ID: 932391892

View in Genome Browser
Species Human (GRCh38)
Location 2:71399309-71399331
Sequence AATGTTGGTCTGCCACATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932391892 Original CRISPR AATGTTGGTCTGCCACATGA AGG Intronic
903661438 1:24981228-24981250 AATGTAGGTCTGCTGCATGCTGG + Intergenic
904080836 1:27871892-27871914 TATGTTGGTCTGACTCCTGAGGG + Intergenic
907401914 1:54229545-54229567 ACTGTTGGTGTGGCAGATGAGGG + Intronic
917716615 1:177744864-177744886 AACGTTGGTGTGCCCCAGGATGG + Intergenic
922127150 1:222738861-222738883 AATGTTTTTCTGCCACCTAATGG - Intronic
1063271959 10:4519782-4519804 TATGATGGACTGCGACATGATGG + Intergenic
1065051858 10:21801220-21801242 AATGTTGGTTTGCTACAGAATGG + Intronic
1066997639 10:42578385-42578407 CATGTTGGCCTGTCCCATGAAGG - Intronic
1068275298 10:54787637-54787659 AATGTTTTTCTGCCCCATGAAGG - Intronic
1075889489 10:125934466-125934488 AATGTTGGGCAGGCAGATGAAGG + Intronic
1076321427 10:129584844-129584866 AATGTGGTTCATCCACATGATGG - Intronic
1078418556 11:11187311-11187333 GATGTTAGTCTGACAAATGAAGG + Intergenic
1082801905 11:57421128-57421150 AAGGAGGGTCTGCCACATGCTGG - Intronic
1086721988 11:90132430-90132452 AATTTTGATCTGCCTCTTGAGGG + Intronic
1086863556 11:91953131-91953153 AATGGTGGCCTGCCACAAGGCGG - Intergenic
1092547001 12:9460989-9461011 GAAATTGTTCTGCCACATGAGGG + Intergenic
1098503344 12:71220242-71220264 AATGTTGGACAGCTTCATGAAGG - Intronic
1101063175 12:100992774-100992796 AATGCTGGTCTTCTAAATGAAGG + Intronic
1102549486 12:113681233-113681255 AATACTAGTCAGCCACATGAAGG + Intergenic
1104264627 12:127219999-127220021 GATGTTGCTCAGCCACAGGACGG - Intergenic
1107259683 13:38475702-38475724 AAAGCTGGTCTGATACATGAGGG - Intergenic
1107585739 13:41846338-41846360 CCTGTTAGTCAGCCACATGAGGG + Intronic
1109007134 13:56892725-56892747 TAGGTTGGTCTTTCACATGATGG - Intergenic
1116161550 14:41272042-41272064 AATGTTTGAGTGCCACGTGAGGG + Intergenic
1116983664 14:51196697-51196719 AATGACGGTCTGTCACAGGAAGG + Intergenic
1120578210 14:86210757-86210779 AATGTTGAAATACCACATGAAGG + Intergenic
1125398382 15:39274255-39274277 AATATTAGTGTGCCACATAAAGG + Intergenic
1138707973 16:58937283-58937305 AATGTTGGGGTGACACATTAAGG - Intergenic
1141274323 16:82572498-82572520 AATATTGATCTGTCACTTGAGGG + Intergenic
1142107549 16:88313141-88313163 AATGTGCCTCAGCCACATGAAGG - Intergenic
1147167048 17:38599100-38599122 AATATTGCTTTGCCACATGGAGG - Intronic
1147671262 17:42178172-42178194 AATTTCGGTCTGCCAGAAGACGG - Exonic
1151358264 17:73573008-73573030 AGTGCAGGTGTGCCACATGAAGG + Intronic
1153056794 18:953641-953663 AATGTTTGTCTACCAAATGAAGG + Intergenic
1159082162 18:63747137-63747159 AATGTTGGTGTGTCTCATGGTGG + Intergenic
1159404814 18:67986479-67986501 AATGTCTGTCTACCACATGGTGG + Intergenic
1168012498 19:53544585-53544607 AATTATGGTCTGCTATATGATGG - Intronic
1168570756 19:57466905-57466927 CATGTTGGTCTGCCAAGGGATGG + Intronic
928030717 2:27776436-27776458 ATTGTTGGTCTGCTTTATGAAGG + Intronic
930565182 2:53009782-53009804 ACTGTGGGTCTGCTGCATGAAGG + Intergenic
932391892 2:71399309-71399331 AATGTTGGTCTGCCACATGAAGG + Intronic
932811343 2:74828952-74828974 AATGTGGGTCTTGCACCTGAGGG - Intergenic
934102905 2:88669813-88669835 GAGGATGGTCTGCCACCTGATGG + Intergenic
935617299 2:105099805-105099827 ACTGTGTGTCTGCCACATGTCGG - Exonic
