ID: 932400158

View in Genome Browser
Species Human (GRCh38)
Location 2:71474930-71474952
Sequence CTGTGATAGGGGAGGGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1211
Summary {0: 1, 1: 0, 2: 8, 3: 73, 4: 1129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932400149_932400158 10 Left 932400149 2:71474897-71474919 CCATGTTACTCCTGTAGGTCACA 0: 1
1: 0
2: 2
3: 16
4: 198
Right 932400158 2:71474930-71474952 CTGTGATAGGGGAGGGGAAGTGG 0: 1
1: 0
2: 8
3: 73
4: 1129
932400151_932400158 0 Left 932400151 2:71474907-71474929 CCTGTAGGTCACAGGAAGCTGAT 0: 1
1: 0
2: 0
3: 13
4: 149
Right 932400158 2:71474930-71474952 CTGTGATAGGGGAGGGGAAGTGG 0: 1
1: 0
2: 8
3: 73
4: 1129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932400158 Original CRISPR CTGTGATAGGGGAGGGGAAG TGG Intronic
900213836 1:1470622-1470644 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
900221343 1:1511001-1511023 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
900385233 1:2407559-2407581 CTGTGACAGGGGCATGGAAGTGG - Intronic
900485622 1:2921284-2921306 CTGTGAAGGGAGAGGGGATGCGG - Intergenic
901185313 1:7369081-7369103 CTGTGGTGGGGGAGGAGGAGGGG - Intronic
901282417 1:8049268-8049290 CTGTCATGGGGTGGGGGAAGGGG - Intergenic
901789680 1:11647716-11647738 CTGGGGTAGGGGATGGGAGGTGG - Intergenic
902052230 1:13573039-13573061 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
902300914 1:15502206-15502228 CTATGGTAGGGGAGGGACAGAGG + Intronic
902513756 1:16979411-16979433 CAGGGAGAGGGGAGGGAAAGGGG + Intronic
902578588 1:17394185-17394207 CTCTGAGGGGGGAGGGGACGTGG + Intronic
902650450 1:17833849-17833871 CTGTGCATGGGGAGGGAAAGGGG + Intergenic
902746811 1:18480139-18480161 TGGTGATGGGGGAGGGGAAATGG + Intergenic
902796727 1:18805196-18805218 GGGTGATAGGGGTGGGGAGGGGG - Intergenic
902838147 1:19059683-19059705 CTGTGAGATGGGAGGTGCAGGGG - Intergenic
903635034 1:24807435-24807457 CTTGGATAAGGTAGGGGAAGGGG + Intronic
903836176 1:26204585-26204607 CTGGAGTAGGGAAGGGGAAGGGG - Intergenic
903949437 1:26987065-26987087 CTGAGAGTGGGGTGGGGAAGGGG - Intergenic
904190355 1:28737992-28738014 ATGTGATGGGGGAGGGGAAGCGG + Intronic
904320904 1:29697371-29697393 CTGAGACAGGGCAGGGGAGGAGG - Intergenic
904378785 1:30097460-30097482 CTGAGATGGGGGAGAGGGAGGGG + Intergenic
904702594 1:32366742-32366764 CTGGGGTAGGGGATGGGAGGTGG - Intronic
904911473 1:33937449-33937471 CAGTGATGGGGAAGTGGAAGTGG + Intronic
905282687 1:36859320-36859342 CTGTGGCAAGGGAGGAGAAGGGG - Intronic
905341734 1:37282748-37282770 CTTGGTGAGGGGAGGGGAAGAGG + Intergenic
905532050 1:38687584-38687606 CTGTGTAAGGAGAGGGTAAGGGG - Intergenic
905628993 1:39508425-39508447 CTGTGAAAGGGCAGGGGCCGTGG - Intronic
905697513 1:39986243-39986265 CTTGGATAGGGGAGAGGAAATGG - Intergenic
905740904 1:40370700-40370722 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
906109914 1:43315754-43315776 CTGTGGTGGGGGAGGGTAATGGG + Intronic
906215095 1:44033940-44033962 CTGGGGCAGGGGAGGGGATGGGG + Intergenic
906400303 1:45499613-45499635 CTGTGGCAGGGGAGCGGCAGGGG + Exonic
906862998 1:49381840-49381862 CTGTGGTGGGGTGGGGGAAGGGG + Intronic
907258521 1:53197993-53198015 CTGGGGGAGGGAAGGGGAAGAGG - Intronic
907445693 1:54506417-54506439 CTGTGATGGGGGAGGGTGTGTGG + Intergenic
907470505 1:54670692-54670714 CTGGGCAAGGGGAGGGGAAAAGG - Intronic
907679683 1:56551534-56551556 CTTTGAGTGGGGAGGGGAGGAGG - Intronic
907900560 1:58737393-58737415 ATGTGCGAGGGGTGGGGAAGAGG + Intergenic
908049331 1:60210609-60210631 CTGTGATGGGGTCGGGGGAGGGG + Intergenic
908765687 1:67552979-67553001 ATGTGATAGGGGAGGGGAATGGG - Intergenic
909346222 1:74590622-74590644 CAGCGATAGGGGATGGGAAGTGG + Intronic
909366934 1:74835532-74835554 GTGGGATAGAGGAGGGGCAGTGG - Intergenic
909612100 1:77561943-77561965 CTGTGAGAGGACAGGGGAATTGG - Intergenic
909811625 1:79938534-79938556 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
909907398 1:81215399-81215421 CTGTCATGGGGTGGGGGAAGGGG - Intergenic
910216346 1:84848331-84848353 CTGTTATTTGGGAGGGAAAGTGG - Intronic
910482537 1:87674294-87674316 CTGTTCTAGTGGAGAGGAAGAGG - Intergenic
910645517 1:89510099-89510121 CTGTCGTGGGGTAGGGGAAGTGG - Intergenic
910650418 1:89560533-89560555 CTGTGGTGGGGTGGGGGAAGGGG - Intronic
910726991 1:90349791-90349813 CTGTGAAAGCAGATGGGAAGGGG + Intergenic
910807887 1:91206662-91206684 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
911884928 1:103286422-103286444 CTGTTGTGGGGTAGGGGAAGGGG - Intergenic
912728838 1:112083360-112083382 GTGTGATAGGGGAGAGAGAGTGG - Intergenic
913019764 1:114777095-114777117 CTGTCATAGGGTTGGGGGAGTGG + Intronic
913108949 1:115641240-115641262 CTCTGATAAGGGAGGAGGAGGGG + Intergenic
913533405 1:119749067-119749089 CTGTGATAGGAGAGCAGGAGAGG + Intronic
913540809 1:119819027-119819049 CTGTCATGGGGTGGGGGAAGAGG - Intergenic
913710978 1:121483107-121483129 CTGTCATGGGGTAGGGGGAGGGG + Intergenic
914833685 1:151189969-151189991 CTGGGAAAAGGGAGGGGAGGAGG - Intronic
915118450 1:153614387-153614409 CTGGGCTAGGGCAGGGGAGGAGG - Exonic
915359803 1:155278993-155279015 CTAAGAGAGGGGAGGGAAAGAGG - Intronic
916153375 1:161818986-161819008 CTGTATTAGGAGAGTGGAAGAGG + Intronic
916311018 1:163399037-163399059 CTGTGCTCTGGGAGGGGAAATGG - Intergenic
916318030 1:163472210-163472232 AGGTGATGGGGGTGGGGAAGAGG + Intergenic
916801827 1:168223102-168223124 GTGTGTTAGGGGAAGGGAAAGGG + Intergenic
917082289 1:171268527-171268549 CTCTGAAATGGGAGAGGAAGGGG - Intronic
917501445 1:175589114-175589136 CTAGGATTGAGGAGGGGAAGGGG + Intronic
917766498 1:178224482-178224504 CAGTGATAGGAAATGGGAAGAGG + Intronic
917779182 1:178373467-178373489 ATGTGTCAGGGGAGGGGAATGGG - Intronic
917783630 1:178427921-178427943 ATGTGATAGGTGTGGGGAGGTGG - Intronic
918164688 1:181933773-181933795 CTAACATAGGAGAGGGGAAGGGG + Intergenic
918508891 1:185288548-185288570 CTGTCATGTGGGAGGGGCAGTGG + Intronic
918722669 1:187873793-187873815 CTGTCATGGGGTAGGGGCAGTGG - Intergenic
918855334 1:189747465-189747487 CTGTTGTTGGGGAGGGGAGGGGG + Intergenic
918893511 1:190308486-190308508 CTGTTGTAGGGTGGGGGAAGGGG + Intronic
918945893 1:191064379-191064401 CTGTGATGGGGTGGGGGGAGGGG + Intergenic
919071597 1:192762647-192762669 CAGTGATAGAGGACAGGAAGTGG - Intergenic
919193768 1:194257120-194257142 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
919378482 1:196823880-196823902 ATGTGGTAGGGAAGAGGAAGTGG + Intronic
919388175 1:196947899-196947921 ATGTGGTAGGGAAGAGGAAGTGG + Intronic
919480059 1:198077302-198077324 CTGTGGTGGGGTGGGGGAAGGGG - Intergenic
919583931 1:199411823-199411845 TTGTGACAGGGTAGGAGAAGAGG - Intergenic
919603713 1:199653305-199653327 CTGTTGTAGGGTGGGGGAAGGGG + Intergenic
919763562 1:201112673-201112695 CTGGGATGGGGCAGGGGCAGTGG + Intergenic
919823910 1:201490345-201490367 CTGTGGAGGGGAAGGGGAAGCGG + Intronic
919838646 1:201593681-201593703 TTGTCATGGGGGAAGGGAAGGGG + Intergenic
920125465 1:203690885-203690907 CTGTGGTGGGGGATGGGGAGGGG - Intronic
920176887 1:204107644-204107666 CTGTGCTTGGGGAGGGGGAGAGG + Intronic
920180791 1:204130679-204130701 CTGTCAGTGGGGTGGGGAAGGGG - Intergenic
920387401 1:205578722-205578744 CTGAGAGAGGGGAGGGGGAAAGG - Intronic
920439802 1:205972435-205972457 CTGTGATAAGGGAGAGTAGGGGG + Intergenic
920442239 1:205989041-205989063 ATAGGATAGGGGAGGGGAGGAGG - Intronic
920648667 1:207821267-207821289 CTATGACGGAGGAGGGGAAGGGG - Intergenic
921193596 1:212731266-212731288 CTGTGATAGGCCAGGTGCAGTGG + Intronic
921870801 1:220137585-220137607 CTATAATAAGGGAGGGGAAGAGG - Intronic
921930115 1:220748191-220748213 GTGTTGTAGGGGCGGGGAAGAGG + Intergenic
921992543 1:221383208-221383230 CTGTTGTAGGGTAGGGGGAGGGG - Intergenic
922023414 1:221727828-221727850 CAGTGAGAGGGGAAGGGAGGGGG - Intronic
922268244 1:224008494-224008516 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
922276822 1:224086877-224086899 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
922934222 1:229411335-229411357 GAGAGGTAGGGGAGGGGAAGAGG - Intergenic
923649324 1:235858791-235858813 TTGTTATGGGGGTGGGGAAGGGG + Intronic
924284072 1:242467562-242467584 TAGTGATAAGGGAGGGGATGAGG - Intronic
924417813 1:243877051-243877073 CTGTGGTGGGGTAGGGGGAGAGG - Intergenic
1064014273 10:11760668-11760690 CTGTGTCAGTGGAGGGTAAGTGG + Intronic
1064600977 10:16992235-16992257 CTGTCATGGGGTGGGGGAAGGGG + Intronic
1064756697 10:18577956-18577978 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1064793831 10:18989276-18989298 CTGTCATGGGGTGGGGGAAGAGG - Intergenic
1064827361 10:19420093-19420115 CTTGGACAAGGGAGGGGAAGGGG + Intronic
1064841890 10:19602342-19602364 CTGTCATAGGGTGGGGGGAGGGG - Intronic
1065154302 10:22853668-22853690 CTCTGATGGCAGAGGGGAAGGGG + Intergenic
1065810560 10:29438982-29439004 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1065888473 10:30100091-30100113 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1066129631 10:32380081-32380103 GTGTGTGTGGGGAGGGGAAGAGG - Intergenic
1066819954 10:39472675-39472697 CTGTGGTGGGGTAGGGGGAGGGG + Intergenic
1067690385 10:48497867-48497889 CTGTCATGGGGTAGGAGAAGGGG + Intronic
1067802627 10:49369585-49369607 CTGGGGCCGGGGAGGGGAAGTGG + Intronic
1067911133 10:50348025-50348047 CTGTCATAGGGTAGGGGGAAAGG - Intronic
1068027279 10:51662071-51662093 CTGTCATAGGGTGGGGGAATAGG + Intronic
1068366718 10:56060503-56060525 CTGTCATGGGGTGGGGGAAGGGG - Intergenic
1068985155 10:63101421-63101443 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069778709 10:70941682-70941704 CTGTGTGAGGGGTGGGGAGGAGG + Intergenic
1069917312 10:71795672-71795694 CAGGGAGTGGGGAGGGGAAGAGG - Intronic
1069974000 10:72198121-72198143 GAGGGAGAGGGGAGGGGAAGGGG + Intronic
1070448340 10:76531094-76531116 CTGTGACAGTGGCGGGGTAGGGG - Intronic
1070589109 10:77789019-77789041 CTGTGATATGGGTGGGCAACAGG - Intergenic
1070666745 10:78350428-78350450 GTGTGATGGGGGAGGGGCTGTGG - Intergenic
1071282762 10:84117541-84117563 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1071283867 10:84126317-84126339 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1071416236 10:85444502-85444524 GTGTGAGAGGAGAGGGGAAAAGG - Intergenic
1071789767 10:88941518-88941540 ATGTGATAGGAGAGGTGAGGTGG + Intronic
1071906731 10:90182438-90182460 CTTTGATAGGGGAAGAGAAAAGG + Intergenic
1072909910 10:99491178-99491200 CTGTGTCAGGGGAGGGGTTGGGG - Intergenic
1073083077 10:100871940-100871962 CAGTGATAGATGAGTGGAAGAGG - Intergenic
1073206548 10:101772451-101772473 CTGTCTAAGGGGAGGGGAATGGG - Intronic
1073689628 10:105793387-105793409 CTGGGATAGAGGTGGGGAGGTGG + Intergenic
1073693952 10:105844521-105844543 CTGTGAGAAGGGAGAGGAGGGGG - Intergenic
1073728254 10:106259551-106259573 CTGTTATGGGGTAGGGGAGGGGG + Intergenic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1075237696 10:120745903-120745925 CTAACATAAGGGAGGGGAAGGGG - Intergenic
1075345764 10:121680988-121681010 CTGGGATAGGGGAGGAGAGAAGG + Intergenic
1075650607 10:124126354-124126376 CGTGGAGAGGGGAGGGGAAGAGG - Intergenic
1076405944 10:130212666-130212688 CAGTGGGAGGGGAGGGGAAGGGG - Intergenic
1076542412 10:131222746-131222768 ATGTGAGAGGGGACAGGAAGGGG - Intronic
1076939336 10:133591047-133591069 CTGCGAGATGCGAGGGGAAGGGG + Intergenic
1077133474 11:986762-986784 CTGTGTGGAGGGAGGGGAAGTGG - Intronic
1077795106 11:5483351-5483373 CTGTGATGGGGTGGGGGGAGGGG + Intronic
1077806593 11:5596552-5596574 TGGAGATGGGGGAGGGGAAGGGG - Intronic
1077889243 11:6406787-6406809 CTGTGAGAGTGGTGGGGGAGAGG - Intronic
1077937480 11:6802832-6802854 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1078339419 11:10488389-10488411 GTGTGGTAGGGGAATGGAAGTGG + Intronic
1078496962 11:11827058-11827080 TTTTGACTGGGGAGGGGAAGGGG + Intergenic
1078637314 11:13064230-13064252 CAGTGGTAGGGGAGTGGAAAGGG - Intergenic
1078741999 11:14075427-14075449 CTGTGGGTGGGGAGGGGGAGGGG + Intronic
1078818406 11:14850332-14850354 CTGTTGTAGGGTGGGGGAAGGGG + Intronic
1079214353 11:18494697-18494719 CTGTGAAAGGTGTGGGGAAGAGG + Intronic
1079226353 11:18608974-18608996 TTATGATGGGGGAGGGGAGGAGG + Exonic
1079813568 11:25026136-25026158 CTGTCATGGGGTAGGGGGAGGGG + Intronic
1080046516 11:27814292-27814314 ATGTGTTAGTTGAGGGGAAGTGG + Intergenic
1080340049 11:31251691-31251713 ATGAGATAGGGAAGGGGAATAGG + Intronic
1080526068 11:33120463-33120485 CTGAGAGATGGGAGGGAAAGTGG - Intronic
1080580838 11:33642451-33642473 CTTGGATAAGGGAGGGGAAGGGG + Intronic
1080588844 11:33704032-33704054 CTGGAGTGGGGGAGGGGAAGGGG - Intronic
1080668872 11:34358215-34358237 CTGGGATGGGGGTGGGGATGGGG + Intergenic
1081164979 11:39797617-39797639 CTGTAATGGGGTGGGGGAAGGGG - Intergenic
1081577509 11:44328363-44328385 CTGGGGGAGAGGAGGGGAAGGGG - Intergenic
1081834473 11:46142882-46142904 CTGTGGTGGGGGTGGGGACGGGG - Intergenic
1081861223 11:46334264-46334286 CTGTGGTTTGGGAGAGGAAGAGG - Intronic
1081875853 11:46408014-46408036 CTGAAATAGGTGAGAGGAAGGGG + Intronic
1081906641 11:46674557-46674579 CTGGGGCAGGGGTGGGGAAGGGG - Intronic
1081908172 11:46682286-46682308 CTGTGCTAGGGGAGGGCCTGTGG - Intronic
1082024875 11:47564981-47565003 CTAGGACAGGGGAGGGGAGGAGG + Intronic
1082170936 11:49004177-49004199 CTGTGGTGGGGTCGGGGAAGGGG + Intergenic
1082589732 11:54990989-54991011 CTCTCATAGGGTAGGGGAAATGG + Intergenic
1082864407 11:57885590-57885612 CTGTGAGAAGGGTGGAGAAGAGG - Intergenic
1083257117 11:61503310-61503332 CTGGGATGGGAAAGGGGAAGTGG + Intergenic
1083427026 11:62593530-62593552 TTGTGAAAGGGGATGGGGAGGGG - Exonic
1083433221 11:62625779-62625801 CTGGGTTAGGGGGAGGGAAGGGG - Exonic
1083620522 11:64047185-64047207 CTGGGGCAGGGGAGGGGAGGGGG - Intronic
1083901104 11:65643989-65644011 CAGCGATAGTGGAGGTGAAGAGG + Intronic
1083911623 11:65713281-65713303 GTGGGATGGGGAAGGGGAAGAGG - Intronic
1084394302 11:68898746-68898768 CTGAGGGTGGGGAGGGGAAGTGG - Intronic
1084515597 11:69636765-69636787 CTGGGAGAGGTGAGGGGAGGAGG - Intergenic
1084643896 11:70443183-70443205 CACTCATGGGGGAGGGGAAGGGG + Intergenic
1084735842 11:71104727-71104749 CTGTTAGAGGGGCAGGGAAGTGG - Intronic
1084818247 11:71664007-71664029 CTGTGGTGGGGGAGGTGATGTGG + Intergenic
1085148180 11:74223089-74223111 CTGTGGTGGGGTGGGGGAAGGGG - Intronic
1085535563 11:77215251-77215273 CTTTGCTCAGGGAGGGGAAGTGG + Intergenic
1085544018 11:77300311-77300333 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1085718628 11:78894540-78894562 ATCTGTTAGGAGAGGGGAAGAGG + Intronic
1085776666 11:79372680-79372702 CTGTGAAATGGGAGGGGAGGGGG + Intronic
1086510792 11:87555695-87555717 CTTGGACAAGGGAGGGGAAGTGG + Intergenic
1086825306 11:91489023-91489045 CTTAGACAAGGGAGGGGAAGGGG + Intergenic
1087065734 11:94026448-94026470 CTGAGGTAGGGGAGGGGAGCAGG - Intronic
1087089528 11:94254044-94254066 CTGTCATAGGGTGGGTGAAGGGG + Intergenic
1087091990 11:94283177-94283199 CTGGGTTAGGGGAGGGAATGTGG - Intergenic
1087218032 11:95515834-95515856 CTAAGATAGGAGAGGGGAAAGGG - Intergenic
1087456572 11:98394484-98394506 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1088188086 11:107195944-107195966 CTGTTGTGGGGTAGGGGAAGTGG + Intergenic
1088346969 11:108837442-108837464 CTGAGATAGGGGGTTGGAAGAGG - Intronic
1088983425 11:114884579-114884601 CTGTCATGGGGTAGGGGGAGGGG - Intergenic
1089073134 11:115716691-115716713 CGGGGATGGGGGAGGGGAGGAGG - Intergenic
1089245089 11:117113314-117113336 CTGTCATGGGGTAGGGGGAGTGG + Intergenic
1089347294 11:117798609-117798631 CTGGGGGAGGGGAGGGGAAGGGG - Intronic
1089389082 11:118087775-118087797 CAGTGGTAGGGGTGGGGAATAGG + Intronic
1090019425 11:123114284-123114306 CTTTGATAGGAAAGTGGAAGGGG - Intronic
1090080370 11:123608607-123608629 CAGTGACAGCGGAGGGGGAGGGG - Intronic
1090115617 11:123968907-123968929 CTGTCATGGGGTGGGGGAAGAGG + Intergenic
1090172044 11:124613647-124613669 CTCTGTTAGGGGAGGGAAAGAGG + Intronic
1090205055 11:124879439-124879461 CAGTGTTAGGAGACGGGAAGAGG - Intronic
1090381645 11:126331645-126331667 CTGTGCTGGGCGAGGGGATGGGG + Intronic
1090472569 11:126993298-126993320 CTGTGTTAGGGAAGTGGGAGAGG - Intronic
1090735935 11:129612331-129612353 CTGAGATAAGGGCGGGCAAGGGG - Intergenic
1090770081 11:129912202-129912224 CTGTGACTGGTGAGGGGAAGTGG + Exonic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1090817945 11:130314938-130314960 CTGGGGAAGGGGAGGAGAAGGGG + Intergenic
1091139988 11:133226767-133226789 CTGTCCTAGGGGAGAGGAGGAGG + Intronic
1091247750 11:134113339-134113361 CTGTCGTGGGGTAGGGGAAGCGG - Intronic
1091386955 12:101897-101919 CTGGGCTAGGGGAAGGGATGAGG - Intronic
1091761568 12:3090845-3090867 CAGTGATCTGGGAGGAGAAGGGG - Intronic
1091922809 12:4319624-4319646 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1092065867 12:5589296-5589318 CTGGGATGGGGGAGGGGAGGAGG + Intronic
1092258940 12:6942156-6942178 CAGGGATCGGGGAGGGGCAGGGG - Exonic
1092424695 12:8365361-8365383 GTGTGGTGGGGGAGGGGATGTGG - Intergenic
1092468788 12:8760091-8760113 CTGTTGTGGGGTAGGGGAAGGGG - Intronic
1092827919 12:12414984-12415006 ATGGGATGGGGGTGGGGAAGAGG + Intronic
1092847470 12:12596976-12596998 CTGTCATGGGGTAGGGGGAGGGG + Intergenic
1093009430 12:14090157-14090179 CTGTCATGGGGTAGGGGGAGTGG - Intergenic
1093063433 12:14631378-14631400 CTGTTATGGGGTAGGGGGAGGGG - Intronic
1093357003 12:18178402-18178424 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1093711840 12:22336192-22336214 CTGGAAAAGGGGAAGGGAAGGGG + Intronic
1093827384 12:23710387-23710409 CTGTTGTGGGGTAGGGGAAGCGG - Intronic
1093950500 12:25160641-25160663 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1094037202 12:26084061-26084083 CTGTCATAGGGTTGGGGGAGGGG + Intergenic
1094162921 12:27410589-27410611 CTGTTGTGGGGTAGGGGAAGAGG + Intronic
1094382128 12:29854451-29854473 CTGTTGTGGGGTAGGGGAAGGGG + Intergenic
1094405767 12:30114834-30114856 CTGTCATGGGGTAGGGGGAGGGG - Intergenic
1094582277 12:31744433-31744455 CTTGGATAAGGGAGGGGAAGGGG + Intergenic
1094770502 12:33652795-33652817 CTGTCATGGGGTGGGGGAAGGGG - Intergenic
1095376420 12:41534442-41534464 CTGTGAGGAGTGAGGGGAAGGGG - Intronic
1095668269 12:44828286-44828308 ATGTGTTAAGGGAGAGGAAGTGG - Intronic
1095739392 12:45590519-45590541 CTGTGATAGGGGTGAGGGTGAGG - Intergenic
1095783416 12:46085517-46085539 CTGTGAAAGGGGAGCAGATGAGG + Intergenic
1095855374 12:46854544-46854566 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
1096149046 12:49297334-49297356 CTGGGGTAGGAGAGTGGAAGGGG - Intronic
1096671075 12:53198601-53198623 TTGAGATAGGGGAGGGGTGGGGG - Intronic
1096957666 12:55543298-55543320 CTGTTATAGGGTTGGGGATGGGG - Intergenic
1097101810 12:56595044-56595066 CTGTGATAGGCCAGGGGAGTAGG + Exonic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097218295 12:57430886-57430908 CTGGGACGGGGGAGGGGAAAGGG + Exonic
1097250129 12:57627892-57627914 CTGGGATAGGGGACCCGAAGGGG + Intronic
1097715994 12:62966757-62966779 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1097757193 12:63419537-63419559 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1098360562 12:69650518-69650540 TTGTGATAAGAGAGGGGCAGGGG + Intronic
1098579146 12:72078431-72078453 CTGTCATTGGGTGGGGGAAGGGG - Intronic
1098613975 12:72499556-72499578 CTGTGATACTGGATGGGAACTGG - Exonic
1099105966 12:78496821-78496843 CTGTCATGGGGTGGGGGAAGTGG - Intergenic
1099499934 12:83401837-83401859 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
1099504096 12:83450645-83450667 CTGTGGTGGGGTCGGGGAAGGGG + Intergenic
1099764709 12:86969016-86969038 CTGTCATGGGGTGGGGGAAGGGG - Intergenic
1099832565 12:87863734-87863756 TTTTGAAAGGGGATGGGAAGAGG + Intergenic
1100239274 12:92694553-92694575 CTGTGTTGGGGGAAGGGAAAAGG + Intergenic
1100460150 12:94791444-94791466 CTGAGATAGGGAAGGGGCATTGG - Intergenic
1100716861 12:97315151-97315173 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1101054720 12:100900448-100900470 CTGTCATGGGGTAGGGGGAGGGG - Intronic
1101078392 12:101154972-101154994 CTGTGGTAGGGTTGGGGGAGGGG + Intergenic
1101387671 12:104272202-104272224 CTTCGATAAGGGAGAGGAAGGGG + Intronic
1101838256 12:108310193-108310215 GTGTGTTAGGGGAGGGGAGAAGG + Intronic
1102042711 12:109810816-109810838 CTGGGGTAGGGGTGGGGAGGAGG + Intronic
1103373853 12:120439881-120439903 CTGTGATGGGGGCGGGGGAGGGG - Intronic
1103487870 12:121295554-121295576 CAGAGCTAGGGGAGGGGGAGTGG + Intronic
1103806217 12:123575221-123575243 AAGAGAAAGGGGAGGGGAAGTGG - Intergenic
1104104689 12:125648050-125648072 CTGTGATGGGGTGGGGGGAGGGG - Intronic
1104655472 12:130571225-130571247 CTCAGCCAGGGGAGGGGAAGTGG + Intronic
1104958543 12:132477426-132477448 CTGTGGTGGGGGAGGGGTGGGGG - Intergenic
1105569076 13:21582840-21582862 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1105727299 13:23177207-23177229 CAGAGAATGGGGAGGGGAAGGGG + Intergenic
1105816031 13:24037197-24037219 CTGTCATAGGGTGGGGGGAGGGG + Intronic
1106030109 13:25992835-25992857 CTGTGGTGGGGTGGGGGAAGGGG - Intronic
1106481608 13:30141148-30141170 CTCCGACAGGGGATGGGAAGTGG - Intergenic
1106533725 13:30618946-30618968 CAGTGATATGGAAGGGAAAGAGG + Intronic
1106616279 13:31331561-31331583 CTGGGAATGGGGAGGGGAAATGG + Exonic
1106932003 13:34676664-34676686 CTGTCATGGGGTAGGGGGAGGGG - Intergenic
1107413429 13:40178521-40178543 CTTTCCTAGGGCAGGGGAAGGGG - Intergenic
1107649178 13:42527185-42527207 GTGTGAGAGGGAATGGGAAGCGG - Intergenic
1107706941 13:43117262-43117284 CTTTGAGAGGGGAGGGGAAGGGG + Intergenic
1108156594 13:47591540-47591562 CTGTCATGGGGTGGGGGAAGGGG + Intergenic
1108166563 13:47699423-47699445 CTGTGGAAAGGGAGAGGAAGAGG - Intergenic
1108319970 13:49279964-49279986 CTATGATAGGGAAGGGGTAAGGG + Intronic
1108519201 13:51230745-51230767 CTGTGATCGGGAAAGGGAAAAGG - Intronic
1108631047 13:52282501-52282523 CTGTGGTGGGGTAGGGGAAGGGG + Intergenic
1108655642 13:52530091-52530113 CTGTGGTGGGGTGGGGGAAGGGG - Intergenic
1108687716 13:52835266-52835288 CTGTGATGGGGAGGGGGAGGGGG + Intergenic
1108728794 13:53210429-53210451 GTGTGCTAGGTGAGGGGGAGAGG + Intergenic
1108749824 13:53437358-53437380 CTGTGGTGGGGTGGGGGAAGGGG - Intergenic
1109217109 13:59602641-59602663 GTATAAAAGGGGAGGGGAAGGGG + Intergenic
1109310563 13:60687740-60687762 CTGAGAAGGGGAAGGGGAAGAGG - Intergenic
1109522069 13:63526357-63526379 CTGTCATGGGGGCTGGGAAGAGG + Intergenic
1109812037 13:67525966-67525988 CTGTTATAGGGTGGGGGGAGGGG - Intergenic
1110032144 13:70629209-70629231 ATGTGGCAGTGGAGGGGAAGGGG + Intergenic
1112464212 13:99629443-99629465 CCCAGATAGGGGAGGGGATGAGG - Intronic
1112538853 13:100286295-100286317 CTCGGACAAGGGAGGGGAAGGGG + Intronic
1112628652 13:101136451-101136473 CTGTCATGGGGCAGGGGGAGGGG - Intronic
1112848053 13:103668253-103668275 CTTGGACAGGGGAGGGGAAGAGG + Intergenic
1113092471 13:106630118-106630140 CAGAGATAGGGGAGTGGGAGAGG + Intergenic
1113179824 13:107612249-107612271 ATTTGCCAGGGGAGGGGAAGAGG + Intronic
1113326438 13:109286512-109286534 CTGGGATAGGGGTGGGGATTGGG - Intergenic
1113465282 13:110508237-110508259 GTGTGGTTGGGGAGGGGAACTGG - Intronic
1113467617 13:110523456-110523478 CTGTCAGAGGGGTGGGGAGGTGG - Exonic
1113535071 13:111059524-111059546 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1113657069 13:112073567-112073589 GTGAGAGAGGGGAGGGGGAGGGG + Intergenic
1114082385 14:19212490-19212512 CTCTGATAGGTGAGGGACAGTGG + Intergenic
1114260954 14:21035837-21035859 CTGGGATTGGGGAGGTGGAGGGG - Intronic
1114357617 14:21929681-21929703 CTGTGGTGGGGTGGGGGAAGGGG - Intergenic
1114558076 14:23573124-23573146 CTGGTATGGGGGTGGGGAAGAGG + Intronic
1114576345 14:23717695-23717717 CTGTCATGGGGTTGGGGAAGGGG - Intergenic
1114801322 14:25779008-25779030 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
1114996863 14:28365105-28365127 CTGTGATAGGGGAGTGGGGCAGG + Intergenic
1115010996 14:28544551-28544573 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
1115119994 14:29927650-29927672 CTGGGCTGGGGGAGGGCAAGGGG + Exonic
1115210830 14:30966238-30966260 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1115211626 14:30972412-30972434 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1115217352 14:31026284-31026306 CCGGGAGAGGGGCGGGGAAGGGG + Exonic
1115221994 14:31067419-31067441 CTGTGGTAGGGTGGGGGGAGGGG - Intronic
1115498213 14:34027294-34027316 GAGGGAGAGGGGAGGGGAAGGGG + Intronic
1115656638 14:35449612-35449634 CAATGTTAGGGGAGGGGAAATGG + Intergenic
1115764001 14:36604129-36604151 CTGTCATGGGGTGGGGGAAGTGG + Intergenic
1116242260 14:42359820-42359842 CTGTTGTGGGGTAGGGGAAGGGG + Intergenic
1117179281 14:53175887-53175909 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1117179955 14:53181516-53181538 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1117409512 14:55438562-55438584 CCATGATGGGGAAGGGGAAGGGG - Intronic
1117478556 14:56119690-56119712 CAGTGAAAGGGGAGGGGGAAGGG + Intronic
1117717983 14:58600263-58600285 CTGGTATAGGGGAGGGGAAGTGG - Intergenic
1118602774 14:67482155-67482177 AGGTGATGGGGAAGGGGAAGGGG + Intronic
1119325468 14:73757695-73757717 CTCTGACAGAAGAGGGGAAGGGG - Intronic
1119441376 14:74630984-74631006 CTGGGGCAGGGGACGGGAAGGGG + Intergenic
1119498606 14:75103037-75103059 CTGTCATAGGGTGGGGGAAGGGG + Intronic
1119960701 14:78853214-78853236 CTGTTGTGGGGTAGGGGAAGAGG - Intronic
1120577684 14:86204032-86204054 AAGTGATAAGGAAGGGGAAGTGG + Intergenic
1120738593 14:88082767-88082789 CTGTTATGGGGTAGGGGGAGGGG + Intergenic
1120743277 14:88131142-88131164 CTGTCATGGGGTAGGGGGAGTGG - Intergenic
1120953380 14:90061805-90061827 CTCAGATAGGGGAGGGGGCGTGG - Exonic
1121038026 14:90722781-90722803 CTGTGCTAGGAAAGAGGAAGTGG - Intronic
1121079456 14:91095969-91095991 TTGTTATAGGGGATTGGAAGTGG - Intronic
1121084023 14:91131612-91131634 CTGTGGTGGGGTGGGGGAAGAGG - Intronic
1121550779 14:94798081-94798103 CTGTGATAGGAATGAGGAAGTGG - Intergenic
1121943986 14:98101571-98101593 CTATGAGAGGAGAGTGGAAGGGG - Intergenic
1122832993 14:104412190-104412212 CTGTCATGGGGTAGGGGGAGGGG - Intergenic
1122866307 14:104605726-104605748 GTGTGATGGGGTAGGGGAGGGGG - Intergenic
1122897948 14:104769627-104769649 CTGTGACACAGAAGGGGAAGGGG + Exonic
1123427856 15:20187502-20187524 CTGTGGTGGGGGTGGGCAAGAGG - Intergenic
1124203402 15:27697673-27697695 CTGTGCTGGTGGTGGGGAAGTGG - Intergenic
1124425481 15:29559294-29559316 CTGTGTGAGGTGAGGGGAACAGG - Intronic
1124437583 15:29663707-29663729 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
1124495830 15:30186298-30186320 CTGAGATTGGGGAGGGGCTGGGG - Intergenic
1124747744 15:32352349-32352371 CTGAGATTGGGGAGGGGCTGGGG + Intergenic
1124899075 15:33805901-33805923 GGGTGAAAGGGGAGGGGGAGAGG - Intronic
1125350316 15:38759988-38760010 CTGTGGTAGGGGTGGGGCAGAGG + Intergenic
1125382289 15:39099643-39099665 ATGTGTTAGGAGAGGGAAAGTGG - Intergenic
1125510326 15:40289170-40289192 CAGTGAGAGGGTAGGGGAAGGGG - Intronic
1125534257 15:40434378-40434400 CTGTGAAAGGGGAGAGGTAGAGG + Intronic
1125673007 15:41486854-41486876 CAGTGCGAGGGGAGGTGAAGGGG - Intergenic
1125686719 15:41567944-41567966 CTGTGAGAGGGGAGTGGTAAGGG + Intronic
1125712266 15:41796563-41796585 CTGTGGAAGGGGAGGAGCAGGGG - Intronic
1126174106 15:45719645-45719667 CAGTGATGGGGGTGGGGCAGTGG - Intergenic
1126277570 15:46902158-46902180 CTTTAATATGGGATGGGAAGAGG - Intergenic
1126487521 15:49198823-49198845 GAGGGAGAGGGGAGGGGAAGAGG - Intronic
1126918624 15:53494947-53494969 CTGTGGTAGGGTGGGGGGAGGGG - Intergenic
1127138526 15:55949795-55949817 CTGTCATGGGGTGGGGGAAGTGG + Intronic
1127408682 15:58682315-58682337 CTGTAAAATGGGATGGGAAGGGG + Intronic
1127426723 15:58865318-58865340 CTGCGACGGGGGAGGGGAGGAGG + Intronic
1128014661 15:64332518-64332540 CTGTGATGGGGTGGGGGGAGGGG + Intronic
1128086697 15:64891679-64891701 CTGCAATGGGAGAGGGGAAGTGG - Intronic
1128087766 15:64897653-64897675 CACTGGTAGGGGTGGGGAAGTGG - Intronic
1128273716 15:66334887-66334909 CTGGGATGGGGGTGGGGGAGGGG - Intergenic
1128332778 15:66766705-66766727 GTGTGATAGGTGAGAGGAGGGGG - Intronic
1128370730 15:67037200-67037222 CTGGGTTAGGTGAGGGGAGGGGG + Intergenic
1128602359 15:69007973-69007995 CTCAGACAAGGGAGGGGAAGGGG - Intronic
1128716641 15:69913539-69913561 CTGTGCTGGGCGTGGGGAAGAGG - Intergenic
1128793183 15:70448001-70448023 CTGCGGGAGGAGAGGGGAAGGGG + Intergenic
1129423786 15:75451018-75451040 CTGGGGTCGGGGAGGGGTAGGGG - Intronic
1129616914 15:77105944-77105966 ATGTGATGGGGAAGGGGAATAGG + Exonic
1129626498 15:77205973-77205995 CTGTGATGGGGTGGGGGGAGGGG - Intronic
1129795851 15:78375231-78375253 CTGAGGTAGGGAAGAGGAAGTGG + Intergenic
1130025878 15:80270116-80270138 CTGTAATGGGGAAGGGGAAGAGG + Intergenic
1131229212 15:90647605-90647627 GTGTGAAGGGGGAGGGGGAGGGG - Intergenic
1131848786 15:96515943-96515965 GTGCTTTAGGGGAGGGGAAGAGG - Intergenic
1132057364 15:98662445-98662467 CTGTGGAAGGGGAGTGGGAGTGG + Intronic
1132151249 15:99461068-99461090 CTGTGAAAGGGATGGGCAAGAGG + Intergenic
1132152783 15:99474394-99474416 AAGTGAAAGGGGAAGGGAAGGGG + Intergenic
1132717148 16:1296883-1296905 CCTGGACAGGGGAGGGGAAGGGG + Intergenic
1132868219 16:2104194-2104216 GGGGGATAAGGGAGGGGAAGGGG + Intronic
1132870844 16:2115146-2115168 CTGTGCTGGGAGAGAGGAAGAGG + Intronic
1133041898 16:3065343-3065365 CTGAGAGTGGGGAGGGGCAGAGG - Intronic
1133061452 16:3177466-3177488 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1133302063 16:4788342-4788364 GTGTGATGGGGGAGGGGAGAGGG + Exonic
1133313968 16:4870678-4870700 CCGAGAAACGGGAGGGGAAGAGG - Intronic
1133373552 16:5264671-5264693 CTGTGATGGGGGAGGGGATGTGG + Intergenic
1133485256 16:6213849-6213871 CTTTGTTATGGGAGGGGATGGGG + Intronic
1133597368 16:7305384-7305406 CTGTCATTGGGCAGGGGCAGTGG + Intronic
1133959374 16:10479495-10479517 CTGTTGTAGGGTAGGGGGAGTGG + Intronic
1134515779 16:14885699-14885721 GTGGCACAGGGGAGGGGAAGAGG + Intronic
1134521686 16:14921758-14921780 CTGTGCTGGGAGAGAGGAAGAGG - Intronic
1134539825 16:15055665-15055687 CTCTGACAAGGGAGGGGACGGGG - Intronic
1134549337 16:15131990-15132012 GGGGGATAAGGGAGGGGAAGGGG + Intronic
1134583676 16:15393395-15393417 CTGTCATGGGGTGGGGGAAGCGG + Intergenic
1134709356 16:16320409-16320431 CTGTGCTGGGAGAGAGGAAGAGG - Intergenic
1134711146 16:16327406-16327428 GGGGGATAAGGGAGGGGAAGGGG - Intergenic
1134716568 16:16360438-16360460 CTGTGCTGGGAGAGAGGAAGAGG - Intergenic
1134948428 16:18341177-18341199 GGGGGATAAGGGAGGGGAAGGGG + Intergenic
1134950246 16:18348236-18348258 CTGTGCTGGGAGAGAGGAAGAGG + Intergenic
1134955685 16:18381287-18381309 GGGGGATAAGGGAGGGGAAGGGG + Intergenic
1134958182 16:18391721-18391743 CTGTGCTGGGAGAGAGGAAGAGG + Intergenic
1135063505 16:19290341-19290363 TGGTGGTGGGGGAGGGGAAGTGG - Intronic
1135543032 16:23346727-23346749 ATAGGAGAGGGGAGGGGAAGGGG - Intronic
1135844654 16:25908046-25908068 TTGTGATAGAAGAGGGGAGGGGG + Intronic
1136036494 16:27544458-27544480 CTGGGCTGGGGGAGGGGAGGAGG + Intronic
1136511963 16:30743693-30743715 CCGTGACAGGGAAGGGGGAGCGG + Intronic
1136591902 16:31222804-31222826 CTGGGGGTGGGGAGGGGAAGGGG - Intronic
1136856439 16:33662259-33662281 CTGTGGTGGGGGTGGGCAAGAGG + Intergenic
1137349894 16:47704320-47704342 CTGTCAGAGGGGTGGGGAGGAGG + Intergenic
1137354165 16:47743309-47743331 CTGTCTGAGGGGAGGGGATGGGG - Intergenic
1137831231 16:51545269-51545291 CTGTGGTGGGGGAGGGTGAGTGG + Intergenic
1137873172 16:51970336-51970358 ATTTAATAGGGGAAGGGAAGTGG + Intergenic
1138031411 16:53562284-53562306 ATGTGATAGGGAGGGAGAAGAGG + Intergenic
1138260878 16:55620952-55620974 CTGTGGTGGGGTAGGGGGAGGGG + Intergenic
1138555625 16:57769743-57769765 CTGTGAGGCGGGAGGGGATGAGG + Intronic
1138618078 16:58188027-58188049 CTGTGTGTGGGGTGGGGAAGGGG + Intronic
1138734436 16:59234061-59234083 CTGTCATGGGGTAGGGGAGGGGG + Intergenic
1138915815 16:61462957-61462979 CTGTGATGGGGTGGGGGGAGGGG + Intergenic
1139152082 16:64394962-64394984 CTGTTGTAGGGTGGGGGAAGGGG - Intergenic
1139226321 16:65235961-65235983 CTGAGAAAGGGGTGGGGAGGAGG - Intergenic
1139230877 16:65281330-65281352 CTGTGCTGGGGGAAAGGAAGGGG - Intergenic
1139376626 16:66502765-66502787 CTGTGGAAGGAGGGGGGAAGGGG - Intronic
1139859363 16:70008535-70008557 CTGTCATGGGGTGGGGGAAGCGG + Intergenic
1140352026 16:74271379-74271401 CTGTAGTAGGGGATGGGGAGGGG - Intergenic
1140985657 16:80156007-80156029 CCTGGAGAGGGGAGGGGAAGGGG + Intergenic
1141191846 16:81830787-81830809 GTGTGATAGTGGAGGGGGATGGG + Intronic
1141613703 16:85198271-85198293 CTGTAAAAGGGGAGAGGAAAGGG + Intergenic
1203118019 16_KI270728v1_random:1510736-1510758 CTGTGGTGGGGGTGGGCAAGAGG + Intergenic
1143016598 17:3893864-3893886 CTGAGCTAAGGGAGGGGAAGTGG - Intronic
1143319558 17:6059336-6059358 CTGGGATAAGGGAGGGGCAGAGG + Intronic
1143478849 17:7217463-7217485 CTGGGGTGGGGGAGGGGAACTGG + Intronic
1143501445 17:7341855-7341877 CTGGGCAAGGGGAGAGGAAGTGG + Intronic
1143527893 17:7482971-7482993 CTGTGAGAGGGAAGGGAAGGTGG + Exonic
