ID: 932403722

View in Genome Browser
Species Human (GRCh38)
Location 2:71500029-71500051
Sequence CCTGATGAGCAGAGGGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 233}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932403716_932403722 8 Left 932403716 2:71499998-71500020 CCTGGTTGGTGCCGACTGAGAGT 0: 1
1: 0
2: 0
3: 6
4: 51
Right 932403722 2:71500029-71500051 CCTGATGAGCAGAGGGCACCTGG 0: 1
1: 0
2: 2
3: 23
4: 233
932403709_932403722 30 Left 932403709 2:71499976-71499998 CCTGTCTGCCACTTGCCAGGCCC 0: 1
1: 0
2: 3
3: 37
4: 308
Right 932403722 2:71500029-71500051 CCTGATGAGCAGAGGGCACCTGG 0: 1
1: 0
2: 2
3: 23
4: 233
932403714_932403722 10 Left 932403714 2:71499996-71500018 CCCCTGGTTGGTGCCGACTGAGA 0: 1
1: 0
2: 0
3: 6
4: 64
Right 932403722 2:71500029-71500051 CCTGATGAGCAGAGGGCACCTGG 0: 1
1: 0
2: 2
3: 23
4: 233
932403713_932403722 15 Left 932403713 2:71499991-71500013 CCAGGCCCCTGGTTGGTGCCGAC 0: 1
1: 0
2: 0
3: 5
4: 143
Right 932403722 2:71500029-71500051 CCTGATGAGCAGAGGGCACCTGG 0: 1
1: 0
2: 2
3: 23
4: 233
932403711_932403722 22 Left 932403711 2:71499984-71500006 CCACTTGCCAGGCCCCTGGTTGG 0: 1
1: 0
2: 2
3: 22
4: 250
Right 932403722 2:71500029-71500051 CCTGATGAGCAGAGGGCACCTGG 0: 1
1: 0
2: 2
3: 23
4: 233
932403717_932403722 -3 Left 932403717 2:71500009-71500031 CCGACTGAGAGTGCAGCATCCCT 0: 1
1: 0
2: 0
3: 11
4: 123
Right 932403722 2:71500029-71500051 CCTGATGAGCAGAGGGCACCTGG 0: 1
1: 0
2: 2
3: 23
4: 233
932403715_932403722 9 Left 932403715 2:71499997-71500019 CCCTGGTTGGTGCCGACTGAGAG 0: 1
1: 0
2: 1
3: 5
4: 79
Right 932403722 2:71500029-71500051 CCTGATGAGCAGAGGGCACCTGG 0: 1
1: 0
2: 2
3: 23
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932403722 Original CRISPR CCTGATGAGCAGAGGGCACC TGG Intronic
900351064 1:2234884-2234906 CCTCCTGAGCAGTGGTCACCAGG + Intronic
900541326 1:3204477-3204499 CTGGAAGAGCAGAGGCCACCAGG + Intronic
900546735 1:3233595-3233617 CCTGCTGGGCAGAGAGGACCAGG - Intronic
900633289 1:3649912-3649934 CCTGGTGAGCGGCGGGGACCTGG - Exonic
900765740 1:4504032-4504054 CCTCATGAGAAGAGGAGACCAGG + Intergenic
901012046 1:6207533-6207555 GGTGAGGAGCAGAGGGTACCCGG + Intronic
901218198 1:7566529-7566551 GTTGATGAGCAGAGAGAACCTGG + Intronic
902330355 1:15728272-15728294 CCGGATGAGCACCGGGCACATGG + Exonic
903261965 1:22136379-22136401 CCTGCTGGGCTGAGGGAACCTGG + Intronic
903622417 1:24707571-24707593 CCTGGTGGGCAGAGGGAGCCAGG + Intergenic
903754044 1:25648194-25648216 CCTGATGAGCAGATGCTTCCAGG - Intronic
904935767 1:34128566-34128588 CTTGCTGAGCACAGAGCACCAGG + Intronic
906104976 1:43286189-43286211 CTTGAAGAACAGGGGGCACCAGG - Intergenic
906606538 1:47176382-47176404 CTTGATGAGCTGAGGGCAGGTGG + Intergenic
912899188 1:113629976-113629998 CCTGCTGATCATAGGGCTCCAGG - Intronic
913126718 1:115797589-115797611 CCTGATGAACCGAAGGCAACTGG - Intergenic
913164634 1:116173620-116173642 CCAGATGAGCAGAGGTCCCCAGG + Intergenic
917798359 1:178548320-178548342 CCTGGTGGGCAGAGGTTACCTGG + Intronic
920092683 1:203465485-203465507 CAGGATGATCTGAGGGCACCAGG - Intergenic
922606857 1:226894917-226894939 CCAGGTGAGCACAGGGAACCAGG - Intronic
922813061 1:228428912-228428934 CCCGATGAGCAGAGGGCAGCAGG - Intergenic
924412272 1:243819037-243819059 CCTCATGAGCCGATGCCACCAGG + Intronic
1062805431 10:416232-416254 CCTGTTGAGAAGAGGGGGCCTGG - Intronic
1062983451 10:1744791-1744813 CCCGATCTGCAGAAGGCACCGGG + Intergenic
1064033787 10:11899653-11899675 CCAGATGAGCACAGGGCATGTGG - Intergenic
1064844337 10:19634245-19634267 CCAGATGAGCAGAAGACACTGGG + Intronic
1067042231 10:42961112-42961134 CCAGAGGAGCAGACGGGACCAGG + Intergenic
1069784840 10:70981351-70981373 CCCGATGCGGAGAGTGCACCAGG + Intergenic
1071491205 10:86137753-86137775 CCTGATTAGCAGAGAGCATCAGG + Intronic
1073510779 10:104041163-104041185 CCTCCTGAGCAGAGGGTTCCTGG - Intronic
1073811309 10:107155390-107155412 CCTGATGGGGAGAAGGGACCAGG - Intronic
1074847465 10:117410838-117410860 GGACATGAGCAGAGGGCACCTGG + Intergenic
1075646683 10:124101404-124101426 CCTGACGTGCACATGGCACCTGG - Intergenic
1076133875 10:128031371-128031393 CCCACTGAGAAGAGGGCACCCGG - Intronic
1076164261 10:128269015-128269037 CCTGCTGAGCAGTGGACACCGGG - Intergenic
1076378230 10:130006774-130006796 TCTGAAGAGCCCAGGGCACCAGG - Intergenic
1076380398 10:130021247-130021269 CCTAATCAGCAGAGGCCAGCCGG - Intergenic
1076441247 10:130482744-130482766 GATGATGAGCTCAGGGCACCAGG + Intergenic
1076722588 10:132399169-132399191 CCTGATGAGAAACTGGCACCTGG - Intronic
1077216347 11:1396731-1396753 CCTGCTGGGCAGCCGGCACCAGG + Intronic
1077787847 11:5403837-5403859 CCTAATGAGGAAAAGGCACCTGG + Intronic
1077908038 11:6548818-6548840 CCTGCTGAGCAGAGGAATCCAGG + Exonic
1078134057 11:8637779-8637801 ACTGGAGAGCTGAGGGCACCAGG + Intronic
1078526022 11:12102136-12102158 CCAGATCAGCACAGGTCACCAGG - Intronic
1080589290 11:33707579-33707601 CCAGATGAGTGGAGGGCACAGGG + Intronic
1081693802 11:45095389-45095411 CATGATGAGCAGATAGCAGCGGG - Intergenic
1083305674 11:61761011-61761033 CCTGGGGTGCAGAGGACACCAGG - Intronic
1084045094 11:66563792-66563814 CAGGGTGAGCAGAGGGCACTGGG - Exonic
1084967843 11:72753634-72753656 CTTGGGCAGCAGAGGGCACCTGG + Intronic
1085865225 11:80282832-80282854 CCTTATCAACAGAGGGCAGCAGG - Intergenic
1089361142 11:117887555-117887577 CCTCATGGGAAGAAGGCACCAGG - Intergenic
1089400480 11:118161434-118161456 ACTGAGCAGCAGAAGGCACCAGG - Intergenic
1089659796 11:119978474-119978496 CCTGAAGGGCAGGGGGCTCCAGG - Intergenic
1089760136 11:120717139-120717161 CGCGATGAGCACAGGGCACCTGG - Intronic
1091138575 11:133215971-133215993 ACTGATGAATAGAGGCCACCAGG + Intronic
1092446894 12:8566536-8566558 CCTGAAGAGAAAAGGGCACCTGG + Intergenic
