ID: 932400488

View in Genome Browser
Species Human (GRCh38)
Location 2:71477527-71477549
Sequence ACCTGCTTACAGAAGGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932400488 Original CRISPR ACCTGCTTACAGAAGGCTGA TGG Intronic
900989520 1:6091923-6091945 CCCTGGTTTCAGAAGGCTGCCGG - Intronic
901954483 1:12774446-12774468 ACATGCTTGCAGAAGACTAAAGG - Intergenic
902513713 1:16979277-16979299 CCCTCCCTACAGAAGGCTGACGG - Intronic
902702244 1:18180391-18180413 ACCTCCTCACTGAAGGCTGAGGG - Intronic
903291409 1:22316495-22316517 AAATGCATACAGAAGGCTGGTGG - Intergenic
905293493 1:36939461-36939483 AACTGCATGCAGAAGGCAGACGG + Intronic
907954841 1:59218262-59218284 TCCAGCTTACAGATGGCAGATGG - Intergenic
908595416 1:65684091-65684113 TCCTGAGTACAGCAGGCTGATGG + Intergenic
910516324 1:88064865-88064887 ACATGCTTAGAGAGGGCTCAGGG - Intergenic
914909832 1:151775979-151776001 ACCTGTTTACAGAGAGCAGATGG - Intronic
916656582 1:166881979-166882001 ACGTGGTTACAGAAGTCTGAAGG - Intergenic
918743256 1:188164184-188164206 AACAGCCAACAGAAGGCTGAAGG - Intergenic
920125299 1:203689491-203689513 GCCTTCTTTCAAAAGGCTGAAGG + Intronic
920232082 1:204477480-204477502 AGCTGCCCACAGATGGCTGAGGG + Intronic
920396286 1:205648537-205648559 ATCTGATTACAGCAGCCTGACGG - Intergenic
920544436 1:206803665-206803687 ACATGCTTACAGAAAACTGCTGG + Intronic
920624744 1:207586063-207586085 AGCTTCTTACAGAAGGCTGATGG + Intronic
922933813 1:229409137-229409159 ACCTGCTTAAGGAAGGCGGAGGG + Intergenic
1062838977 10:655068-655090 ACATGCTCACAGTAGACTGAGGG + Intronic
1066051205 10:31637478-31637500 AGGTGCTTACTGAAGGCAGAGGG - Intergenic
1067355189 10:45517558-45517580 GGCTGCTTACAGAAGGCAGAGGG - Intronic
1069228090 10:65969127-65969149 ACCTGCTGACAGAAAGGTGTAGG + Intronic
1069334175 10:67328484-67328506 AGCTGCTTAGAGAAGGGTTAGGG - Intronic
1073205462 10:101767101-101767123 ACCTGCTTCCATTTGGCTGAGGG + Intergenic
1075809434 10:125214294-125214316 ACCAGCTTACAGGGGACTGAAGG - Intergenic
1076947165 10:133659303-133659325 ACCTGCTCACAGATGGCAGGTGG + Intergenic
1079442923 11:20533683-20533705 ACCTGCTCAAAGCTGGCTGAAGG - Intergenic
1082075357 11:47972025-47972047 ACCTGCTTAATGAAGTCTCAGGG + Intergenic
1082772282 11:57217301-57217323 AGCTCCTTACTGAAGGCTGCTGG - Intergenic
1090661148 11:128882493-128882515 ACTTGGTTTCAGAAGGCTGGTGG + Intergenic
1092950525 12:13499197-13499219 GCCTGCTGAGAGAAGGCTGCAGG + Intergenic
1096981836 12:55732578-55732600 ACATGCTCTCAGAAGGCTGCAGG - Intergenic
1097513939 12:60579375-60579397 ACCTACCTCCCGAAGGCTGAGGG + Intergenic