1144049338 17:11485248-11485270 CTGCGGCAGAGGAGGGGAAGAGG + Intronic
1144224370 17:13130707-13130729 GTTTGATGGGGGAGGGGGAGGGG + Intergenic
1144244273 17:13347487-13347509 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1144323617 17:14155827-14155849 CTGTGACAGTGGAGATGAAGAGG - Intronic
1144407354 17:14964964-14964986 CTGTCATGGGGTAGGGGGAGAGG - Intergenic
1144493864 17:15735217-15735239 CTGTCATCTGGGAGGGGTAGTGG + Intronic
1144847818 17:18229203-18229225 CTGTGAAAGGGGCAGGGGAGCGG + Intronic
1144991696 17:19237789-19237811 CGGTGATAGGGACGGGTAAGGGG - Intronic
1145146749 17:20488766-20488788 CTGTGATAGGCCAGGCGCAGTGG + Intergenic
1146640157 17:34534481-34534503 CTGGGATTAGGGAGGGGATGGGG - Intergenic
1146649331 17:34597127-34597149 TGGTGGTAGGGGAAGGGAAGGGG - Intronic
1147164918 17:38587924-38587946 GTGTGAAAGAGGAGGGGCAGGGG - Intronic
1147310326 17:39592263-39592285 CTGGGAAAGGGGATGGGATGGGG - Intergenic
1147839562 17:43361745-43361767 GAGGGAGAGGGGAGGGGAAGGGG - Intergenic
1147864906 17:43545712-43545734 CTGCGATGGGGGCGGGGAGGGGG + Intronic
1148463679 17:47851838-47851860 CTGGGAGAGGGGAGGAGAGGAGG - Intronic
1148770664 17:50064196-50064218 CAGTGAAAAGTGAGGGGAAGGGG + Exonic
1148791457 17:50175529-50175551 CTGGGAGAGGTCAGGGGAAGAGG + Intronic
1149649591 17:58268599-58268621 CAGAGAAAGGGGAGGGGCAGGGG + Intergenic
1149961642 17:61116085-61116107 CTGTGGTAGGGTAGGGGGAGGGG + Intronic
1150220610 17:63493838-63493860 CTGTGATGGTGGAGGGGTGGGGG - Intronic
1150291217 17:63983456-63983478 CTGTGGGTGGGGACGGGAAGGGG + Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151956022 17:77380674-77380696 TTGGGGCAGGGGAGGGGAAGCGG - Intronic
1151999643 17:77637346-77637368 AGGTGCTGGGGGAGGGGAAGGGG - Intergenic
1152079098 17:78175480-78175502 CTGGGATTGAGGAGGGCAAGAGG - Intronic
1152110726 17:78356278-78356300 CTGTGGTGGGGGAGGGGGTGGGG + Intergenic
1152111797 17:78360806-78360828 TTTTCATAGGGGAGGGGAGGGGG - Intergenic
1152334875 17:79695107-79695129 CTGTGACTGGGGAGGGGCTGAGG - Intergenic
1152466338 17:80468654-80468676 GTGTGTTTGGGGAGGGGGAGAGG + Exonic
1152609266 17:81307555-81307577 CAGAGAAGGGGGAGGGGAAGAGG - Intergenic
1153450421 18:5221215-5221237 GAGAGATGGGGGAGGGGAAGGGG - Intergenic
1153514353 18:5890881-5890903 CCGCGATAGGGGCGGGGACGCGG - Exonic
1153666314 18:7370198-7370220 CTGTGACAGGGGAAGAGGAGAGG - Intergenic
1153727560 18:7972305-7972327 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
1153826870 18:8882920-8882942 CTTGGACAAGGGAGGGGAAGAGG + Intergenic
1153841026 18:9008003-9008025 CTGTCATGGGGTGGGGGAAGGGG + Intergenic
1153946647 18:10023823-10023845 CTGTGAGAGGGGAGGGCCACTGG + Intergenic
1154506532 18:15045861-15045883 CTGTGATAGAGACAGGGAAGGGG - Intergenic
1155061617 18:22233635-22233657 GGGTGGTAGGGGAGGGGAGGAGG + Intergenic
1155611136 18:27669155-27669177 CAGTGGGAGGGGAGGGCAAGTGG - Intergenic
1155730386 18:29150754-29150776 CTGTGGTGGGGTGGGGGAAGGGG - Intergenic
1155746620 18:29362280-29362302 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1156043907 18:32856800-32856822 CTGTGGTGGGGAGGGGGAAGGGG - Intergenic
1156122583 18:33863265-33863287 CTGTTGTGGGGTAGGGGAAGGGG + Intronic
1156860200 18:41827271-41827293 CTGTGAGAAGGGAAGTGAAGGGG + Intergenic
1157012555 18:43668834-43668856 CTGTGGTGAGGCAGGGGAAGAGG - Intergenic
1157299274 18:46467914-46467936 GTGTGGTTGGGGAGGGGGAGAGG - Intergenic
1157356716 18:46941908-46941930 CTTGGACAGGGGAGGGGAAGGGG + Intronic
1157403979 18:47408429-47408451 CTGAGAAGGGGAAGGGGAAGGGG + Intergenic
1157433774 18:47651726-47651748 CTGGGCTATAGGAGGGGAAGCGG + Intergenic
1157507256 18:48236969-48236991 CTGAGAAATGGGAGGGGAAAGGG + Intronic
1157807399 18:50668351-50668373 CTGCGCTAGAGGAGGGGATGTGG - Intronic
1158236564 18:55322396-55322418 CGGAGAAAGGGGAGGGAAAGGGG + Intronic
1158388887 18:57026944-57026966 CTGTGATAGGGAAAGGGAGAGGG + Intronic
1158608913 18:58920786-58920808 GTGTGTTTGGGGAGGGGAGGGGG + Intronic
1158775406 18:60572923-60572945 CTGTGCTAGGGGTGGAAAAGGGG - Intergenic
1158814323 18:61075945-61075967 CTGTGGTGGGGTGGGGGAAGGGG + Intergenic
1158819728 18:61145599-61145621 CTGTGGTAGGGGGGGGGAGGGGG + Intergenic
1159051020 18:63421642-63421664 TTGCGGTAGAGGAGGGGAAGTGG + Intronic
1159927472 18:74281953-74281975 CTGTGAGTGGGAAGGGGAACAGG + Intronic
1160051398 18:75437444-75437466 GGGTAATGGGGGAGGGGAAGGGG + Intergenic
1160698865 19:496955-496977 CGGTGAGCGGGGAGGGGACGCGG + Intronic
1160699012 19:497374-497396 CGGTGAGCGGGGAGGGGACGCGG + Intronic
1160775165 19:852200-852222 CTGTGCCAGGGGAGAGGAAGTGG + Exonic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161022379 19:2016106-2016128 CTGTTGCAGGGGAGGGGACGGGG + Intronic
1161139344 19:2638457-2638479 GAGGGAAAGGGGAGGGGAAGGGG + Intronic
1161163966 19:2775670-2775692 CGGGGCTTGGGGAGGGGAAGGGG + Intronic
1161360156 19:3844028-3844050 CAGGGACCGGGGAGGGGAAGGGG + Intronic
1161492194 19:4568114-4568136 GTGTGATGGGGGAGGAGAGGAGG - Intergenic
1161626366 19:5329217-5329239 CGGACAAAGGGGAGGGGAAGAGG + Intronic
1162160194 19:8708205-8708227 CTGTCATGGGGTGGGGGAAGGGG - Intergenic
1162629055 19:11911666-11911688 CTGTCATGGGGTAGGGGGAGGGG + Intronic
1162671385 19:12260491-12260513 CTGTGATGGTGAAGCGGAAGCGG + Intronic
1162884929 19:13689899-13689921 CTGTCATGGGGTAGGGGGAGGGG + Intergenic
1163068615 19:14819040-14819062 CTGTTATGGGGCAGGGGGAGGGG - Intronic
1163172247 19:15540396-15540418 CTGTGCTATGCTAGGGGAAGGGG + Intronic
1163215558 19:15874145-15874167 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1163630753 19:18417011-18417033 CTGTGATGGGGGAGGCGCGGAGG - Intergenic
1163828571 19:19537155-19537177 GTCTGATGGGGGAGGGGAAGTGG + Intronic
1164348110 19:27294426-27294448 CTGTTATGGGGTGGGGGAAGTGG - Intergenic
1164350431 19:27330173-27330195 CTGTTATGGGGTGGGGGAAGGGG + Intergenic
1164420261 19:28085109-28085131 CTGTTATGGGGTTGGGGAAGTGG + Intergenic
1164655418 19:29917647-29917669 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1164859444 19:31551248-31551270 CTGTGAGAGGGGAGAGAAGGAGG - Intergenic
1165073503 19:33268730-33268752 CAGGGATAGGGAACGGGAAGGGG - Intergenic
1165343310 19:35227547-35227569 CTGGGGGAGAGGAGGGGAAGGGG + Intronic
1166100111 19:40566588-40566610 CTGGGATGGGGGAGTGGGAGGGG + Intronic
1166116289 19:40657064-40657086 TTGTGATCGTGGAGGGGAATAGG - Intergenic
1166773713 19:45299883-45299905 CTGAGGCAGGAGAGGGGAAGTGG - Intronic
1166827949 19:45621119-45621141 CTGGGAGTGGGGAGGGGGAGTGG + Intronic
1166882426 19:45937675-45937697 GGGGGATAGGGGAGGGGAAGTGG + Exonic
1166924934 19:46260857-46260879 GTGGGAGAGGGAAGGGGAAGAGG + Intergenic
1167422705 19:49413508-49413530 CTGAAAGAGGGGAGGGGGAGAGG - Intronic
1167476241 19:49702893-49702915 GAGTGAGAGGGGAAGGGAAGAGG + Intronic
1167588880 19:50391682-50391704 CTGAGAGGGGGGAGGGGGAGGGG + Intronic
1167678579 19:50905250-50905272 CTGGGATGGGAGAGGGGAATAGG - Intergenic
1167696375 19:51017643-51017665 CGGGGATCGGGGAGAGGAAGGGG + Intronic
1168092821 19:54096831-54096853 CTGGGGTCGGGGAGGAGAAGTGG - Intronic
1168267848 19:55231983-55232005 CTGGGATAGAGGTGGGGGAGCGG + Intronic
1168298229 19:55388286-55388308 CTGTGATGGTGAAGAGGAAGCGG + Intronic
1168311855 19:55464613-55464635 CTGTGAGCAGGGAGGGGCAGGGG + Intergenic
1168379312 19:55906791-55906813 CTCTGAAAGGGATGGGGAAGAGG - Intronic
1168479948 19:56711449-56711471 AGGGGATAGGGGAGGGGAAATGG - Intergenic
925238557 2:2300689-2300711 GTGTGGGAGGAGAGGGGAAGTGG + Intronic
925299829 2:2803915-2803937 CTGTGATTGGGGAGTTGGAGTGG - Intergenic
925333285 2:3075142-3075164 CTGTGATACGGAAGGGAAACAGG - Intergenic
925548327 2:5041843-5041865 AAGTGAAAGGGAAGGGGAAGGGG - Intergenic
925652173 2:6103092-6103114 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
925653764 2:6122490-6122512 CTGTCGTAGGGTAGGGGGAGGGG + Intergenic
926022451 2:9508585-9508607 CTGTGATGGGAGACGGGAATGGG - Intronic
926888864 2:17622089-17622111 CTGTGATAGATGAGTGGAAAAGG - Intronic
927079014 2:19609618-19609640 CAGAGACATGGGAGGGGAAGAGG - Intergenic
927114450 2:19886991-19887013 CTGGAATAGGGGCGGGGAAACGG - Intergenic
927270076 2:21197787-21197809 CTTTTTCAGGGGAGGGGAAGAGG + Intergenic
927378624 2:22450767-22450789 CAGTGATACAGGAGGGGAACTGG - Intergenic
927681976 2:25145802-25145824 ATGTGTCAGGGGAGGGGAGGGGG - Intronic
927698349 2:25252270-25252292 CCGTCTTGGGGGAGGGGAAGGGG + Intronic
928090616 2:28372133-28372155 CTGTGGTGGGGTAGGGGGAGCGG + Intergenic
928439918 2:31283864-31283886 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
928647182 2:33366987-33367009 CTGTGATGGGGTAGGTGGAGGGG - Intronic
928718016 2:34085565-34085587 CTGTCATGGGGTAGGGGGAGGGG + Intergenic
928726209 2:34176712-34176734 CTGTGATAGGAGAAGAGAAATGG + Intergenic
929074030 2:38062764-38062786 CTGTTGTGGGGGGGGGGAAGGGG - Intronic
929677187 2:43948200-43948222 CTGTGAGAAGGGAAGGGAGGGGG + Intronic
930168698 2:48229614-48229636 CAGTCATGGGGGAGGTGAAGGGG - Intergenic
931152810 2:59593958-59593980 ATGTGACAGGGGTGGGGAAATGG + Intergenic
931156668 2:59639585-59639607 CTGTTGTAGGATAGGGGAAGAGG + Intergenic
931363493 2:61598527-61598549 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
931425809 2:62170043-62170065 CTTGGATAACGGAGGGGAAGGGG - Intergenic
931693442 2:64854642-64854664 CTGTGACTGGGGGTGGGAAGTGG - Intergenic
932005193 2:67920479-67920501 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
932018588 2:68059138-68059160 ATGTGACAGGGCAGGAGAAGTGG + Intronic
932126310 2:69148279-69148301 CTGGGGTAGGGCAGGGGCAGTGG - Intronic
932400158 2:71474930-71474952 CTGTGATAGGGGAGGGGAAGTGG + Intronic
932477094 2:72013131-72013153 CAGTGCTGGGGGAAGGGAAGCGG + Intergenic
932723410 2:74157133-74157155 CTGTGATCTGGGAAGGGGAGAGG - Intronic
932950565 2:76288431-76288453 TTGTGACAGGGAAGGGGAAGAGG - Intergenic
933365716 2:81351142-81351164 CTGTGGTGGGGAAGGGGGAGGGG - Intergenic
933653520 2:84868430-84868452 CTGTCATGGGGTAGGGGGAGGGG + Intronic
933750987 2:85602104-85602126 CCGGGAAGGGGGAGGGGAAGGGG + Exonic
933985451 2:87588082-87588104 CTGTGATTGGGGTGGGGCTGTGG + Intergenic
934555098 2:95282918-95282940 CTGTGTTTGGGGAGGGCGAGGGG - Intronic
935047669 2:99497026-99497048 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
935597486 2:104890515-104890537 TTCTGATAAGAGAGGGGAAGTGG + Intergenic
935622314 2:105141006-105141028 CTGTGGTGGGGTAGGGGGAGGGG + Intergenic
935940664 2:108235133-108235155 CTGTGAGAGGAGGGGTGAAGAGG + Intergenic
935950473 2:108324161-108324183 ATAAGATAGGGGAGAGGAAGGGG + Intergenic
936308390 2:111362719-111362741 CTGTGATTGGGGTGGGGCTGTGG - Intergenic
936378962 2:111967542-111967564 ATCTGCTGGGGGAGGGGAAGGGG - Intronic
936726821 2:115329583-115329605 CTGTCATTGGGTAGGGGGAGCGG - Intronic
936834683 2:116694305-116694327 CTATGAAAGGGGAAGGGATGAGG + Intergenic
937050713 2:118886466-118886488 CTGTTGTAGGGTGGGGGAAGGGG - Intergenic
