 Left 932390051 2:71380672-71380694 CCCAAATTACATTCTTTAATTGG 0: 1
1: 0
2: 1
3: 28
4: 350
Right 932390055 2:71380692-71380714 TGGCCCCTGTATTAAGCAGGCGG 0: 1
1: 0
2: 1
3: 17
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932390055 Original CRISPR TGGCCCCTGTATTAAGCAGG CGG Intronic
901659354 1:10788969-10788991 TGGCCACTGTGAGAAGCAGGAGG - Intronic
904574842 1:31498661-31498683 TGGTCCCTGTTTTAAGCAGAGGG + Intergenic
905218381 1:36426534-36426556 TGGGCCCTGTTCTGAGCAGGGGG - Intronic
910111097 1:83684283-83684305 TGGCCCAGGTGTCAAGCAGGAGG - Intergenic
911435692 1:97854998-97855020 TGGCCCCTGAGATATGCAGGAGG - Intronic
913164048 1:116168940-116168962 TGGCTCCTGTACTCAGCAGTAGG - Intergenic
915953950 1:160207904-160207926 AGGTCCCTGTATTGGGCAGGAGG - Intronic
916011710 1:160712124-160712146 TAGCCCCTGAATTAATCAGAGGG - Intergenic
916816950 1:168363401-168363423 TGGCTCCTGTAGTATGTAGGAGG + Intergenic
922239478 1:223746216-223746238 TGACCCCAGTATTGAGCAGTGGG - Intronic
924738233 1:246778552-246778574 TGGCCCCTCTATTAAATAGTTGG + Intergenic
1069745458 10:70712212-70712234 TGGCCCCTGGAGCCAGCAGGTGG + Intronic
1069803751 10:71103715-71103737 TGGCCCAAGTATTATGAAGGGGG - Intergenic
1073890815 10:108098299-108098321 TGGCATCTGTATTATGCAGGAGG + Intergenic
1078871994 11:15355773-15355795 AGGCTCCTGTAGTAAGCTGGTGG - Intergenic
1078992732 11:16665655-16665677 AGGCCTCTGCAATAAGCAGGAGG - Intronic
1080436757 11:32251944-32251966 TGGCCCCTGTGCTAAGCATTTGG - Intergenic
1081889288 11:46527011-46527033 AGGCCCCTGTATTAGTCAGAAGG + Intronic
1082683391 11:56207623-56207645 TGGCCCGTATATGAGGCAGGAGG - Intergenic
1090236545 11:125152416-125152438 TGGCTCCTGAATTAGACAGGAGG + Intergenic
1093122564 12:15290264-15290286 TTGCCTTAGTATTAAGCAGGAGG - Intronic
1094201308 12:27797328-27797350 TGGCTTCTGTATTAAGTAGTCGG + Intronic
1096796379 12:54080565-54080587 GAGCCCCTGTTTTAAGAAGGAGG - Intergenic
1098134990 12:67392529-67392551 TGGCCCCCTAATAAAGCAGGGGG + Intergenic
1102535839 12:113580329-113580351 TGGCCCCTGTATTTATCATTTGG - Intergenic
1104376789 12:128270102-128270124 TTGCGCCTGTATAAAGCAAGTGG + Intronic
1105006799 12:132726470-132726492 TGGCTCCTGAATGAAGCAGGCGG + Exonic
1107883368 13:44853249-44853271 TGGCTACTGTATTGGGCAGGTGG - Intergenic
1110621395 13:77599815-77599837 TGACCCTTGTACTAAGCAGGAGG - Intronic
1113575130 13:111389997-111390019 TGGCCCCTGGAAGAGGCAGGAGG + Intergenic
1115346078 14:32344586-32344608 TGACCACTGTGTTAAGCAAGTGG + Intronic
1123126046 14:105946953-105946975 TGGTCCCTGTATGAAGCAGTGGG - Intergenic
1123406630 15:20023375-20023397 TGGTCTCTGTATGAAGCAGTGGG - Intergenic
1123515960 15:21030023-21030045 TGGTCTCTGTATGAAGCAGTGGG - Intergenic
1125406507 15:39357701-39357723 TGTCCCCTGTTCTAAGCAAGTGG - Intergenic
1127787908 15:62372291-62372313 TAACCCCTGTATTAGTCAGGGGG - Intergenic
1128385694 15:67146814-67146836 TGCTCCTTGGATTAAGCAGGAGG - Intronic
1128516743 15:68346868-68346890 TATCCCCTGCATTGAGCAGGGGG + Intronic
1129905358 15:79183460-79183482 TGACACCTGGATTAGGCAGGAGG - Intergenic
1130298877 15:82665522-82665544 TGGCCTTGGCATTAAGCAGGTGG + Exonic