1102155777 12:110726560-110726582 TCCTTCTTACGAAAGGCTGAAGG + Intronic
1103004945 12:117413721-117413743 ACCCTCCTACAGATGGCTGATGG + Intronic
1105601480 13:21892228-21892250 AGCTGCTTCCAGAAGCCTGAAGG - Intergenic
1106786509 13:33113239-33113261 ACCTGCTTTCAGAAGGCTTCTGG + Intronic
1107046054 13:35993459-35993481 ATCTGCTGACAGAAGGCAGGAGG + Intronic
1109132390 13:58603676-58603698 ACCTACCTGCAAAAGGCTGAGGG + Intergenic
1112122193 13:96425107-96425129 ACATGCATATAGAAGGCAGAAGG - Intronic
1113063967 13:106355715-106355737 ATTTGCTATCAGAAGGCTGAAGG + Intergenic
1113659144 13:112092815-112092837 ACCTGCTTTGGGAAGGCTCATGG + Intergenic
1113789186 13:113018502-113018524 TCTTTCTTACTGAAGGCTGAGGG + Intronic
1114726039 14:24938717-24938739 GCCTGCTTCCAGGAGGGTGAGGG - Intronic
1115577301 14:34724145-34724167 AACTGCCTACAAAAGGGTGAGGG + Intergenic
1119006423 14:70934529-70934551 AGCTACTCACAGGAGGCTGAGGG - Intronic
1119721143 14:76891339-76891361 ACCTGCAGACAGAAGGGTGGTGG + Intergenic
1121826450 14:97013675-97013697 AGCTGCTTACAGAAGGAACATGG + Intergenic
1122685051 14:103499957-103499979 ACCTTCTTCCACAAGGCTGCAGG - Intronic
1202921227 14_KI270723v1_random:31858-31880 ACCTGCTCACAGATGGCAGGTGG + Intergenic
1202923682 14_KI270724v1_random:5722-5744 ACCTGCTCACAGATGGCAGGTGG - Intergenic
1125294413 15:38186811-38186833 GCATGCTTTCAGAAGGCTGCTGG - Intergenic
1125745371 15:41994011-41994033 ACTTGCTTCCAGCAGGTTGAGGG - Intronic
1127570429 15:60236128-60236150 ACCTGCTGACAGCAGTCTGCTGG - Intergenic
1128596690 15:68958188-68958210 ACCAGCGGACAGAAGGCAGAAGG - Intronic
1130329011 15:82905208-82905230 AACTGCTTTCGGAAGGCTCAGGG + Intronic
1135224879 16:20647058-20647080 ACCTTCTAACAGAAGGCAGAGGG - Intronic
1140202220 16:72903931-72903953 AGCTGCTTCCAGTGGGCTGAAGG - Intronic
1140950902 16:79816404-79816426 ACCTTCTTACTGACAGCTGAAGG - Intergenic
1141855192 16:86676556-86676578 TCCTTCTTGCAGAAGGCTGCTGG - Intergenic
1141954280 16:87359847-87359869 GCCTGCTCACAGAATGCTAAAGG + Intronic
1142336443 16:89492166-89492188 GGCTGCCTAGAGAAGGCTGAAGG - Intronic
1142398210 16:89845064-89845086 CCCTACTTGCAGAAGGATGATGG - Intronic
1146202879 17:30875433-30875455 ACCTGCTTAAAGAAAGAAGAGGG - Intronic
1146337917 17:31991122-31991144 GCCTGTTTAAAGAAGGCAGAAGG + Intronic
1203171077 17_GL000205v2_random:148304-148326 ACCTGCTCACAGATGGCAGGCGG + Intergenic
1153199556 18:2634543-2634565 ACCCTCTTACAGAATGTTGATGG - Intergenic
1156031990 18:32723420-32723442 ATTTGCTTTCAGAAGACTGAGGG + Intronic
1156537892 18:37881211-37881233 AGGTGCTTACTGAAGGCAGAGGG + Intergenic
1157585722 18:48799990-48800012 GCCTACTTAGAGAAGGCAGAGGG + Intronic