937089783 2:119198489-119198511 GTGTGAGACGGGAAGGGAAGTGG - Intergenic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937509995 2:122584420-122584442 CTGTCATGGGGTGGGGGAAGGGG + Intergenic
937811702 2:126206726-126206748 CTGTCATGGGGTCGGGGAAGGGG - Intergenic
938494199 2:131784113-131784135 CTCTGATAGGTGAGGGACAGTGG - Intergenic
938549699 2:132368852-132368874 CTGTCATAGGGTTGGGGGAGGGG - Intergenic
938634062 2:133203384-133203406 CTGTCATGGGGTGGGGGAAGCGG + Intronic
939333914 2:140800242-140800264 CTGTCATAGGGGAGGAGGAGCGG + Intronic
939879656 2:147615535-147615557 CTTTGAGAAGGGAGGGGAAAGGG + Intergenic
940098928 2:150010915-150010937 GTGGGGTAGGGGAGGGGGAGGGG + Intergenic
940314130 2:152309561-152309583 CTGTGTCGGGGGCGGGGAAGAGG + Intergenic
940346767 2:152636813-152636835 AAGTGAAAGGGGAGGGGGAGGGG - Intronic
940802251 2:158145580-158145602 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
940858906 2:158752166-158752188 CTGGGATAGAGGAGGCTAAGGGG - Intergenic
940955667 2:159724828-159724850 CTGTTTTAGGGTAGGGGGAGGGG - Intronic
941809236 2:169738996-169739018 AGGAGATGGGGGAGGGGAAGGGG - Intronic
941876040 2:170434427-170434449 CTTGGACAAGGGAGGGGAAGGGG + Intronic
942431834 2:175920290-175920312 CTGTCATGGGGTGGGGGAAGGGG + Intergenic
942628047 2:177924876-177924898 CTGTGGTGGGGTAGGGGGAGGGG - Intronic
942846450 2:180431966-180431988 TAGTGGTAGGGGAGGGGAATTGG + Intergenic
943154222 2:184152212-184152234 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
944378153 2:199073249-199073271 CTGTCATAGGGTGGGGGAAGTGG + Intergenic
944533111 2:200684190-200684212 ATGTGATGGCGGCGGGGAAGAGG + Intergenic
944987469 2:205193831-205193853 CTGTGACACTGGAGGGGAAAAGG + Intronic
945460606 2:210103314-210103336 CTGTCATGGGGTGGGGGAAGGGG + Intronic
945720497 2:213412340-213412362 CTTGGACAAGGGAGGGGAAGGGG - Intronic
945780980 2:214172242-214172264 CTGTTGTGGGGTAGGGGAAGTGG - Intronic
945867537 2:215193498-215193520 CTGTGAGAGGTTAGGGGAAAAGG + Intergenic
945947242 2:216006365-216006387 GAGTGATAGGGGAGGGCCAGAGG - Intronic
945988428 2:216372480-216372502 CTGTGCGAGGGAAGGGGATGGGG + Intergenic
946178817 2:217937891-217937913 AGGGGATAGGGGTGGGGAAGAGG - Intronic
946183038 2:217960383-217960405 CTCTGACAGTGGAGGGCAAGGGG + Intronic
946298069 2:218802228-218802250 CTTGGACAAGGGAGGGGAAGGGG - Intronic
946364454 2:219240095-219240117 CTGCCAGAGGGGAGGGAAAGTGG + Intronic
946408741 2:219506218-219506240 CAGTGAAAGGTAAGGGGAAGAGG - Intronic
946719614 2:222590359-222590381 CTGTCATGGGGTGGGGGAAGGGG + Intronic
946861125 2:224001264-224001286 CTGTGAGAGGAGCTGGGAAGGGG - Intronic
946898515 2:224349251-224349273 TTGTCACAGGGGTGGGGAAGAGG + Intergenic
947132957 2:226948411-226948433 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
947377048 2:229506666-229506688 CTGTGGTGGGGTAGGGGGAGGGG - Intronic
947556826 2:231100295-231100317 CTTGGACAAGGGAGGGGAAGGGG + Intronic
947814543 2:233027521-233027543 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
948158247 2:235801776-235801798 CTTTGTTAAGGGAGTGGAAGGGG + Intronic
948261879 2:236610348-236610370 CTGTGATATGGCAGGCGATGTGG + Intergenic
948622665 2:239246309-239246331 CTCCGACGGGGGAGGGGAAGGGG - Intronic
948768923 2:240237532-240237554 AGGTGGTGGGGGAGGGGAAGGGG - Intergenic
948868101 2:240785414-240785436 CCATGATATGGGAGGGGAAGGGG + Intronic
948934158 2:241151342-241151364 ATGTGAAAGGGGTAGGGAAGAGG + Intronic
1168849530 20:967127-967149 CAGGGAGAGGGGAGGGGCAGGGG + Intronic
1168951247 20:1803509-1803531 CTGGGAAAGGGGCGGAGAAGGGG + Intergenic
1169493577 20:6091840-6091862 CTGGGGCAGGGTAGGGGAAGGGG + Intronic
1169835548 20:9873824-9873846 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1169897307 20:10518005-10518027 CTGGGAGTGGGGAGGGGCAGGGG + Intronic
1170091317 20:12592505-12592527 GTTTGATATGGGAGGGGCAGTGG - Intergenic
1170428612 20:16258589-16258611 GTGTGTTTGGGGATGGGAAGGGG - Intergenic
1170457744 20:16549187-16549209 CTGTGGTGGGGTAGGGGGAGGGG - Intronic
1170690100 20:18606772-18606794 CTGTGGTGGGGGGGGGGAGGGGG + Intronic
1170863835 20:20135071-20135093 CTGTGATAAGGGAGAGACAGAGG + Intronic
1170940661 20:20845568-20845590 CTATGGAAGGGGAGGGGTAGGGG + Intergenic
1170951682 20:20942058-20942080 CTGTGAAAAGGCAGGGGAGGGGG + Intergenic
1171042447 20:21778189-21778211 CTTTGGTAAGGGAGAGGAAGAGG - Intergenic
1172007723 20:31828930-31828952 GTGGGAGAGGGGAGGGAAAGGGG + Intronic
1172014490 20:31864885-31864907 CTGTGGTGGGGGAGGGGGAGGGG - Intronic
1172024156 20:31936636-31936658 CTGTGTCAGGGGGTGGGAAGCGG - Intronic
1172077567 20:32310941-32310963 CAGTGGTGGGGGTGGGGAAGAGG + Exonic
1172090135 20:32424947-32424969 CTGTGACTGGGAAGGGGCAGTGG - Intronic
1172186492 20:33034295-33034317 GTGTGGCAGGGGAGGGGCAGCGG + Intronic
1172409939 20:34713544-34713566 GTGTCATATGGGAGAGGAAGAGG + Intronic
1172479743 20:35264012-35264034 CTGTCATGGGGCAGGGGACGAGG + Intronic
1172646022 20:36470142-36470164 AACTGATAAGGGAGGGGAAGGGG - Intronic
1172936288 20:38622876-38622898 CTGGGAGAGGGGAGGAGATGAGG + Intronic
1173666352 20:44766074-44766096 CTGTGGTGGGGGAGGGACAGGGG + Intronic
1173869594 20:46332944-46332966 CTGGAAGAGGGGAGGGGAGGGGG + Intergenic
1174180197 20:48669571-48669593 ATGTGATGGGAGAGGGGAGGAGG + Intronic
1174680752 20:52405736-52405758 AAGGGCTAGGGGAGGGGAAGGGG - Intergenic
1175372603 20:58502047-58502069 CTGTGAGAGGAGAGGAGAAAGGG - Intronic
1175555955 20:59856910-59856932 CTGTTGTAGGGTAGGGGAAGGGG + Intergenic
1175557964 20:59887148-59887170 CTGTCGTGGGGTAGGGGAAGGGG - Intronic
1175888919 20:62307486-62307508 CGGTGTTAAGGGAGGGGCAGTGG + Intronic
1176198255 20:63847856-63847878 CTGGGGGAGGAGAGGGGAAGTGG - Intergenic
1176270456 20:64233321-64233343 GTAGGAGAGGGGAGGGGAAGGGG - Intronic
1176613719 21:9010270-9010292 CTCTGATAGGTGAGGGACAGTGG + Intergenic
1176711472 21:10153622-10153644 CTCTGATAGGTGAGGGACAGTGG - Intergenic
1176791332 21:13323246-13323268 CTGTGATAGAGACAGGGAAGGGG + Intergenic
1176960598 21:15154753-15154775 GTGTGTTGGGGGAGGGGAGGTGG + Intergenic
1177166744 21:17612565-17612587 CGGGGACAGGGGAGGGGCAGGGG - Intronic
1177543563 21:22528018-22528040 CTGTCATGGGGTGGGGGAAGTGG - Intergenic
1177990463 21:28030126-28030148 CTGTGATAGAGACAGGGAAGGGG - Intergenic
1178238213 21:30868590-30868612 CAGTGATATTGGAGGTGAAGGGG - Intergenic
1178257385 21:31066730-31066752 CTGTCATGGGGTAGGGGGAGGGG + Intergenic
1178452367 21:32714556-32714578 GTGTGAAATGTGAGGGGAAGAGG + Intronic
1178690249 21:34744340-34744362 CTGTGCTTGGGGAGGGGCGGAGG + Intergenic
1178900702 21:36596276-36596298 GTGTGATGGGGGTGGGGAGGGGG - Intergenic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1179000436 21:37452635-37452657 CTGTCATAGGAGATGGGGAGGGG + Intronic
1179266287 21:39806420-39806442 CTGTCATGGGGTGGGGGAAGTGG - Intergenic
1179331668 21:40408285-40408307 CTGTGATAGGGTGGGGGGACAGG + Intronic
1179333026 21:40423880-40423902 CTGTGAGGGGTGTGGGGAAGAGG + Intronic
1179793087 21:43766864-43766886 CTGTGAAAGGGGAGGGCCTGGGG + Intergenic
1179881887 21:44296477-44296499 CTGAGGCAGGGGAGGGGGAGTGG - Intronic
1180051050 21:45331103-45331125 GTGGGAAAGGGGAGGGGAGGTGG + Intergenic
1180094449 21:45549621-45549643 ATGTGGCAGGGGAGGGGCAGGGG + Intergenic
1180137591 21:45871370-45871392 CTGTGACTGGGGTGGGGAAGGGG + Intronic
1180246887 21:46554482-46554504 CTGCGAGAGAGGAGGGGAGGTGG - Intronic
1180498392 22:15910180-15910202 CTCTGATAGGTGAGGGACAGTGG - Intergenic
1180857277 22:19056466-19056488 CTGTGATGGTGAAGAGGAAGGGG + Intronic
1180962326 22:19767523-19767545 CTCGGAGAGGGGAGGGGCAGTGG - Intronic
1181581745 22:23832539-23832561 CACAGAGAGGGGAGGGGAAGTGG + Intronic
1181802774 22:25358255-25358277 CTGTGAAAGAGGAAGGGACGGGG - Intronic
1182079446 22:27518685-27518707 CTGGAGTAGGGGAGGGGATGGGG - Intergenic
1182204703 22:28611655-28611677 CTGTGGTGGGGTAGGGGGAGCGG - Intronic
1182255032 22:29031797-29031819 CTGTGGTCAGGGAGGGGAAAAGG - Intronic
1182321315 22:29480062-29480084 CAGTGAGAGGGGCGGGGCAGGGG - Intergenic
1182551999 22:31105627-31105649 CTGTTCTGGGGGAGGGGAAATGG - Intronic
1182954091 22:34404604-34404626 CTGTCATGGGGTAGGGGGAGTGG + Intergenic
1183328024 22:37204907-37204929 CTCTGCAAGGGGTGGGGAAGCGG + Exonic
1183343667 22:37295351-37295373 GTGTGGTGGGGGAGGGGAGGAGG - Intronic
1183466272 22:37981882-37981904 CTGAGAAGGGGCAGGGGAAGGGG + Intronic
1183473587 22:38023140-38023162 CTGTGATAGGGACTGGGAGGAGG + Intronic
1183678864 22:39315173-39315195 CTGGGATAGCGGAGGGCCAGGGG - Intronic
1183752702 22:39731068-39731090 CTGTGCTAGGGGAGGGGGCTGGG + Intergenic
1183781711 22:40003158-40003180 CTGTGCTAAGGCTGGGGAAGAGG + Intronic
1184096356 22:42318412-42318434 CTGTGAGAGGAGAGGGGAGGAGG + Intronic
1184272685 22:43393544-43393566 CTGTGGTGGGGGAGGGGCTGTGG + Intergenic
1184978641 22:48080868-48080890 GTGTGGTGGGGGAGGGGGAGGGG - Intergenic
1185285194 22:49996906-49996928 CGGGGATGGGGGATGGGAAGGGG + Intronic
949303019 3:2606328-2606350 CTGTGGTAGGGCAGGGGTCGAGG + Intronic
949610739 3:5700979-5701001 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
949673732 3:6428650-6428672 CTGTTGTGGGGTAGGGGAAGTGG - Intergenic
949787381 3:7757033-7757055 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
950007020 3:9697976-9697998 CTGAGAGAGGGGAGGGCAGGAGG - Intronic
950088910 3:10280924-10280946 CTGTGTTAGAGGAGGAAAAGCGG + Exonic
950249659 3:11453796-11453818 CAGTGATGGGGGAGTGCAAGGGG + Intronic
950256423 3:11510448-11510470 CTGGGATGGGGGAGGGGGTGGGG - Intronic
950421789 3:12903745-12903767 CTGGGAGTGGGGATGGGAAGAGG + Intronic
950624274 3:14233037-14233059 TTGTGGTAGAGGAGGAGAAGTGG + Intergenic
950751907 3:15135841-15135863 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
951442346 3:22737883-22737905 CTGTTATGGGGTGGGGGAAGGGG - Intergenic
951918654 3:27828981-27829003 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
952128896 3:30336385-30336407 CTGTCATAGGGTGGGGGGAGGGG - Intergenic
952268907 3:31813640-31813662 ATGGGGTAGGGGAGGGGACGAGG + Intronic
952519755 3:34144963-34144985 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
952767563 3:36968155-36968177 CTGTTATGGGGTAGGGGAGGGGG - Intergenic
953324494 3:42001441-42001463 CTGAGGTAGGGCAGGGGCAGAGG + Intergenic
953567133 3:44042308-44042330 CTGTTAGAGGAGAGGGGAAATGG + Intergenic
953770075 3:45772772-45772794 CTGGGTTAGGGCTGGGGAAGTGG + Intronic
954002123 3:47566061-47566083 CTGTGACAGGGAAGGGTCAGTGG - Intronic
954135182 3:48579146-48579168 ATGTGAAGGGGTAGGGGAAGGGG + Intronic
954139130 3:48595932-48595954 CTGTGACATGGTAGGGGATGTGG - Intergenic
954151351 3:48658873-48658895 CTGTCACAGGTGAGGGGCAGGGG - Exonic
954604350 3:51897288-51897310 CTTGGACAAGGGAGGGGAAGGGG - Intronic
954605014 3:51902756-51902778 CTTGGACAAGGGAGGGGAAGGGG - Intronic
955023293 3:55142182-55142204 CTGTGGTGGGGTGGGGGAAGGGG + Intergenic
955349459 3:58183190-58183212 CTGTGGTGGGGAAAGGGAAGTGG - Intergenic
955422993 3:58758684-58758706 CTGTTGTGGGTGAGGGGAAGGGG - Intronic