1132200973 15:99954507-99954529 TGGCCCCTGGCTGAAGCAAGGGG + Intergenic
1135207387 16:20494646-20494668 TGGCCCCTGAAGTCAGGAGGGGG + Intergenic
1135211498 16:20528986-20529008 TGGCCCCTGAAGTCAGGAGGGGG - Intergenic
1138353915 16:56362782-56362804 TTGCCGCTGTATAAAGCATGTGG - Exonic
1143150119 17:4802428-4802450 TGGCGCCTGTAATCACCAGGCGG - Intergenic
1144967495 17:19087299-19087321 TGGCCCCTGGATGAAGGAGGAGG + Intergenic
1144980424 17:19164766-19164788 TGGCCCCTGGATGAAGGAGGAGG - Intergenic
1144987798 17:19213466-19213488 TGGCCCCTGGATGAAGGAGGAGG + Intergenic
1152962032 18:85914-85936 TGGCCCCTGCAGTAACCACGTGG + Intergenic
1156208449 18:34911786-34911808 TGGCTCCTGTATCAAGCTGTAGG - Intergenic
1156480648 18:37434469-37434491 TGGCCCCTGTCTAAAACAGGGGG + Intronic
1157090206 18:44627885-44627907 TGGCCTCAGCCTTAAGCAGGAGG + Intergenic
1161369818 19:3904713-3904735 TGGATCCTGTATTATCCAGGTGG + Intronic
1161484247 19:4526110-4526132 TGGGCCCTGTTTTACACAGGAGG + Intronic
1162502331 19:11060932-11060954 AGGCCCCTGTGTCAGGCAGGAGG + Intronic
1163434955 19:17289899-17289921 TGGCCCCTGTTTTACACTGGAGG - Intergenic
1163736798 19:18986490-18986512 TGGCCTTTGTTTTAAGGAGGAGG + Intergenic
1165929577 19:39348004-39348026 TGGCCACTGTAGTAGACAGGGGG + Intronic
1166428110 19:42697719-42697741 GGGACCCTGTCTTAAGCAAGCGG + Intronic
925306686 2:2851662-2851684 TGACCCCTGGTTCAAGCAGGTGG - Intergenic
925704398 2:6670109-6670131 TGGCCCCCATCTTAAGCAGATGG + Intergenic
928424119 2:31164049-31164071 TCTCCCCTGTATTATGAAGGTGG + Intergenic
928768007 2:34670975-34670997 TGGGCTCTGTAGTCAGCAGGTGG - Intergenic
931715161 2:65022967-65022989 TGTCCCCAGTTTTAAGAAGGGGG - Exonic
931976741 2:67651695-67651717 TGGCAACTGCATTAAGCTGGAGG + Intergenic
932390055 2:71380692-71380714 TGGCCCCTGTATTAAGCAGGCGG + Intronic
933072985 2:77885460-77885482 TGGCCTCTATATTAAGGTGGTGG + Intergenic
935645167 2:105329014-105329036 TGGCCCCTGTTTTTAGCACCAGG - Intronic
935944088 2:108270275-108270297 TGGTCCCAGGAATAAGCAGGTGG + Intergenic
937949237 2:127370962-127370984 GGGACCCTGTCTTAAGCAAGTGG + Intronic
938627175 2:133123622-133123644 TGCCCTCTGTATTCATCAGGAGG + Intronic
947710992 2:232315780-232315802 TGCCCACTGAATTAAGCAAGAGG + Intronic
1169729468 20:8771070-8771092 TGGCTCCTGTATTGGGCAGCAGG - Intronic
1174916083 20:54655411-54655433 TGAGCCCTGTATTAAGGAGGTGG - Intergenic
1175352793 20:58337373-58337395 AGGACCCTGTATTACTCAGGTGG - Intronic
1178424571 21:32469105-32469127 TGGGCCCTGTTCTAAGCATGGGG + Intronic
949719880 3:6976606-6976628 TAGTCCCTGTATTATGCAGTTGG + Intronic
955385163 3:58473576-58473598 TTGCCCCTGTTTTATGGAGGAGG - Intergenic
958983482 3:100753051-100753073 TGGCTCCAGTATTTAGCATGGGG - Intronic
959276989 3:104288144-104288166 TGACCCCTGTATTAAACAACAGG - Intergenic
960419574 3:117427253-117427275 TGGCCCTTTGATTAACCAGGTGG - Intergenic
965562881 3:170078425-170078447 GGGACCCTGTCTTAAGCAAGCGG + Intronic
969478805 4:7436051-7436073 TGACCCCTGTACCCAGCAGGAGG - Intronic
971127494 4:23770419-23770441 TGGCTCCTGCATTAAGAAGTAGG - Intronic
972314804 4:37916432-37916454 TGTCCCCTGTATGAAGCAGGGGG + Intronic