1095858391 12:46887206-46887228 GCTGAAGTGCAGAGGGCACAAGG + Intergenic
1097020865 12:56020153-56020175 CCTGATGAGGGAAGGTCACCTGG - Intronic
1097264505 12:57737806-57737828 GCTGCTGAGCAGGGGGCGCCGGG + Exonic
1097268206 12:57758022-57758044 CCTGAAGAGCAGGGTGCTCCAGG - Intronic
1101738439 12:107481398-107481420 CCTGGTGCTCAGAGGGAACCAGG - Intronic
1102575026 12:113850759-113850781 CCTGAGGAGCAGAAGGGGCCAGG - Intronic
1102872251 12:116423135-116423157 CCTGATGACCAGAGGCACCCCGG - Intergenic
1103012580 12:117468551-117468573 CCTGAAGAGCAGATGTCCCCGGG - Intronic
1103922402 12:124405745-124405767 CCTGAGGAGCTGGGGGGACCCGG + Intronic
1103997256 12:124838394-124838416 TCTGTTGTGAAGAGGGCACCCGG + Intronic
1104051143 12:125194671-125194693 CCTGGCGAGCAGAGGGGGCCAGG + Intronic
1104274303 12:127310561-127310583 ACTGATGAGCACAGGTCTCCTGG - Intergenic
1104927835 12:132322728-132322750 CCTGGTGAGCCCAGGGGACCGGG + Intronic
1104974999 12:132548349-132548371 CCTGGGCAGCAGAGGGCAGCTGG + Intronic
1107965851 13:45597618-45597640 CCTGGTGAGCTGAGGGCAGATGG - Intronic
1110743941 13:79030947-79030969 GCTGATGGGCACAGTGCACCTGG - Intergenic
1113313688 13:109157016-109157038 CCTGAAGAGCAGGGTGCATCTGG - Intronic
1116258419 14:42587994-42588016 CCAGAAGAGCAGCAGGCACCAGG - Intergenic
1116441639 14:44961634-44961656 CCTGATAAGCAGATGGCAAGAGG + Intronic
1119080123 14:71685046-71685068 CCTGAGGAGGAAAGGCCACCAGG - Intronic
1119423983 14:74524216-74524238 CCTGCTGAGCAGAGGCCAGAAGG + Intronic
1121492976 14:94372949-94372971 CCAGATCAGCAGTGGGCACAGGG + Intergenic
1121996532 14:98607435-98607457 CCTGCTGAGATGCGGGCACCAGG - Intergenic
1122200557 14:100120094-100120116 TCTGGTCAGCAGAGGGTACCTGG + Intronic
1122341587 14:101031886-101031908 CCTGATGCGCACCGGGCAACCGG - Intergenic
1124138791 15:27059114-27059136 CCTGAATGGCAGAGGGCACCAGG - Intronic
1124640272 15:31392490-31392512 CCTGAGGAGCGCAGGGGACCCGG - Intronic
1126188653 15:45855784-45855806 CCTGAAGAGCCCAGGGAACCTGG - Intergenic
1126760527 15:51966054-51966076 GATGATGAGGAGAGGGCACAAGG - Exonic
1127728007 15:61769849-61769871 CCTGATGTGCAGAGGGATTCAGG - Intergenic
1129687570 15:77695461-77695483 TCTGAGGGGCAGATGGCACCAGG - Intronic
1129710554 15:77818598-77818620 CCTGAGGAGCAGAAGGCGCGGGG + Intronic
1129920646 15:79316535-79316557 CCTGATGAGGTGAGGGCTGCAGG + Intronic
1130056354 15:80529327-80529349 TCTGATGAGCTGAAAGCACCTGG + Intronic
1131072114 15:89472559-89472581 CCTGAGGTGCAGTGGGCACATGG - Intronic
1132374809 15:101322058-101322080 CCTGATGAACAGGGAGAACCAGG + Intronic
1132864254 16:2085807-2085829 GCTTCTGAGCAGAGGGCACATGG + Intronic
1136385239 16:29921377-29921399 CGTGAGGTGCAGAGGGAACCTGG + Intronic
1136591095 16:31218199-31218221 ACTGCTGAGCAGAGGGGATCAGG + Intronic
1136609827 16:31359538-31359560 CCTGATGAGGAGAGGACCCAGGG + Intronic