1160074135 18:75655762-75655784 TCCTGATTAGAGAAGGCTTATGG - Intergenic
1161345827 19:3768343-3768365 ACCAGATTAGAGGAGGCTGAGGG + Intronic
1161353718 19:3807405-3807427 ACCTGCTGAGAGAGGCCTGAGGG - Intronic
1164472241 19:28546065-28546087 ACCTGCTTTCAGGCGGCTGCAGG + Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
925745084 2:7037085-7037107 ACTTGATCACAGAAGGCAGAGGG - Intronic
926690695 2:15731319-15731341 AGCAGGTAACAGAAGGCTGATGG - Intronic
927679917 2:25132470-25132492 ACCTGCCTACTCCAGGCTGAAGG - Intronic
929417726 2:41760874-41760896 ACTTCCTTACAGAATGCTGAAGG + Intergenic
931077617 2:58734187-58734209 ACCTGTTAAAAGAAGGCTGCAGG + Intergenic
932093619 2:68827935-68827957 GCCTGCTTGCAGAAGATTGAGGG + Intergenic
932400488 2:71477527-71477549 ACCTGCTTACAGAAGGCTGATGG + Intronic
935284870 2:101555728-101555750 AACTGTTTCCAGAAGGCTGGAGG - Intergenic
935738837 2:106128640-106128662 TCTTGCTTGCAGAAGGCAGACGG + Intronic
936067816 2:109345263-109345285 ACCAGTCTAGAGAAGGCTGATGG + Intronic
937646815 2:124274852-124274874 AGCTGCTTAAAGAAGTCAGATGG - Intronic
942513871 2:176730919-176730941 ACCTCTCTACAGAAGGCTGATGG - Intergenic
942670893 2:178375723-178375745 ACCTGACTAAAGAAGGATGAAGG - Intronic
947170774 2:227309056-227309078 ACCTGCTTATATAAGGCTCAAGG - Exonic
947628013 2:231633206-231633228 AGAAGCTCACAGAAGGCTGAGGG + Intergenic
947787558 2:232837243-232837265 GCCTGCTGACTGATGGCTGAGGG + Intronic
947859465 2:233348472-233348494 ACCCACTCACAGAAGGCAGAGGG + Intergenic
947994728 2:234517454-234517476 ACATGCTTACAGACAGGTGAAGG + Intergenic
1171109811 20:22470487-22470509 ACCTGCTTACAGGTGGTTAAGGG + Intergenic
1173378260 20:42510483-42510505 ACCTGCTCACAGCAAGATGAAGG + Intronic
1173511874 20:43636001-43636023 ACCTACTCACCGCAGGCTGAAGG - Exonic
1176327061 21:5510135-5510157 ACCTGCTCACAGATGGCAGGCGG + Intergenic
1176400696 21:6310816-6310838 ACCTGCTCACAGATGGCAGGCGG - Intergenic
1176436461 21:6678288-6678310 ACCTGCTCACAGATGGCAGGCGG + Intergenic
1176460723 21:7005358-7005380 ACCTGCTCACAGATGGCAGGCGG + Intergenic
1176484284 21:7387136-7387158 ACCTGCTCACAGATGGCAGGCGG + Intergenic
1182300319 22:29333429-29333451 ACCAGCTCTCAGAAGGCTGGTGG - Intronic
951647164 3:24905650-24905672 ACCTGCTTAAAGAAGCCTGGAGG + Intergenic
955095107 3:55789365-55789387 TGCTGCTTAAACAAGGCTGATGG - Intronic
956505868 3:69939017-69939039 ACCTGTTCACACAAAGCTGATGG - Intronic
956526606 3:70170026-70170048 AACTGCTTCCAGAGGGCTAAAGG - Intergenic
956747339 3:72320314-72320336 AGCTGCTCACAAAAGGTTGAGGG - Intergenic