980852200 4:138396375-138396397 TGGCTCCTGTCTTAATCAGTTGG - Intergenic
986560425 5:9055076-9055098 TGACCCCAGCATTCAGCAGGCGG - Intronic
987179189 5:15348624-15348646 TGGGCCATGTATTAAGCACAAGG + Intergenic
993353725 5:86880954-86880976 TGGTGCCTGTATCAGGCAGGTGG + Intergenic
998178191 5:139914912-139914934 TGGCCCCTGTAACCAGCTGGGGG - Intronic
1006013226 6:31059638-31059660 TGGCCCCTGGAATAAGCATGTGG + Intergenic
1007994531 6:46292250-46292272 TGGCCCCCAAATTAAGCAAGTGG + Intronic
1009041654 6:58187132-58187154 TCTCCCCTTCATTAAGCAGGAGG - Intergenic
1009217506 6:60941447-60941469 TCTCCCCTTCATTAAGCAGGAGG - Intergenic
1009402273 6:63271046-63271068 TGTCCCCTGTATTTAACAAGTGG + Intergenic
1009780913 6:68268377-68268399 TGTCCCATATGTTAAGCAGGTGG + Intergenic
1010415049 6:75602484-75602506 TGGGCCATGGATTAAGAAGGAGG + Exonic
1013802282 6:113961468-113961490 TGGCACCTGCATTAAAAAGGTGG - Intronic
1016889960 6:148995960-148995982 TGGAGCCTGTATTCAGCAGGGGG + Intronic
1018496260 6:164348363-164348385 TGGGCCCTGGTTTAAGCAGCTGG + Intergenic
1018649380 6:165979295-165979317 TGGCCCAGGTATGAAGCAGAAGG + Intronic
1021709625 7:23402158-23402180 TGAGCTATGTATTAAGCAGGTGG - Intronic
1024329388 7:48141072-48141094 GGGACCCTGTCTTAAGCAAGTGG + Intergenic
1027420613 7:78014527-78014549 GGGCCCTTGTATAGAGCAGGTGG + Intergenic
1034244472 7:149634202-149634224 TGGCCCCTGCATGAAGAAGGAGG - Intergenic
1034815734 7:154170510-154170532 CTGCCCCTGTAATGAGCAGGAGG - Intronic
1034957701 7:155344863-155344885 TGGCCCCTGGATTGCGCTGGCGG - Intergenic
1036156332 8:6345877-6345899 TGACCCCTGTATTAAACAGCAGG + Intergenic
1037906010 8:22716474-22716496 TGTCCCCTGTCTTCAGCAGCTGG + Intronic
1042037090 8:64545595-64545617 TGGCACCTGTATAATGCTGGAGG - Intergenic
1045822899 8:106362052-106362074 TGACCTCTGTGTTTAGCAGGTGG - Intronic
1047338775 8:123960041-123960063 TGGACCCTGTATAAAGCTAGGGG + Intronic
1047353435 8:124097501-124097523 TGGCCCCTGTCTTAAGGGAGGGG + Intronic
1049480920 8:142822199-142822221 GGGCCCCTGTGGTAAGGAGGAGG - Intergenic
1050160416 9:2713089-2713111 TGGCCCCAGCACTAAGAAGGGGG - Intergenic
1050987764 9:12104425-12104447 TTGCCCCTGGATCAAGCAGTGGG - Intergenic
1053785987 9:41653247-41653269 GAGCCCCTGTTTTAAGAAGGAGG - Intergenic
1054159064 9:61660950-61660972 GAGCCCCTGTTTTAAGAAGGAGG + Intronic
1054174702 9:61867180-61867202 GAGCCCCTGTTTTAAGAAGGAGG - Intergenic
1054449560 9:65396240-65396262 GAGCCCCTGTTTTAAGAAGGAGG - Intergenic
1054478838 9:65591955-65591977 GAGCCCCTGTTTTAAGAAGGAGG + Intergenic
1054662836 9:67713613-67713635 GAGCCCCTGTTTTAAGAAGGAGG + Intergenic
1062088122 9:134659003-134659025 TGGCCTCTGTGTAAGGCAGGAGG + Intronic
1062108395 9:134768127-134768149 GGGCCCCAGTATGCAGCAGGTGG + Intronic
1062352992 9:136148305-136148327 CGGCCCCTGAATTATGCAGGAGG + Intergenic
1062731798 9:138114087-138114109 AGGGCCCTGCATTAAGCAGGTGG + Intronic
1062736110 9:138138203-138138225 TGGCCCCTGCAGTAACCACGTGG - Intergenic
1191224795 X:58031618-58031640 TGGCCACTTTATTATGCAGGTGG + Intergenic
1193800145 X:85925233-85925255 TGGCCCTTGTACAAACCAGGTGG - Intronic
1198800284 X:140440646-140440668 TGGGTCCTGTATTAAGTATGGGG - Intergenic