955674617 3:61435164-61435186 ATGTGATGGCGGACGGGAAGAGG + Intergenic
955951943 3:64251385-64251407 CTGTGGTGGGGGAGTGGGAGAGG - Intronic
956589060 3:70894385-70894407 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
957068703 3:75548463-75548485 CTGTGGTGGGGGAGGGGTTGTGG - Intergenic
957310596 3:78513481-78513503 CTGTCATGGGGTAGGGAAAGGGG + Intergenic
957494572 3:80975296-80975318 CAGTGATGGGGGAAGGCAAGGGG + Intergenic
957696105 3:83639549-83639571 CTGTCATGGGGTAGGGGGAGGGG + Intergenic
957822586 3:85398153-85398175 CTGTCATGGGGTGGGGGAAGGGG - Intronic
957857212 3:85894340-85894362 CTGTTGTGGGGTAGGGGAAGTGG + Intronic
957975160 3:87433779-87433801 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
958796660 3:98713370-98713392 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
960252294 3:115469498-115469520 CTGTGATGGGGTGGGGGGAGAGG + Intergenic
960330085 3:116348466-116348488 CTATGAGAAGGAAGGGGAAGCGG + Intronic
960421365 3:117449764-117449786 ATGTGAAAGGAGTGGGGAAGTGG + Intergenic
960720068 3:120616859-120616881 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
960720894 3:120623429-120623451 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
960766324 3:121134552-121134574 CTGTTATGGGGTGGGGGAAGGGG - Intronic
960798569 3:121514481-121514503 CTGACTTAGGGGAGTGGAAGGGG - Intronic
961284707 3:125791857-125791879 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
961337974 3:126195956-126195978 CTGTCATGGGGTGGGGGAAGAGG + Intronic
961456913 3:127028931-127028953 CTGTGATGGAGGAGGGAAAGAGG + Intronic
961512873 3:127413731-127413753 TTATGGCAGGGGAGGGGAAGGGG - Intergenic
961962355 3:130867851-130867873 ATGTGATGGCGGCGGGGAAGAGG - Intronic
962131641 3:132684939-132684961 AAGAGATAGGGGTGGGGAAGAGG - Intronic
962370897 3:134820043-134820065 GTGGGTGAGGGGAGGGGAAGGGG - Intronic
962562217 3:136618344-136618366 CTTGGACAAGGGAGGGGAAGGGG - Intronic
962580146 3:136790856-136790878 TAGTGATAGGGGAGGGGAAGGGG - Intergenic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963750081 3:149168702-149168724 TTGTGATTGGGAAGGGAAAGGGG + Intronic
963773520 3:149414899-149414921 AAGTGATTGAGGAGGGGAAGGGG + Intergenic
963943844 3:151123482-151123504 TTTTTATAGGGGAGGGGATGTGG + Intronic
964739677 3:159952164-159952186 CTGTAAAAGGGAAGAGGAAGAGG + Intergenic
965304871 3:167051786-167051808 CTGGGATGGGGGTGGGGTAGGGG - Intergenic
965640979 3:170828791-170828813 GTGAGAAAGGGAAGGGGAAGAGG + Intronic
965737909 3:171841457-171841479 CACTGATATGGGGGGGGAAGGGG - Intergenic
966306540 3:178542078-178542100 CTTGGACAAGGGAGGGGAAGGGG - Intronic
967094690 3:186167490-186167512 CTGTGATAGAGGAAGTAAAGGGG - Intronic
967291647 3:187926684-187926706 CAGTGATAGGGGTGGGGGAAAGG - Intergenic
967511989 3:190322830-190322852 GTGTGATGGGGGAGGAGACGCGG - Intronic
967882123 3:194308885-194308907 CTGTGCTGGGCTAGGGGAAGAGG + Intergenic
968065062 3:195753951-195753973 CAGGCATAGGGGAGGGGACGGGG - Intronic
968084690 3:195869053-195869075 CCGTGACAGGGGCGGGGATGAGG - Intronic
968283161 3:197492246-197492268 CTGTGTTAGAGGAGGGGAGGAGG + Intergenic
968293389 3:197555661-197555683 CCGGGATACGGGTGGGGAAGGGG - Intronic
968434866 4:579227-579249 CTGTATTGGGGGTGGGGAAGGGG + Intergenic
968513000 4:1003510-1003532 CTGTGATGGCGTCGGGGAAGGGG - Intronic
968614769 4:1572509-1572531 CTGTGATAAGGGAGAGGTTGGGG + Intergenic
968684071 4:1944520-1944542 CTGTGCTTGGAGAGGGGAGGTGG + Intronic
968841964 4:3014167-3014189 CTGTGATAAGGGAAAGGAAAGGG - Intronic
969013034 4:4083004-4083026 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
969167699 4:5331067-5331089 CTATGGGAGTGGAGGGGAAGGGG - Intronic
969740810 4:9024790-9024812 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
969800148 4:9557621-9557643 CTGTGGTGGGGAAGGGGATGTGG + Intergenic
969920036 4:10529738-10529760 TTGTCAAAGGGGAGAGGAAGAGG + Intronic
970092430 4:12425834-12425856 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
970093071 4:12431240-12431262 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
970305552 4:14728183-14728205 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
970793336 4:19886025-19886047 CTGAGAAATGGGAGTGGAAGAGG - Intergenic
970926460 4:21458140-21458162 CTGTGGTAGGGTGGGGGGAGGGG - Intronic
970972689 4:22002604-22002626 CTGTCATAGGGTGGGGGGAGGGG + Intergenic
970982514 4:22117253-22117275 CTGTAATAGCAGAGGGGAAAAGG + Intergenic
971019082 4:22516134-22516156 CCGGGAAAGAGGAGGGGAAGGGG - Intergenic
971093415 4:23371530-23371552 TTGTGATGGAGGAGGGGAATGGG - Intergenic
971373014 4:26033360-26033382 CTATGAGAGGGGAGGGGCAGAGG + Intergenic
971412061 4:26384817-26384839 AGGTGAGAGGGGAGGGGGAGAGG - Intronic
971586711 4:28413251-28413273 CTGTCATGGGGTAGGGGGAGTGG + Intergenic
972117177 4:35650910-35650932 CTGTTGTGGGGCAGGGGAAGGGG + Intergenic
972639042 4:40909072-40909094 CTGTGACAGGGGAGGCCCAGAGG - Intronic
972784415 4:42313821-42313843 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
973772254 4:54217716-54217738 CAGTGCTGGGGGAGGGGAGGAGG - Intronic
974361532 4:60887236-60887258 CTGTCATGGGGTAGGGGGAGGGG - Intergenic
974488190 4:62530537-62530559 CTGTCATGGGGTGGGGGAAGTGG + Intergenic
974524073 4:63025648-63025670 CTGTTATGGGGTAGGGGGAGTGG - Intergenic
974831355 4:67193314-67193336 CCCTGGTAGGGGAGGGCAAGAGG + Intergenic
974944423 4:68509952-68509974 CTGTGGTGGGGTAGGGGCAGGGG - Intergenic
975322875 4:73027947-73027969 CTGTCATAGGGTGGGGGGAGGGG + Intergenic
975523519 4:75325261-75325283 AAGTGATAGGGGAGGAGAAGGGG - Intergenic
975844724 4:78513015-78513037 CTGTGACAGAGCAGGGGAACAGG + Intronic
975856237 4:78627487-78627509 CTGGGATGGGGATGGGGAAGGGG + Intergenic
975911982 4:79277833-79277855 CTTGGACAAGGGAGGGGAAGGGG - Intronic
975927973 4:79482727-79482749 CTGTGCTGGGGTGGGGGAAGGGG + Intergenic
976352720 4:84078351-84078373 CTGTGGTGGGGTAGGGGGAGGGG + Intergenic
976879531 4:89902170-89902192 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
977222241 4:94351770-94351792 CTGAGGTAGGGGTGGGGAATTGG + Intergenic
977482482 4:97595443-97595465 CTGTCATGGGGTAGGGGGAGAGG + Intronic
977682134 4:99808490-99808512 CTGTGGAAGTGGAGGGGAAGAGG + Intergenic
978796807 4:112716051-112716073 CTGTCCTTGGGGAAGGGAAGAGG - Intergenic
979048832 4:115903616-115903638 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
979177296 4:117680296-117680318 CTGTTGTAGGGTAGGGGGAGCGG - Intergenic
979770704 4:124521596-124521618 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
979791073 4:124781562-124781584 CTGTGGTAGGGGTGGGAAATGGG + Intergenic
980625952 4:135375007-135375029 CTGTTATGGGGTGGGGGAAGGGG - Intergenic
980743059 4:136976561-136976583 CTGTCATGGGGTGGGGGAAGGGG - Intergenic
981106515 4:140887766-140887788 CTCTGGGAGGGGTGGGGAAGAGG + Intronic
981936479 4:150245514-150245536 CTGTCATGGGGTAGGGGAAGGGG - Intronic
981968811 4:150639197-150639219 CTGTGGTGGGGTAGGGGAAGGGG + Intronic
982331459 4:154186209-154186231 CGGTGACAGGGTGGGGGAAGTGG - Intergenic
982651775 4:158096086-158096108 CTGTCATGGGGTGGGGGAAGTGG - Intergenic
982708589 4:158737261-158737283 CTGTCGTAAGGGAGGGGAAAGGG + Intergenic
982933193 4:161435427-161435449 GTGTAACTGGGGAGGGGAAGAGG + Intronic
984370475 4:178858686-178858708 CTGTGGTGGGGTAGGGGGAGTGG - Intergenic
984449355 4:179879114-179879136 CAGTGATGGGGAAGGGGAAAGGG + Intergenic
984648230 4:182242205-182242227 CTGTCATGGGGTGGGGGAAGTGG - Intronic
984842382 4:184080498-184080520 CTGTGGGAGGGGAGATGAAGGGG + Intergenic
985390630 4:189488824-189488846 CTGTTGTAGGGTAGGGGGAGGGG + Intergenic
985504937 5:273413-273435 CAATGATAGCGGAGGGGAGGGGG - Intronic
985513883 5:327931-327953 CTGTTGTAGGGTAGGGGGAGCGG - Intronic
985570810 5:643788-643810 CTGTCATCGAGGAGGGGAAAGGG - Intronic
985777820 5:1854105-1854127 CTGTGGTAGAGGCAGGGAAGAGG - Intergenic
985803584 5:2021999-2022021 CTGTGTTAGGGGGAGGCAAGGGG - Intergenic
988210362 5:28196301-28196323 CTGTTGTGGGGTAGGGGAAGCGG - Intergenic
988287757 5:29242495-29242517 CTGTTGTGGGGTAGGGGAAGCGG - Intergenic
988352560 5:30130536-30130558 CTGTCATGGGGTGGGGGAAGGGG - Intergenic
988390154 5:30617156-30617178 CTGTGAGGGGTGGGGGGAAGGGG - Intergenic
988907850 5:35808396-35808418 CTGTCATGGGGTGGGGGAAGGGG - Intronic
988969703 5:36454789-36454811 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
989119927 5:37994705-37994727 CTGATTTAGGGGAGGAGAAGAGG - Intergenic
989463703 5:41729763-41729785 CTGTCATGGGGTGGGGGAAGGGG + Intergenic
989479919 5:41918745-41918767 ATATGCTAGGGGAGGGGCAGAGG - Exonic
989498643 5:42139780-42139802 CGCTGATAGGGAAGAGGAAGAGG - Intergenic
990299236 5:54434112-54434134 CTGTGAAAGAGAAGAGGAAGAGG + Intergenic
990456192 5:55990886-55990908 CTGTCATGGGGTAGGGGGAGGGG - Intronic
990509272 5:56475524-56475546 CTGTTGTCGGGTAGGGGAAGTGG + Intronic
990560918 5:56982133-56982155 CTGTGGTTGGAGGGGGGAAGGGG - Intergenic
990676689 5:58194416-58194438 CTGTTGTAGGGTAGGGGGAGGGG + Intergenic
990901505 5:60755339-60755361 CTGTGACAGTGGAGGACAAGTGG - Intronic
991001110 5:61784005-61784027 TTGGAATGGGGGAGGGGAAGCGG - Intergenic
991045393 5:62217820-62217842 CTGTGGTGGGGGTGGGCAAGAGG - Intergenic
991124700 5:63056057-63056079 CTGGGATAGGGGAGGAAATGGGG - Intergenic
991253650 5:64591481-64591503 CTGGGAAAGGGGTGGGGAAATGG + Intronic
991669679 5:69035553-69035575 AAGAGATTGGGGAGGGGAAGTGG + Intergenic
991860865 5:71011787-71011809 CTGTGAAATGGGAGAGAAAGGGG + Intronic
991941220 5:71854007-71854029 CTGTGATGGGGTGGGGGGAGCGG + Intergenic
991967876 5:72109046-72109068 CTTTTATTGGGGAGGGGGAGTGG - Intronic
992476463 5:77107048-77107070 CTGTCGTAGGGTAGGGGGAGAGG - Intergenic
992689861 5:79231683-79231705 CTGTGGAAGAGAAGGGGAAGGGG - Intronic
992772637 5:80062681-80062703 CTGTCATGGGGTAGGGGGAGGGG - Intronic
993170666 5:84415166-84415188 CTGGGAGAGGGGAGTGGAAATGG - Intergenic
993270571 5:85791054-85791076 CTGTAGTGGGGTAGGGGAAGTGG - Intergenic
993296348 5:86146391-86146413 CTGTCATGGGGTAGGGGGAGGGG - Intergenic
993474532 5:88348350-88348372 CTGTCATGGGGTAGGGGGAGGGG - Intergenic
993816084 5:92547142-92547164 CTGTCATAGGGTTGGGGGAGGGG + Intergenic
994016466 5:94972364-94972386 CAGTGATAGTGAAGGGAAAGGGG - Intronic
994531437 5:100977769-100977791 CTGTTGTGGGGGAGGGGGAGGGG - Intergenic
995327545 5:110908081-110908103 CTGTCATGGGGTAGGGGAGGGGG + Intergenic
995468482 5:112475427-112475449 AAGTAATAGGGAAGGGGAAGTGG + Intergenic
995728117 5:115203607-115203629 ATGTGCATGGGGAGGGGAAGTGG + Intergenic
995731614 5:115249390-115249412 CTTGGACAAGGGAGGGGAAGGGG + Intronic
995794811 5:115930076-115930098 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
996052344 5:118948504-118948526 CTGTGATCAGGGTGGGGAACAGG + Intronic
996827377 5:127700591-127700613 CTGTGCTAGGGGAGGACAAGAGG - Intergenic
996958026 5:129209057-129209079 CTGTGGTAGGGTGGGGGGAGGGG - Intergenic
997081027 5:130737956-130737978 CTGTGGTGGGGTGGGGGAAGGGG + Intergenic