935815079 2:106839707-106839729 GATCTTGGTTTCCCACATGAAGG + Intronic
935960111 2:108417446-108417468 AATGTTGGAATGCCACCTGGTGG - Intergenic
941587873 2:167382194-167382216 AATGAAGTTTTGCCACATGAGGG - Intergenic
943934300 2:193895205-193895227 AATGTTAAGCTGCCACATGTTGG - Intergenic
944949366 2:204729663-204729685 AATGGTTCTCTGCCACAAGATGG - Intronic
945793190 2:214330802-214330824 AATGTTGTGGTGCCAAATGAGGG + Intronic
948145717 2:235707035-235707057 AATGTTTGTCTGCAGCATGTTGG + Intronic
948353797 2:237361250-237361272 AGTGCTGCTCTGCCAAATGAAGG - Intronic
1173266321 20:41486182-41486204 AATGTCAATCTGCCACATGCTGG + Intronic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1184649316 22:45912461-45912483 AATGATGGTCAGCCACTTCACGG + Intergenic
952474729 3:33696211-33696233 AATATTGGTCTGCAACATGCTGG + Intronic
956692804 3:71893342-71893364 AATGATGCACTGCCACGTGATGG - Intergenic
962949907 3:140208779-140208801 AATGCAGTTCTGCCACATAAAGG + Intronic
965376875 3:167935886-167935908 AATGTTGGTCTCTCTCATGCAGG - Intergenic
966634826 3:182120879-182120901 CTAGATGGTCTGCCACATGATGG - Intergenic
972963633 4:44484286-44484308 GATGTCTGTCTGCAACATGATGG - Intergenic
978660934 4:111125386-111125408 ATTGGTGGTATGCCACATGATGG + Intergenic
979067896 4:116161918-116161940 AATATTGTTCTTCCACATTATGG + Intergenic
983649015 4:170020348-170020370 AATATTGGGCTGCCACATCCTGG + Intronic
991163954 5:63539914-63539936 AGTACTGGTCTGCAACATGAGGG - Intergenic
991253381 5:64588132-64588154 AATTTTTGTCTGCAACATAAAGG + Intronic
999237238 5:150106231-150106253 AAAGTTCCTCTGCCACAGGAAGG - Intronic
1003289706 6:4769565-4769587 AATGTTGATCTCTCGCATGATGG + Intronic
1004610728 6:17236930-17236952 AATATTGGGGTGCAACATGAAGG - Intergenic
1006530776 6:34651530-34651552 ATGGTTAGTCTGCCACAAGATGG + Intronic
1018113561 6:160560560-160560582 CATGTTTGTCAGCCACATAAAGG + Intronic
1028102450 7:86837747-86837769 AATCTTAGACTGCTACATGAGGG + Intronic
1030938480 7:115616005-115616027 CATGTTGGTCTACTACATCAAGG - Intergenic
1031107583 7:117564437-117564459 AATGTCTGTGTGCCAAATGAAGG + Intronic
1032142482 7:129345283-129345305 AAAGTAAGTCTGCCACCTGAAGG + Intronic
1033775898 7:144610897-144610919 AATGTTGGTCAGGCATTTGATGG + Intronic
1034031430 7:147770151-147770173 AATGTGGCTCTGCCACACCAAGG + Intronic
1043041340 8:75265692-75265714 AATATTAGTCTGCCACAAAAAGG + Intergenic
1043759317 8:84046641-84046663 AATGTTGGTCTCCCAGTTAAAGG + Intergenic
1046036131 8:108843664-108843686 AATGTTTGTCTGACAGATGTAGG + Intergenic
1047350707 8:124070943-124070965 ACTGTAAGTCTGCCAGATGAAGG - Intronic
1048888598 8:138928751-138928773 AATGATTGTCAGCCTCATGAAGG + Intergenic
1049468140 8:142762824-142762846 AATGTTATTCAGCCACATAAAGG - Intergenic
1049931185 9:458469-458491 AATGTTTGTCTGCCACACTGAGG + Intronic
1052911549 9:33886939-33886961 AATGTTGGGGTGCCACATTTTGG - Exonic
1057140404 9:92723365-92723387 AATGTTGTTCAGCCACAATAAGG + Intronic
1057530282 9:95839060-95839082 AGTGCTGGCCTGCCACTTGATGG + Intergenic
1061338502 9:129960029-129960051 AATGTGGGATAGCCACATGATGG - Intronic
1192734355 X:73834569-73834591 TTTGTTGGTCTGCAAGATGACGG - Intergenic
1202260938 Y:22969493-22969515 TATGTTGCTCTGGCACAGGAAGG - Intergenic
1202413926 Y:24603234-24603256 TATGTTGCTCTGGCACAGGAAGG - Intergenic
1202456858 Y:25066852-25066874 TATGTTGCTCTGGCACAGGAAGG + Intergenic