1136983875 16:35082455-35082477 CCTGATCAGGGGAGGGCTCCTGG + Intergenic
1138542878 16:57699065-57699087 GCTGGAGAGCAGAGGGCACAGGG + Intronic
1140562905 16:76004688-76004710 CTTGGTGAGCTGAGGGCACAAGG + Intergenic
1141534352 16:84668811-84668833 TGTGATGAGCAGAGGCCACGTGG + Intergenic
1141840608 16:86571921-86571943 CCTGAGGACCAGAAGGCAACAGG - Intergenic
1141850227 16:86640115-86640137 CCTGGTGGGCCAAGGGCACCTGG + Intergenic
1142188520 16:88706286-88706308 GCTGCTGAGCCGAGGCCACCAGG + Exonic
1143757982 17:9080339-9080361 CCTGAAGTGTAGAGGGCTCCAGG - Intronic
1143771955 17:9174625-9174647 CCTTATTAGAAGAGGGCATCGGG - Intronic
1144655194 17:17030782-17030804 CCTTAGGAGCAGAGGGGCCCTGG - Intergenic
1146935170 17:36808619-36808641 CCTGAGGAGCTGGGGGCACCAGG - Intergenic
1146946288 17:36875965-36875987 CAGGAGGAGCAGAGGTCACCAGG + Intergenic
1148621499 17:49038229-49038251 CCCGATGAGCAGATAGCACAGGG + Exonic
1151916164 17:77119679-77119701 ACTGATAAGGAGAGGGCCCCAGG + Intronic
1152318785 17:79596379-79596401 CCTGCTGATCAGAGAGCCCCAGG - Intergenic
1152559950 17:81072958-81072980 CCTGATGAGAAAATGGCATCTGG + Intronic
1153789192 18:8562379-8562401 CTTAATTAGCAGAGGGCACTGGG - Intergenic
1155018140 18:21866567-21866589 CCTGGTGAGGAGGGAGCACCTGG + Exonic
1156497918 18:37538048-37538070 CGTGGCCAGCAGAGGGCACCAGG - Intronic
1157423439 18:47564921-47564943 CCTGATGGGCAGAGGACAGAGGG + Intergenic
1157680737 18:49603387-49603409 CCTGTTGTGCAGTGGGGACCTGG + Intergenic
1160422456 18:78756220-78756242 ACTGATGACCACTGGGCACCAGG - Intergenic
1160773637 19:844569-844591 CCGGAGGAGGCGAGGGCACCTGG - Intronic
1163087387 19:14992119-14992141 CCTGAAAAGCAGAAGGCACTGGG - Intronic
1163127624 19:15252815-15252837 CCTGGGAAGCAGAGGGCACCAGG + Intronic
1164906483 19:31972572-31972594 CCAGATGAACACAGGGCACACGG + Intergenic
1165138686 19:33686542-33686564 CCTGATGAACAAAGGGGACTCGG - Intronic
1167321400 19:48799220-48799242 CCTGCTGAGCTGAGGCCACTGGG + Intronic
1168058055 19:53874459-53874481 CCAGGTGGGCAGAGTGCACCAGG - Exonic
925202114 2:1976201-1976223 CCTGATGGGAATAGGACACCAGG - Intronic
926070926 2:9890105-9890127 CTTGATGAGCAGAGGAGACAGGG - Intronic
927197383 2:20557963-20557985 TCTGCAAAGCAGAGGGCACCAGG + Intergenic
927441480 2:23121567-23121589 ACTGAAGAGCAGAGGGCAAGGGG - Intergenic
927577628 2:24212653-24212675 TCTGATGAGCAGTGGGTAGCGGG + Exonic
928113928 2:28532173-28532195 CCTGTTGAGCAGAGGGGCACAGG - Exonic
930112874 2:47694190-47694212 CCTGATAAGCAGAAGGAGCCAGG + Intergenic
931259060 2:60600739-60600761 GCTGCTGAGCAGAGGCCTCCTGG - Intergenic
931773036 2:65515914-65515936 GCTTATGACCAGAGGGCAACGGG - Intergenic
931855523 2:66298722-66298744 CGAGATGAGCAGAGGGCTGCAGG + Intergenic
932285031 2:70524802-70524824 CCAGCTGAGCAGAGGGCACCTGG + Intronic
932403722 2:71500029-71500051 CCTGATGAGCAGAGGGCACCTGG + Intronic