997284648 5:132669430-132669452 CTCACACAGGGGAGGGGAAGGGG + Intergenic
997868777 5:137488741-137488763 CTGTGATTGGAGCAGGGAAGTGG - Intronic
997875515 5:137543259-137543281 CTGTCATAGGGTGGGGGGAGTGG + Intronic
998113513 5:139519702-139519724 CTGGGATATTGGATGGGAAGAGG + Intergenic
998403953 5:141863176-141863198 CCGTGGTAGGGGTGGGGTAGGGG + Intronic
998440482 5:142157206-142157228 CTTAAATGGGGGAGGGGAAGTGG - Intergenic
998552224 5:143088723-143088745 CTTTGGCAAGGGAGGGGAAGGGG + Intronic
998649425 5:144101397-144101419 TAGTGACAGGGGAGGGGAAATGG - Intergenic
998683786 5:144500765-144500787 CTGTCATGGGGTGGGGGAAGTGG + Intergenic
998939125 5:147261330-147261352 CTTGGACAAGGGAGGGGAAGGGG + Intronic
999118593 5:149187931-149187953 CTTGGACAAGGGAGGGGAAGAGG - Intronic
999237900 5:150110304-150110326 CCTTGACAGGGGAGGGGAAGAGG - Intronic
999482519 5:151961767-151961789 CTGTGAGAAGCCAGGGGAAGCGG + Intergenic
999665708 5:153910748-153910770 CTGTCATGGGGTGGGGGAAGTGG + Intergenic
999700803 5:154225977-154225999 CTGTTGTGGGGTAGGGGAAGGGG + Intronic
1000393670 5:160750588-160750610 CAGTGATGGTGGAGGGAAAGAGG - Intronic
1000794077 5:165643096-165643118 CTGTGATAGGCTATGGGAAATGG + Intergenic
1000919410 5:167120382-167120404 CTGTGGGAGAGGAGGGGAAGTGG + Intergenic
1001071845 5:168592694-168592716 CTGTCATGGGGTAGGGGGAGGGG - Intergenic
1001540537 5:172534672-172534694 CAGTCATAGGGCAGGGGCAGGGG - Intergenic
1001558230 5:172650738-172650760 CTTGGACAAGGGAGGGGAAGGGG + Intronic
1002019102 5:176350765-176350787 TTGTGATGGGAGAGGGGAATGGG - Intronic
1002169283 5:177366362-177366384 CTGGGGTAGGGAAAGGGAAGGGG + Intronic
1002443476 5:179276037-179276059 CTGTGGGAGGAGAGCGGAAGAGG + Intronic
1002660527 5:180788370-180788392 CTGTGAGGGTGGAGAGGAAGAGG - Intergenic
1002854541 6:1025703-1025725 CTGGGATGTGGGATGGGAAGAGG + Intergenic
1003098676 6:3160630-3160652 CGGGGATGGGGAAGGGGAAGAGG + Intergenic
1003549192 6:7086653-7086675 CTCAGATAGTGCAGGGGAAGAGG - Intergenic
1003719139 6:8680906-8680928 CCTTGATAGGGAAGGGGCAGTGG + Intergenic
1004481654 6:16025421-16025443 CTCTCATAGGAGAGGGGAAGTGG - Intergenic
1005996401 6:30934056-30934078 CTTTGACAGGGAAGGGGAAAGGG - Intergenic
1006061289 6:31421816-31421838 CTTGGACAGGGGAAGGGAAGAGG + Intergenic
1006181294 6:32154821-32154843 CTGTGGCAGGGGAGGGAGAGCGG + Intronic
1006326211 6:33355901-33355923 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1007124065 6:39409892-39409914 CTGGGACAGAGGTGGGGAAGAGG - Intronic
1007496075 6:42261023-42261045 CGGGGATAGGGGAGGGGTGGGGG - Intronic
1007677187 6:43606302-43606324 CTGGGATGGGGGAGGGGAGGAGG - Intronic
1007938848 6:45758022-45758044 CTGAGAGAGGAGAGGGTAAGGGG + Intergenic
1007987825 6:46224929-46224951 CTGTCATGGGGTGGGGGAAGGGG - Intronic
1008104938 6:47431097-47431119 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1008122688 6:47635787-47635809 CTGTCATAGGGTCGGGGGAGGGG - Intergenic
1008280196 6:49587327-49587349 CTAGGACAAGGGAGGGGAAGGGG + Intergenic
1008826806 6:55704898-55704920 CTGAGATTGGGGTGGGGTAGGGG - Intergenic
1008864709 6:56195436-56195458 ATGTGGTGGGGGAGGGAAAGAGG + Intronic
1009357910 6:62775007-62775029 CTGTGCAAGGTGAGAGGAAGGGG + Intergenic
1009635389 6:66259029-66259051 CTTGGACAAGGGAGGGGAAGAGG - Intergenic
1009636010 6:66264705-66264727 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1010182474 6:73103479-73103501 CTGTCATGGGGGGGGGGGAGAGG + Intronic
1010320224 6:74498575-74498597 CTCTGATAGGGGAAAGGAAATGG - Intergenic
1010669112 6:78665793-78665815 CTGTCATGGGGTAGGGGGAGGGG - Intergenic
1010917895 6:81643124-81643146 CAGTGATGGAGGAGAGGAAGTGG - Intronic
1011046222 6:83086393-83086415 CTGTGAGTGGGCAGAGGAAGAGG + Intronic
1011123163 6:83977205-83977227 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1011146804 6:84227220-84227242 TAGAGATGGGGGAGGGGAAGAGG + Intronic
1011180959 6:84620186-84620208 AAGTGATGGGGGAGGGGATGGGG - Intergenic
1011269603 6:85563918-85563940 CTGTCATGGGGTGGGGGAAGGGG - Intronic
1011282924 6:85694944-85694966 CTGTCATGGGGTAGGGGGAGGGG - Intergenic
1011365434 6:86576581-86576603 CTGTAGTAGGGAAGGGGAAGGGG - Intergenic
1011734348 6:90296643-90296665 CCGGGAAGGGGGAGGGGAAGGGG + Exonic
1011965869 6:93156783-93156805 CTGCTGTAGGGGAGGGGATGTGG + Intergenic
1012270887 6:97209029-97209051 CTGTGATAAGGAAGGAGGAGGGG - Intronic
1012362443 6:98399191-98399213 CTGTAATGGAGGTGGGGAAGGGG + Intergenic
1012527472 6:100195611-100195633 CTGTTGTAGGGTGGGGGAAGGGG + Intergenic
1012714613 6:102652498-102652520 CTGTCATGGGGTAGGGGTAGAGG - Intergenic
1012984318 6:105858659-105858681 CTGTCATGGGGTAGGGGGAGTGG - Intergenic
1013278468 6:108610089-108610111 CTGTATATGGGGAGGGGAAGGGG - Intronic
1013351020 6:109305797-109305819 CTGTGAAAGTCGAGGGCAAGGGG + Intergenic
1013655585 6:112243274-112243296 CTGTGGTAGGGGGTGGGGAGGGG - Intronic
1013813636 6:114071955-114071977 CTGTGATAGAAGTGGGGCAGTGG + Intronic
1013814586 6:114082944-114082966 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1014061961 6:117082024-117082046 CTGTCATGGGGTAGGGGAAGGGG + Intergenic
1014547107 6:122746851-122746873 CTCTGAAAGGAGAGGGAAAGGGG - Intergenic
1014649803 6:124022041-124022063 CTGTCATGGGGTAGGGGGAGGGG - Intronic
1014660525 6:124165663-124165685 CTGTGGTGGGGTAGGGGGAGGGG - Intronic
1015561182 6:134517723-134517745 CTGTGGGAGGGGTGAGGAAGAGG - Intergenic
1015779178 6:136846490-136846512 CTGTCATGGGGTGGGGGAAGGGG - Intronic
1016384462 6:143516848-143516870 CTGAGATAGGGCTGGGCAAGAGG + Intergenic
1016546423 6:145229267-145229289 GTGGGAGAGGGGAGGGGAGGAGG - Intergenic
1016866269 6:148770436-148770458 CCATGGTAGGGGAAGGGAAGAGG + Intronic
1017030884 6:150220537-150220559 ATGTAATATGGGAGTGGAAGGGG + Intronic
1017133487 6:151128382-151128404 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1017259665 6:152371663-152371685 GAGAGAGAGGGGAGGGGAAGGGG + Intronic
1017640201 6:156486008-156486030 CTGTTGTAGGGTAGGGGGAGGGG - Intergenic
1018490905 6:164292345-164292367 CTGTCATGGGGTAGGGGGAGGGG - Intergenic
1018532444 6:164782105-164782127 CTGTGATGGGGTGGGGGGAGTGG - Intergenic
1018705684 6:166461854-166461876 CTGTGGTGGGGCAGGGGCAGGGG - Intronic
1018937765 6:168284698-168284720 CTGAAATAGGGAAGGGGAATGGG - Intergenic
1019281874 7:204697-204719 CAGTGTTCAGGGAGGGGAAGTGG + Intronic
1019281902 7:204839-204861 CAGTGTTCAGGGAGGGGAAGTGG + Intronic
1019281919 7:204910-204932 CGGTGCTCGGGGAGGGGACGTGG + Intronic
1019652941 7:2170389-2170411 CAGGGAAAGGGGAGGGCAAGTGG + Intronic
1019686059 7:2382894-2382916 CTGGGAAAGGGGAGGAGACGTGG + Intergenic
1019971816 7:4547709-4547731 CTGACAAAGGGGAGGGGAAAGGG - Intergenic
1020389171 7:7640580-7640602 CTCTGAAAGGGGTGGAGAAGGGG + Exonic
1020640967 7:10753059-10753081 CTGTCATGGGGTGGGGGAAGTGG + Intergenic
1021633964 7:22673134-22673156 CTTGTATGGGGGAGGGGAAGAGG - Intergenic
1021813420 7:24425349-24425371 GTGTGATGGGGGAGGAGAAAAGG - Intergenic
1021859723 7:24894558-24894580 CTGTGCTTGGGGCGGGGAGGGGG + Intronic
1021865511 7:24952826-24952848 ATGAGATTGGGGAGGGGAAGCGG - Intronic
1022106423 7:27200415-27200437 CTGGGATAAAGGAAGGGAAGGGG - Intergenic
1022221430 7:28317417-28317439 CTTTGAGTGGGCAGGGGAAGAGG + Intronic
1022324610 7:29319898-29319920 GTGAGGTCGGGGAGGGGAAGGGG - Intronic
1022504470 7:30901978-30902000 TTGGGATAGGAAAGGGGAAGAGG - Intergenic
1022651570 7:32282004-32282026 CTGTCATGGGGTAGGGGACGGGG + Intronic
1023436796 7:40147952-40147974 CTTGGACAAGGGAGGGGAAGGGG + Intronic
1023664238 7:42504854-42504876 CTGTCATGGGGTAGGGGGAGGGG - Intergenic
1023868964 7:44252516-44252538 CTGTGATGGGGCACGGGCAGGGG + Intronic
1024087904 7:45911887-45911909 CTCTGATTGGAGATGGGAAGGGG + Intergenic
1024553342 7:50581973-50581995 CTGAGAGAGGGGAAGGGTAGTGG - Intergenic
1024753224 7:52495054-52495076 CTGTGGTGGGGTAGGGGGAGAGG - Intergenic
1024822374 7:53347905-53347927 CTGTCATGGGGTGGGGGAAGTGG + Intergenic
1025597459 7:62949261-62949283 CTGTTGTGGGGTAGGGGAAGGGG - Intergenic
1026799254 7:73388501-73388523 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1027276360 7:76561346-76561368 CTGTTGTGGGGTAGGGGAAGGGG - Intergenic
1027935008 7:84590595-84590617 CTGTCGTGGGGTAGGGGAAGGGG - Intergenic
1027944160 7:84723675-84723697 CTGTGATCATGGAGGAGAAGAGG - Intergenic
1028137260 7:87234987-87235009 CTGAGATAGGGGAGGAAAGGAGG - Intergenic
1028333449 7:89624475-89624497 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1028373050 7:90116233-90116255 CTGTCATGGGGTGGGGGAAGGGG + Intergenic
1028405430 7:90468957-90468979 GTGTGGTTGGGGAGGGGTAGAGG - Intronic
1028804521 7:95009145-95009167 CTGTCATGGGGTCGGGGAAGGGG + Intronic
1029071691 7:97904638-97904660 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
1029297056 7:99549893-99549915 CTGTCATGGGGTGGGGGAAGTGG + Intronic
1030079160 7:105762549-105762571 AGGTGATTGGGTAGGGGAAGGGG - Intronic
1030091300 7:105861405-105861427 CTGGGATGGGGGTGGGGGAGTGG + Intronic
1030363152 7:108616440-108616462 CTGTGGTAGGGTGGGGGGAGTGG + Intergenic
1030537260 7:110784371-110784393 ATGTGGAAGGGGAGGGGAGGAGG - Intronic
1031462835 7:122072815-122072837 CTGTCGTGGGGTAGGGGAAGGGG - Intergenic
1031895758 7:127346823-127346845 CTGTGAAAGGAGAGGGGAACTGG + Intronic
1031909933 7:127505431-127505453 CTGGGAGAGGGAAGGGGAAGGGG - Intergenic
1031955016 7:127934166-127934188 CTGTGTTGGGGGAGGGGAGTAGG + Intronic
1032359748 7:131244425-131244447 CTGTGAGAGGGGAGGTGGTGGGG - Intronic
1032536777 7:132671133-132671155 GTGTGGGAGGGGCGGGGAAGAGG + Intronic
1032854919 7:135825971-135825993 GTGTGTTGGGGGAGGGGGAGAGG + Intergenic
1032857538 7:135847792-135847814 CTGTCATGGGGTGGGGGAAGTGG - Intergenic
1033096795 7:138439289-138439311 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1033270538 7:139929264-139929286 CTTGGACAAGGGAGGGGAAGGGG + Intronic
1033293896 7:140114177-140114199 CGTGGAAAGGGGAGGGGAAGGGG - Intronic
1033370673 7:140704589-140704611 CTGTGATAGAGGGAGGGTAGGGG - Intronic
1033377941 7:140782056-140782078 CTGTCATGGGGTAGGGGGAGGGG - Intronic
1033383160 7:140844141-140844163 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1033498167 7:141920829-141920851 CTGTGGTGGGGTCGGGGAAGGGG - Intronic
1033499349 7:141932138-141932160 CTGTGAGAATGAAGGGGAAGGGG + Intronic
1034285334 7:149880132-149880154 CTGGGATGAGAGAGGGGAAGGGG + Exonic
1034880903 7:154761841-154761863 CTGTCATGGGGTGGGGGAAGGGG - Intronic
1034929078 7:155146285-155146307 CTTTGATATGGGTGGGGAGGAGG - Intergenic
1034975950 7:155449393-155449415 CCGTGCGAGGGGAGGGGAGGGGG - Intergenic
1035038915 7:155913575-155913597 CTTTGAAAGGGGATTGGAAGAGG + Intergenic
1035283647 7:157793080-157793102 CTGTGCCCGGGGAGAGGAAGGGG + Intronic
1035905770 8:3508351-3508373 CTGTTATGGGGCAGGGGGAGGGG + Intronic
1036017182 8:4798159-4798181 CTGTCATTGGGTGGGGGAAGTGG - Intronic
1036217125 8:6889918-6889940 CTGAGACTGGGGAGGGGACGGGG - Intergenic
1036246015 8:7117358-7117380 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