957080292 3:75631113-75631135 ACCTGCTCACAGATGGCAGGTGG - Intergenic
957839685 3:85652263-85652285 CCCTGCTTCTAGAAGGCTCATGG - Intronic
960183645 3:114612365-114612387 ACCTGCTCACAGAGAGCTTATGG - Intronic
960966744 3:123110849-123110871 TCCTGCATACAGCAGGGTGAAGG - Intronic
962251318 3:133837854-133837876 ACCAGCTTCCAGGAGGCTGAGGG - Intronic
962983250 3:140509486-140509508 TCCTGCTGAAAGAAGCCTGATGG + Intronic
963226357 3:142866424-142866446 ACCAGCTTGCAGAAAGCAGATGG + Intronic
968596171 4:1486832-1486854 ACCTGAGTAGAGAAGGCTGGAGG - Intergenic
970160162 4:13180194-13180216 ACCTGCTTTCAGAACTGTGAGGG - Intergenic
971311458 4:25529086-25529108 CCGTGCTTACAGCAGGATGAAGG - Intergenic
974097374 4:57378966-57378988 TGCTGCTTACTGAATGCTGAGGG + Intergenic
974350533 4:60738878-60738900 TCCTGCATGCAGAAGGCAGATGG - Intergenic
975692126 4:76975810-76975832 TCCTCCTTAGAGAAGACTGAAGG - Intronic
978746621 4:112202020-112202042 AACTGCTTACAAAAGGCAGGTGG + Intergenic
979814595 4:125084825-125084847 ACCTCCTTTCAGAAGACTTAAGG - Intergenic
980639414 4:135556092-135556114 TCCAGCTTACAGATGGCAGATGG + Intergenic
980977817 4:139627894-139627916 TCCTGCTTGCAGAAGCCTGTGGG - Intergenic
982605486 4:157511521-157511543 ACCTGAGTACAGAAGGCAGGAGG + Intergenic
983577715 4:169276397-169276419 ACCTGTTTCAAGAAGGCTGGAGG - Intergenic
983815460 4:172120966-172120988 ACCTAAACACAGAAGGCTGAAGG - Intronic
984210899 4:176846511-176846533 TCCAGCTTACAGAACTCTGAAGG - Intergenic
985450625 4:190060102-190060124 ACCTGCTCACAGATGGCAGGTGG + Intergenic
993826178 5:92689991-92690013 AACTGCTTACTCAAGGCTCAAGG - Intergenic
994098645 5:95870726-95870748 TCCCTTTTACAGAAGGCTGATGG + Intergenic
999953532 5:156675871-156675893 TCCTTCTTACAAATGGCTGAAGG - Intronic
1000854753 5:166384199-166384221 TCCTTCTTACAGAATTCTGAAGG + Intergenic
1001691192 5:173633767-173633789 ACCTGCCTGAAGCAGGCTGATGG - Intergenic
1006020734 6:31116261-31116283 ACTTGCTGCCACAAGGCTGAAGG + Exonic
1008544641 6:52574442-52574464 ACCTTCTTACTGGAGGCTTAGGG + Intronic
1011004984 6:82634272-82634294 TCCTGAATACAGCAGGCTGATGG - Intergenic
1012084050 6:94800198-94800220 TCCAGCTTCCAGAAGGCAGATGG - Intergenic
1013410913 6:109882274-109882296 AGTTGCTTACAGAAGGTTTAAGG + Intergenic
1015646875 6:135401393-135401415 ACTTGCTTAAAGAATGCTAATGG + Intronic
1015661651 6:135581926-135581948 CCATGCCTACAGAAGGCTGAAGG - Intergenic
1016998513 6:149977996-149978018 ACCTGCTTGCAGAAAGAAGAAGG + Intergenic
1017107060 6:150897723-150897745 ACCTGCTGCCAGTGGGCTGAAGG - Intronic
1019373756 7:677399-677421 GCCTGATAACAGCAGGCTGAGGG - Intronic
1023515376 7:40996499-40996521 CTCTGCCTACTGAAGGCTGAAGG + Intergenic
1024286114 7:47758972-47758994 ACCTACATACAGAAAGGTGAAGG + Intronic
1024556335 7:50606090-50606112 ACCTACTTACACAACCCTGAGGG + Intronic
1028346997 7:89795396-89795418 AGCTGCTTGCAGTAGTCTGAGGG + Intergenic
1030222878 7:107115942-107115964 ACTTCCTTACTGAAGGCTGCAGG - Intronic
1030807749 7:113937479-113937501 AGCTGCTTAGAGAAGTCTTAGGG - Intronic
1030924259 7:115431685-115431707 GCCTGTTTACAGAAGGCATATGG - Intergenic
1031478461 7:122250499-122250521 ACCAGCTTGCAGCATGCTGAGGG - Intergenic
1031568617 7:123330392-123330414 ACCTGCAGACAGAGGGCTGGGGG - Intergenic
1032944024 7:136829162-136829184 ACTTGCTCACAGAAGGGGGAAGG - Intergenic
1033348371 7:140542449-140542471 GCCAGCTCACAGAAGGCTGCAGG - Intronic
1035718651 8:1773578-1773600 AGCTGCGTACAGGATGCTGATGG - Intronic
1036928481 8:12930529-12930551 CCCTGCTTAAGAAAGGCTGAGGG + Intergenic
1039037042 8:33371258-33371280 ACCTCCTTATAGAAGCCAGAAGG - Exonic
1042862481 8:73328331-73328353 ACCTGCTAGCAGAGGGCTGGAGG - Intergenic
1047444967 8:124911573-124911595 ACTTGCTTACAAAAGGTTTAAGG - Intergenic
1049029386 8:140023170-140023192 ACCTGCTTCCCGAAGGCTGCTGG + Intronic
1049609858 8:143549870-143549892 ATCTGTTTACTGAAGTCTGATGG - Intergenic
1054709923 9:68501004-68501026 ACCTTCTAAGAGTAGGCTGATGG - Intronic
1054824932 9:69564143-69564165 ACAGGCTTACAGATGACTGATGG + Intronic
1054852832 9:69866295-69866317 TCCAGCTTACAGAAGGCAGATGG - Intronic
1056543094 9:87591243-87591265 ACATGCTTTCAGAAGCCTAAGGG - Intronic
1057961598 9:99462728-99462750 TGCTGCTTACAGAAGGCAAAGGG + Intergenic
1059416697 9:114166957-114166979 ATCTGCTATCAGAAGGGTGATGG - Intronic
1203435054 Un_GL000195v1:130371-130393 ACCTGCTCACAGATGGCAGGCGG - Intergenic
1189850698 X:45173681-45173703 AGCTACTTAGAGAAGGCTGAGGG - Intronic
1192935197 X:75851317-75851339 AGCTGCTTAGAGAAGGGTTAGGG - Intergenic
1194850668 X:98864834-98864856 TCCTGCTGACAGAGGGATGATGG - Intergenic
1195824250 X:108980484-108980506 ACCAGCTTACTGTAGGCTAAAGG + Intergenic
1196545092 X:116953789-116953811 ACCTGCTTCCAGATTCCTGAAGG + Intergenic
1197897554 X:131331409-131331431 CCCTGCTTGCAGAAGGTTGTTGG - Intronic
1199712280 X:150477798-150477820 ACCTGCTTGCAGCAGGCTCAGGG + Intronic
1199744978 X:150766816-150766838 TTCTGCAAACAGAAGGCTGAGGG + Exonic
1199782084 X:151070861-151070883 AGCAGGTTACAGAAGGGTGAAGG + Intergenic
1200840235 Y:7774339-7774361 ACCTACTTACAGACTACTGAGGG + Intergenic
1201987033 Y:19979895-19979917 AAATGTTTACAGAAGGCTGAGGG + Intergenic
1202200995 Y:22347720-22347742 TCCAGAATACAGAAGGCTGAGGG + Intronic