933092427 2:78137775-78137797 CCTGAGGAGCACAGAGCAGCAGG - Intergenic
934166080 2:89295724-89295746 TCTGATGAGTAGAGGACACCAGG + Intergenic
934201196 2:89886732-89886754 TCTGATGAGTAGAGGACACCAGG - Intergenic
934604918 2:95687340-95687362 CCTGAAGAGCAGAGACCACCAGG - Intergenic
935205128 2:100890509-100890531 CCTGATGACCTGAGGGTACAGGG - Intronic
935217821 2:100988710-100988732 CTGGAGGAGCAGGGGGCACCTGG - Intronic
936074943 2:109395775-109395797 CCTGATGAGAATAGGGAGCCTGG + Intronic
936292760 2:111239116-111239138 TCTGTTTAGAAGAGGGCACCTGG - Intergenic
936538371 2:113329879-113329901 CCTGAAGAGCAGAGACCACCAGG - Intergenic
936834143 2:116686477-116686499 AATGATGAGCACAGGGCACGAGG + Intergenic
937042739 2:118834520-118834542 CCTGCTGAGAGGAGGGCACTTGG + Intergenic
938291514 2:130153233-130153255 CCTTGTGAGCAGAGGCCATCAGG - Intronic
938465033 2:131519730-131519752 CCTCGTGAGCAGAGGCCATCAGG + Intergenic
938570567 2:132558541-132558563 CCTAATGAGCTGGGGGCACCGGG + Intronic
943013543 2:182481772-182481794 CCTGCAGAGCAGATGGCACATGG + Intronic
943179946 2:184529049-184529071 CCTGTTGAGAAAAGGGTACCTGG + Intergenic
943769874 2:191704977-191704999 CCTACTGAGCAGTGGCCACCAGG - Intergenic
946585334 2:221180074-221180096 CCTTATGAGAAGAGGGAATCTGG + Intergenic
948482652 2:238259899-238259921 CCACATGAGAAGAGGGAACCTGG - Intronic
949034155 2:241808911-241808933 CCTGATGCTCAGAGGGTAACTGG - Intronic
1169257622 20:4111021-4111043 CCTGACAAGCAGCTGGCACCTGG - Intergenic
1169802132 20:9521231-9521253 GCTGCTGAGCAGATGTCACCTGG - Intronic
1170268619 20:14499053-14499075 CCTGCTGAGCACAGGCCAGCTGG - Intronic
1171173568 20:23035343-23035365 GCTGAAGAGCTGCGGGCACCGGG - Intergenic
1172841242 20:37903630-37903652 CCTGCAGAGAAGGGGGCACCCGG + Intronic
1173079142 20:39849555-39849577 CCTGAAGAGCAGATGTCCCCAGG - Intergenic
1174508738 20:51034938-51034960 CCTGGTGTGCAGAGGGCTGCTGG - Intergenic
1175420124 20:58826564-58826586 CTGGATTAGCAGAGGGGACCTGG + Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1176107819 20:63397867-63397889 ACGGAGGAGCAGAGGGCAGCTGG - Intergenic
1178501327 21:33127962-33127984 CCTGCTGATGAGAGGGCACAGGG + Intergenic
1179563349 21:42231143-42231165 CCTGGTGAGAAGAGGGAAGCTGG - Intronic
1179889974 21:44330535-44330557 CCTGCTGGGCTGAGGGCAACAGG - Exonic
1180180948 21:46118485-46118507 CCTGATGTCCACGGGGCACCTGG - Intronic
1180583669 22:16866420-16866442 TCTGATGATCAGATGGCAACTGG + Intergenic
1180692039 22:17725020-17725042 CCTGATAAGCAGTAGGCACACGG + Intronic
1180786017 22:18548281-18548303 CCTGGGGAGCACAGGGCCCCTGG - Intergenic
1181131299 22:20734006-20734028 CCTGGGGAGCACAGGGCCCCTGG - Intronic
1181242940 22:21487835-21487857 CCTGGGGAGCACAGGGCCCCTGG - Intergenic
1181328508 22:22070229-22070251 CATGAGGAGCAGAGGGGTCCAGG - Intergenic
1181433930 22:22899502-22899524 CCTCATGAGCAGATGCCACCAGG + Intergenic
1181434868 22:22904871-22904893 CCTCATGAGCAGATGCCACCAGG + Intergenic
1181436481 22:22914156-22914178 CCTCATGAGCAGATGCCACCAGG + Intergenic
1182030384 22:27154887-27154909 TCTTATCAGCAGAAGGCACCTGG + Intergenic
1183045904 22:35219884-35219906 TCTGATTAGCAGATGGCATCGGG - Intergenic
1183323803 22:37180683-37180705 CATGAGGGGCAGAGAGCACCTGG + Exonic
1184031842 22:41899829-41899851 CCTGAAAAGCAGAGGGACCCAGG - Intronic
1184718483 22:46295719-46295741 CCAGCTCAGCACAGGGCACCAGG - Exonic
1185228672 22:49668009-49668031 CCTGCTGAGCTGGGGGCCCCAGG - Intergenic
953238970 3:41131390-41131412 CCTGATGAGCAGAGAAGCCCTGG + Intergenic
953383931 3:42493998-42494020 CCTGGTGAGGTGAGGGGACCTGG - Intronic
957239863 3:77644745-77644767 CCTGATGAGCTGTGGCCACCTGG - Exonic
960945425 3:122963090-122963112 CGAGATGAGCAGACAGCACCAGG + Intronic
961393494 3:126570403-126570425 CCTGGCCTGCAGAGGGCACCGGG + Intergenic
961646933 3:128397717-128397739 CTTGATGAGTAGAGGCCAGCTGG - Intronic
962445309 3:135458458-135458480 CCTGAGGAGCAGAGGAAACATGG - Intergenic
962773087 3:138631291-138631313 CCTCCTGAGCAGCGGGGACCAGG - Intronic
967135584 3:186510190-186510212 CCTGATAAGCTGAGGGGTCCTGG + Intergenic
968228029 3:196988192-196988214 CCTGCTCAGCAGAGGACAACAGG - Intergenic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
969165642 4:5308602-5308624 CCTAATTAGAAGAAGGCACCTGG - Intronic
972278493 4:37581575-37581597 CCACATTAGCATAGGGCACCAGG - Intronic
973629842 4:52810253-52810275 ACTGATGGGGAGAGGGCTCCAGG + Intergenic
974554123 4:63421260-63421282 CTTGATCAGCAGAGGGGACTGGG - Intergenic
976315286 4:83653423-83653445 CCAGAAGAGCAGATGGCACAGGG - Intergenic
980132844 4:128832858-128832880 CCTGTTCAGAAGAGGGGACCAGG + Intronic
984933278 4:184867255-184867277 CCTTATGAGAGGAGGGCAACAGG + Intergenic
985636566 5:1038562-1038584 GCAGAAGAGCAGAGGGCGCCTGG - Exonic
986660034 5:10051595-10051617 CCTGATGAGCACAGTGAGCCTGG + Intergenic
987306049 5:16638893-16638915 CAAGAAGAGCAGAGGACACCAGG + Intergenic
993202149 5:84830305-84830327 CCTGAGGAGCACGGGGCACGTGG - Intergenic
998138150 5:139685150-139685172 CCTGGCCAGCAGGGGGCACCGGG + Intergenic
998446814 5:142205006-142205028 CCAGGTGAGATGAGGGCACCAGG + Intergenic
1002402509 5:178999037-178999059 CCTCATGAGCAGAGGACAAGAGG - Intergenic
1005699292 6:28383744-28383766 ACTGATGAGCAGTGGCCAGCAGG - Intronic
1005994482 6:30922998-30923020 CGGGGTGAGCAGAGGGCAGCGGG + Intronic
1005995882 6:30931250-30931272 CCTGTTGAGCAGAGGGTTCCAGG - Intergenic
1005996060 6:30932137-30932159 CCTGTTAAGGAGAGGCCACCGGG - Exonic
1006712111 6:36083356-36083378 CCTCATGAGCACATGCCACCAGG + Intronic
1011125126 6:83999051-83999073 TCTGATGAGCAGAGGGCTTGAGG + Intergenic
1012423195 6:99086988-99087010 CCTGCTGAGCAAATGACACCAGG - Intergenic
1016779679 6:147943953-147943975 CCTGATGGACCAAGGGCACCAGG + Intergenic
1018910167 6:168097176-168097198 CCTGCTGAGCCCAGAGCACCTGG + Intergenic
1019177267 6:170166519-170166541 CCTGCGGGGCAGCGGGCACCCGG - Intergenic
1021075135 7:16294045-16294067 TCTGATGAGTAGAGAACACCAGG - Intronic
1021897593 7:25251597-25251619 TCTGATGAGGTGAGGACACCAGG - Intergenic
1024241276 7:47438485-47438507 CCTGAGGAGGAGAGGGCCCCTGG + Intronic
1026571514 7:71535328-71535350 CCTGATGAGAAGGTGGCACTGGG + Intronic
1026639545 7:72112084-72112106 CCTGATTCTCAGAGGGCACTAGG - Intronic
1027948383 7:84780418-84780440 CCTGCTGATGTGAGGGCACCTGG - Intergenic
1029089313 7:98035662-98035684 CCTTATGAGCTGAGGGGGCCTGG + Intergenic
1030553450 7:110993897-110993919 TCAGATGGGCAGAGGGGACCTGG - Intronic
1034551148 7:151821494-151821516 ACTGCTGAGCAGAAGGCCCCGGG + Intronic
1034897707 7:154888023-154888045 CCTGATGTGCACAGGACTCCTGG + Intronic
1035694488 8:1584712-1584734 CCTGATGGGCAGAGACCCCCAGG - Intronic
1037460584 8:19104463-19104485 GCTGATGAGCACTGGGCACGGGG - Intergenic
1039081758 8:33740434-33740456 CCTGATGAGCAAAGAGGACCTGG - Intergenic
1042061265 8:64820729-64820751 CCTCATGTGCAGAGAGCTCCTGG - Intergenic
1046048142 8:108987480-108987502 GCTGATGAGCATAGGGCAACAGG - Intergenic
1047489363 8:125362007-125362029 ACTGCTGAGCAAAGGGAACCGGG - Intronic
1047541260 8:125768668-125768690 GCTTTTGATCAGAGGGCACCAGG + Intergenic
1049414816 8:142490415-142490437 CCTAGTGAGCAGGGGTCACCGGG - Intronic
1049421683 8:142519415-142519437 GCTGGAGAGCAGAGGGCACAGGG - Intronic
1049540851 8:143208138-143208160 CCTGATGTGCAGAGGCTGCCAGG + Intergenic
1049575204 8:143386618-143386640 CCTGAGGAGAAGAGGGCATGGGG + Intergenic
1049696798 8:143987993-143988015 CCTGATGCTCAGAGGGCTCCAGG + Intronic
1051629706 9:19129940-19129962 CCTGTGAAGCAGAGGGCCCCAGG + Intronic
1052343577 9:27385993-27386015 CCTGCTGAGCACTGGACACCTGG + Intronic
1053145684 9:35710683-35710705 CCTGAGGAACAGAGGACATCAGG + Exonic
1055645203 9:78356517-78356539 CCTGATGAACTGAGGTCCCCAGG - Intergenic
1056095589 9:83250307-83250329 CCTTATGAGCCCAGGCCACCAGG + Intronic
1058577629 9:106420758-106420780 CCTGATGGGCACAGGGCCACAGG + Intergenic
1060212967 9:121721787-121721809 CCAGATGGGCAGAGGGCAATAGG + Intronic
1060779003 9:126398091-126398113 CCTCATGTGCAGGGAGCACCGGG - Intronic
1060821294 9:126662860-126662882 CCATTTGAGCTGAGGGCACCAGG - Intronic
1061195391 9:129104348-129104370 CCTGGGGAACAGGGGGCACCAGG - Intronic
1187066485 X:15843988-15844010 ACTGAAGAGTAGATGGCACCAGG + Intronic
1190960318 X:55240649-55240671 CCTCATGAGCACATGCCACCAGG + Intronic
1191078924 X:56487981-56488003 CCTCATGAGCCGATGCCACCAGG - Intergenic
1195411027 X:104567672-104567694 CCTGAGCAGCAGTGGGGACCTGG - Intronic
1196747627 X:119085785-119085807 TCTGATTTGCAGATGGCACCAGG - Intronic
1200162516 X:154016782-154016804 ACTGATGAGCAGAGGCCCCCAGG - Intronic