1036475612 8:9090229-9090251 CTGTGAGAGAGGAAAGGAAGAGG + Intronic
1036647848 8:10623221-10623243 CTGTAACAGGGCAGAGGAAGAGG + Intronic
1036888255 8:12576670-12576692 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
1037120966 8:15286623-15286645 CTGTCAGGGGGCAGGGGAAGGGG - Intergenic
1037133398 8:15433534-15433556 CTGTTATATGGGTGGGGGAGTGG - Intronic
1037242509 8:16793088-16793110 CTGTGATGGGGTGGGGGGAGGGG + Intergenic
1037412722 8:18615412-18615434 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1037783263 8:21885921-21885943 CTGTGCTAGGGTCGGGGGAGGGG - Intergenic
1037986337 8:23292919-23292941 CTGTGGTGGGGGAGGGGTATAGG - Intronic
1038166300 8:25088057-25088079 GGGGGAAAGGGGAGGGGAAGGGG + Intergenic
1038383540 8:27119476-27119498 CTGTGATGGGGTCGGGGGAGGGG + Intergenic
1039271004 8:35880423-35880445 TTGTGCTAGGGGAGAGGAAGAGG - Intergenic
1039469187 8:37803015-37803037 CTGTGATTAGGGAGGGGGAGTGG + Intronic
1039546440 8:38414329-38414351 TTGTGCTGGGGGAGGGGAGGCGG - Intronic
1040387087 8:46921016-46921038 CAGTTACAGGGGAGGGGAGGAGG + Intergenic
1040414555 8:47184558-47184580 GAGTGCTGGGGGAGGGGAAGAGG - Intergenic
1040730060 8:50434036-50434058 CTGTCATGGGGTAGGGGGAGGGG - Intronic
1040777444 8:51063005-51063027 CTGTTGTGGGGGAGGGGGAGGGG + Intergenic
1040915615 8:52564623-52564645 GCGTGAAAGGGGAGGGGAAAGGG + Intronic
1041029948 8:53726890-53726912 TTGTGATTTGGGAGTGGAAGTGG - Intronic
1041612630 8:59869945-59869967 CTGTGATGGGGTGGGGGTAGGGG - Intergenic
1042177829 8:66054872-66054894 CTGTGCTGGGGTAGGGGAGGTGG + Intronic
1042339720 8:67666410-67666432 CTGAGAGAGGGGTGGGGAGGGGG + Intronic
1042618054 8:70671480-70671502 CTGTGGTGGGGTCGGGGAAGGGG - Intronic
1042875891 8:73439558-73439580 CAGTGACAGGGGTGGGAAAGAGG + Intronic
1042982787 8:74549168-74549190 AGGTGAAAGGGGTGGGGAAGTGG + Intergenic
1043726422 8:83617443-83617465 CTGTCATAGGGTGGGGGGAGCGG - Intergenic
1043915528 8:85918424-85918446 CTGTAATGGGGTAGGGGGAGGGG + Intergenic
1044062393 8:87654035-87654057 CTGTTATGGGGTGGGGGAAGAGG + Intergenic
1044843033 8:96354279-96354301 TTTTGGTAGGGGAGGGGAAGGGG + Intergenic
1044887638 8:96796579-96796601 CTTTGATAGGGGAGAGGGAGTGG - Intronic
1046094032 8:109537402-109537424 CTTTGAAAGGGGAGAGTAAGTGG + Intergenic
1046218349 8:111179835-111179857 CTGTCATGGGGTAGGGGAAGGGG - Intergenic
1046283570 8:112066458-112066480 CTGTTATAGGGTGGGGGGAGGGG - Intergenic
1046415323 8:113906462-113906484 CTGTGGTGGGGTGGGGGAAGGGG - Intergenic
1046537228 8:115530924-115530946 CTGTCATGGGGTGGGGGAAGGGG + Intronic
1047293654 8:123551931-123551953 CTGTCATGGGGTGGGGGAAGGGG + Intergenic
1047643088 8:126841770-126841792 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1047733802 8:127748342-127748364 CTGTGATAGAGGAAGGGGGGAGG - Intergenic
1048483035 8:134819235-134819257 CTGGGAGTGGGAAGGGGAAGAGG + Intergenic
1048688330 8:136929443-136929465 CTCTGATTGGAGAGGGGTAGGGG + Intergenic
1049299560 8:141862399-141862421 CTCTGTTTGGGGAGGGGAAGCGG - Intergenic
1049410974 8:142473872-142473894 CTGGCATAGGTGTGGGGAAGTGG + Intronic
1049503468 8:142981461-142981483 CTGTGATGGGGAAGGAAAAGGGG - Intergenic
1049694230 8:143975807-143975829 CTGTCAAATGGAAGGGGAAGGGG + Intronic
1049855864 8:144861510-144861532 CTTTGGTAGGAGAGGGGAGGAGG + Intergenic
1050170519 9:2811069-2811091 CTGCGATTGGGGAAGAGAAGTGG - Intronic
1050442063 9:5675072-5675094 CTTGGACAAGGGAGGGGAAGGGG + Intronic
1051272723 9:15371229-15371251 CGGTGATAGGGTCGGGGTAGGGG - Intergenic
1051872628 9:21756235-21756257 CTGGGGTAGGGGTGGGGAAGGGG - Intergenic
1052989317 9:34509666-34509688 CTGAGCTAGGGCAGGGGCAGTGG + Intronic
1053103708 9:35392636-35392658 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
1053110482 9:35455550-35455572 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1053111278 9:35461743-35461765 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1053648460 9:40139313-40139335 CTCTGATAGGTGAGGGACAGTGG - Intergenic
1053757280 9:41324529-41324551 CTCTGATAGGTGAGGGACAGTGG + Intergenic
1053891091 9:42693701-42693723 CAGAGACAGGGGAGGGGAATCGG + Intergenic
1054220607 9:62408062-62408084 CAGAGACAGGGGAGGGGAATCGG - Intergenic
1054230107 9:62501110-62501132 CAGAGACAGGGGAGGGGAATCGG + Intergenic
1054329441 9:63737256-63737278 CTCTGATAGGTGAGGGACAGTGG - Intergenic
1054536121 9:66236857-66236879 CTCTGATAGGTGAGGGACAGTGG + Intergenic
1054789400 9:69241436-69241458 CTCTGATACTGGAGAGGAAGGGG + Intronic
1054901143 9:70370745-70370767 TTGTCAGAGGGGAGGGGAGGGGG + Intergenic
1055710875 9:79060686-79060708 CTTTCATAGGGGAGAGAAAGGGG + Intergenic
1055987232 9:82063811-82063833 CAGTGAGAGGGGAGGGGCAGTGG + Intergenic
1056062875 9:82902235-82902257 CTATTATATGGGAGTGGAAGTGG + Intergenic
1056377385 9:86028061-86028083 CGGTGATATGGGAGGGGGACAGG + Intronic
1056414233 9:86360856-86360878 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1056530059 9:87478953-87478975 GTGTGAGAGAGGAGGTGAAGGGG + Intergenic
1056592239 9:87973264-87973286 CTGTGATAGGGTACCGGGAGGGG - Intronic
1056642222 9:88381320-88381342 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1056655597 9:88506136-88506158 CTGTGATAGGCCAGGGGTGGTGG + Intergenic
1056656150 9:88510905-88510927 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1056958463 9:91101418-91101440 CTCTGGAAGGGGAGGGCAAGGGG + Intergenic
1056965135 9:91159234-91159256 CTATAAAAGGGAAGGGGAAGGGG + Intergenic
1056978638 9:91285304-91285326 CTGTCATGGGGTGGGGGAAGGGG + Intronic
1057456810 9:95220712-95220734 CTGTCATGGGGTAGGGGGAGAGG + Intronic
1058235813 9:102487837-102487859 CTGTGGTGGGGTGGGGGAAGGGG + Intergenic
1058809651 9:108627153-108627175 CAGGGAGAGGGCAGGGGAAGGGG - Intergenic
1059023911 9:110604295-110604317 CTGGGGTGGGGGAAGGGAAGAGG - Intergenic
1059335648 9:113566931-113566953 ATGTGCTAGGGCTGGGGAAGAGG - Intronic
1059357596 9:113711896-113711918 CTTTGATGGGGGTGGGGCAGTGG + Intergenic
1060818645 9:126649162-126649184 CTGGGATAGGGGAGGTGAAGGGG - Intronic
1060870953 9:127039768-127039790 CAGTGAAATGGGAGGGAAAGGGG + Intronic
1061159160 9:128883178-128883200 CTGAGGTAGGGCAGGGGAAGAGG - Intronic
1061482753 9:130905199-130905221 CTGTGGCAGGGATGGGGAAGGGG - Intronic
1061909129 9:133713544-133713566 CTGTGCTGGGCGGGGGGAAGTGG - Intronic
1061920175 9:133778361-133778383 CTGAGGTAGGGGTGGGGAGGAGG + Intronic
1202796226 9_KI270719v1_random:122611-122633 CTCTGATAGGTGAGGGACAGTGG - Intergenic
1185798422 X:2986834-2986856 CTGTGGTGGGGTAGGGGGAGGGG - Intergenic
1185925515 X:4141674-4141696 CTGAGAAGGGGAAGGGGAAGGGG - Intergenic
1186047440 X:5551917-5551939 CAGTGATATGGGAGGGGAGCAGG + Intergenic
1186516874 X:10173099-10173121 GTCTGAGAGGGGAGGGGAAGAGG - Intronic
1186862160 X:13683307-13683329 CTGTTGTAGGGTGGGGGAAGGGG + Intergenic
1187157876 X:16738031-16738053 CAGTGTTTAGGGAGGGGAAGAGG + Intronic
1187596422 X:20777547-20777569 CGGTCATGGGGTAGGGGAAGGGG + Intergenic
1187715699 X:22100346-22100368 TTTTCTTAGGGGAGGGGAAGGGG + Intronic
1188210673 X:27419683-27419705 CTGTGATAGTGGTGGCCAAGGGG + Intergenic
1188537944 X:31218357-31218379 CTGGGATGGGGCAGGGGCAGGGG + Intronic
1189034824 X:37484684-37484706 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1189335372 X:40168007-40168029 CTCTGGTGGGGGAGGGGAAAGGG - Intronic
1189369762 X:40418375-40418397 CTGGGGTGGGGGCGGGGAAGGGG + Intergenic
1189587462 X:42475094-42475116 TTTTCATAGGGGAAGGGAAGTGG + Intergenic
1189833599 X:44999299-44999321 CTTGGACAAGGGAGGGGAAGGGG + Intronic
1189955571 X:46273968-46273990 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1190037243 X:47036953-47036975 CTGTGGTGGGGTAGGGGGAGGGG + Intronic
1190298023 X:49039963-49039985 CTGAGAGAGGGGAGGGGAGGGGG - Intronic
1190771840 X:53521278-53521300 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1190910171 X:54764406-54764428 CTGTGGTGGGGAGGGGGAAGGGG - Intronic
1191086113 X:56569033-56569055 GTGTGGGAGGGGAGGGGCAGGGG + Intergenic
1191674868 X:63784027-63784049 CTTTCATTGTGGAGGGGAAGAGG - Intronic
1191676365 X:63795964-63795986 CTGTGAGACAGGAGAGGAAGAGG - Intergenic
1191720309 X:64223500-64223522 CTGAGCTAGAGGATGGGAAGAGG - Intergenic
1191727489 X:64296727-64296749 CTGTGTTGGGGGCGGGGGAGGGG - Intronic
1191734051 X:64370035-64370057 CTGAGATGGGGGAGTGGAATGGG + Intronic
1191828405 X:65390250-65390272 CTGTCATAGGGTAGGGGGAGGGG + Intronic
1191839500 X:65501594-65501616 CTGTGATGGGAGAGAGAAAGTGG - Intronic
1192338361 X:70240389-70240411 ATGTGGTAGGGGAGGGCATGAGG + Exonic
1192668387 X:73112005-73112027 CTGTGGTGGGGTCGGGGAAGGGG + Intergenic
1192693275 X:73386845-73386867 CTGTGGTGGGGTCGGGGAAGGGG + Intergenic
1192740825 X:73891132-73891154 CTGTGGTGGGGTGGGGGAAGGGG + Intergenic
1193146017 X:78076512-78076534 CTGTCATGGGGTAGGGGGAGTGG - Intronic
1193326789 X:80187691-80187713 CTGTTGTGGGGTAGGGGAAGGGG - Intergenic
1193539736 X:82756657-82756679 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1193844020 X:86446441-86446463 CTGTGATGGGGTCGGGGGAGGGG - Intronic
1194231062 X:91324140-91324162 CTGTCATGGGGTGGGGGAAGTGG + Intergenic
1195113909 X:101676707-101676729 CTCAGGTAGTGGAGGGGAAGTGG + Intergenic
1195299493 X:103513293-103513315 CTGCCACAGGGGAGGGAAAGGGG + Intronic
1195855663 X:109329962-109329984 CTGTCATGGGGTTGGGGAAGGGG - Intergenic
1196376568 X:115039757-115039779 CAGTGATACGGGAGGGGGACAGG + Intergenic
1196632949 X:117964734-117964756 CTGTTATGGGGTGGGGGAAGGGG - Intronic
1196799783 X:119532266-119532288 GTGTGAGAAGTGAGGGGAAGAGG - Intergenic
1197096559 X:122603824-122603846 GTGTGGTGGGGGAGGGGGAGGGG - Intergenic
1197130935 X:123004945-123004967 CTGTTTTAGGGTAGGGGTAGTGG - Intergenic
1197243906 X:124148570-124148592 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1197268807 X:124404010-124404032 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1197644112 X:128999055-128999077 CCGTGCTATGGGAGGAGAAGAGG + Intergenic
1198273872 X:135082692-135082714 CTGTCATAGGGTGGGGGGAGGGG - Intergenic
1198508445 X:137324996-137325018 CTGTGATGGTGAAGAGGAAGCGG - Intergenic
1198742687 X:139857677-139857699 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1198809891 X:140524577-140524599 ATGGGAGAGGGGAGGGGAAGGGG + Intergenic
1198988557 X:142483704-142483726 CTGTGGTGGGGTCGGGGAAGAGG + Intergenic
1199637204 X:149825381-149825403 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1199638548 X:149836960-149836982 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1199825138 X:151491058-151491080 ATGTGTTGGGGGCGGGGAAGTGG + Intergenic
1199895131 X:152119978-152120000 ATGTGGTAGGGGATGGGAATAGG + Intergenic
1201594362 Y:15651299-15651321 CTGTCATAGGGTGGGGGCAGCGG - Intergenic
1202253488 Y:22896544-22896566 CTGTCATAGAGTAGGGGGAGAGG - Intergenic
1202406478 Y:24530293-24530315 CTGTCATAGAGTAGGGGGAGAGG - Intergenic
1202464304 Y:25139788-25139810 CTGTCATAGAGTAGGGGGAGAGG + Intergenic