ID: 932402223

View in Genome Browser
Species Human (GRCh38)
Location 2:71488958-71488980
Sequence GAGGAGCAGCTGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2097
Summary {0: 1, 1: 1, 2: 9, 3: 177, 4: 1909}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932402223_932402228 0 Left 932402223 2:71488958-71488980 CCTTCCTCCTTCAGCTGCTCCTC 0: 1
1: 1
2: 9
3: 177
4: 1909
Right 932402228 2:71488981-71489003 CTCCCACCCCCACATTGAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 216
932402223_932402236 28 Left 932402223 2:71488958-71488980 CCTTCCTCCTTCAGCTGCTCCTC 0: 1
1: 1
2: 9
3: 177
4: 1909
Right 932402236 2:71489009-71489031 CTGCCCCAGTGGAATAAGCGTGG 0: 1
1: 0
2: 1
3: 10
4: 95
932402223_932402235 17 Left 932402223 2:71488958-71488980 CCTTCCTCCTTCAGCTGCTCCTC 0: 1
1: 1
2: 9
3: 177
4: 1909
Right 932402235 2:71488998-71489020 AGCTGGATGATCTGCCCCAGTGG 0: 1
1: 0
2: 0
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932402223 Original CRISPR GAGGAGCAGCTGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr