ID: 932409093

View in Genome Browser
Species Human (GRCh38)
Location 2:71534745-71534767
Sequence AGGTGTGAGTTAAGGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932409086_932409093 13 Left 932409086 2:71534709-71534731 CCATAATGGGAGGTATGGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 146
Right 932409093 2:71534745-71534767 AGGTGTGAGTTAAGGGTAGAAGG 0: 1
1: 0
2: 5
3: 21
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932409093 Original CRISPR AGGTGTGAGTTAAGGGTAGA AGG Intronic
901189897 1:7403549-7403571 AGGTGTTAGTGAAGGGGTGAAGG + Intronic
902719165 1:18292658-18292680 CGGTGTGTGTTAAGGGTCAAAGG - Intronic
903611594 1:24618733-24618755 AGGAGTGAGTGAAGGGAAGTGGG + Intergenic
906465420 1:46074350-46074372 GGGTGTGAGATAATGGTGGAAGG - Intronic
906694923 1:47817453-47817475 AGGTGGGAGTTGGAGGTAGAGGG - Intronic
906813098 1:48849567-48849589 AGGTGGGAGTGAGGAGTAGATGG - Intronic
906947189 1:50305051-50305073 GGGTGGGAGTTAAGGTTGGAAGG - Intergenic
908036306 1:60057766-60057788 AAGTCTGAATTAAGGGCAGATGG + Intronic
908880476 1:68725995-68726017 AGATGTGAGCCAAGGATAGAGGG - Intergenic
909459496 1:75893764-75893786 GGGTGTGGGATAAGGGTGGAAGG + Intronic
910308456 1:85795126-85795148 TGGTGTCAGTTAAGGAAAGAAGG + Intronic
911352401 1:96769925-96769947 AGGTGTGAATTAATTGTAAAAGG + Intronic
913132253 1:115851356-115851378 AGGTTTGTGTTCAGGGTAGATGG + Intergenic
914004513 1:143720750-143720772 AGCTGTGTGTTAGGGCTAGAAGG - Intergenic
914422720 1:147543825-147543847 GGGTGTGAGGTAAGGGTACCCGG - Intronic
914513523 1:148354300-148354322 ATGTCTCAGTTTAGGGTAGATGG + Intergenic
914807887 1:151005082-151005104 AAGTGTCATTTAAGGGGAGAAGG - Intronic
915286624 1:154857432-154857454 TGGAGTGGGGTAAGGGTAGAGGG - Intronic
915603511 1:156937094-156937116 GGGTGTGATTTAAGGGTGGCTGG + Intronic
916017625 1:160764237-160764259 GGGTGTGGGGTAATGGTAGAAGG - Intergenic
917772169 1:178291713-178291735 AAGTGTGGGTGAAAGGTAGAAGG - Intronic
919652842 1:200167304-200167326 AGGTGTCTGTTAAGGGAAGAAGG - Intronic
920029844 1:203030275-203030297 AGGTGTGAGGTGAGGCTGGATGG + Intronic
923624818 1:235605552-235605574 AGAGGTCAGTAAAGGGTAGAGGG + Intronic
923833296 1:237581671-237581693 TGGTGTGAATTAAGGTTAGTAGG + Intronic
1064528587 10:16283907-16283929 AGGTGAGAGATAAGGGAAGAGGG + Intergenic
1064545944 10:16450047-16450069 GGGTGTGAGATAATGGTGGATGG - Intronic
1065567142 10:27023525-27023547 ACGTCTGAGTTAAGGGGAAAAGG + Intronic
1069020951 10:63487985-63488007 AGGTGAAAGTTAAGTGTATATGG + Intergenic
1069791158 10:71021986-71022008 GGGTGTGGGATAATGGTAGAAGG - Intergenic
1069876687 10:71567483-71567505 ATGAGTGAGTCAAGGGCAGAAGG + Intronic
1070581307 10:77722090-77722112 ACATCTGAGTTAAGGTTAGAGGG - Intergenic
1070586110 10:77767512-77767534 AGGTGGAAGATAAGGGTACAGGG + Intergenic
1070648133 10:78215631-78215653 AGGTGGGAGGAAAGGGGAGAGGG + Intergenic
1071267380 10:83976235-83976257 GGGTGTGGGATAAGGGTGGAAGG - Intergenic
1071719226 10:88126176-88126198 TGGGGTGAGTTAAGGTTGGAGGG + Intergenic
1073989689 10:109248392-109248414 AGATGTGAGTTAGGGATGGAGGG - Intergenic
1079681695 11:23304959-23304981 AGGTAAGAGTTAAGGGAAAAGGG - Intergenic
1081589300 11:44409765-44409787 GGGTGTGAGTTGAAGGCAGAGGG + Intergenic
1082108402 11:48244927-48244949 AGGAGTTAGTTATGTGTAGAAGG - Intergenic
1082789402 11:57336846-57336868 AGCTATGAGTTCAGGGGAGAAGG - Intergenic
1085710264 11:78823212-78823234 TGCTGTGGGTTAAGGGTGGAGGG - Intronic
1086141649 11:83506344-83506366 AGGTGTGAGATAATGGTGGAAGG - Intronic
1089498720 11:118920725-118920747 AGGTGTCCGTGAGGGGTAGAGGG + Intronic
1090209957 11:124912030-124912052 AGGTGTGGGATGATGGTAGAAGG - Intergenic
1091993092 12:4972747-4972769 AGGTGAGTTTTAAGGGAAGAAGG + Intergenic
1092922839 12:13247651-13247673 GGGTGTGAGATAATGGTGGAAGG - Intergenic
1095487699 12:42701900-42701922 AAGAGGGAGTTAAGGGTACAAGG + Intergenic
1096600102 12:52723065-52723087 AGGTCTGAGCAAAGGGGAGAAGG - Intergenic
1097179509 12:57163153-57163175 AGGAGGGAGTTTAGGGAAGATGG + Intronic
1097355114 12:58592554-58592576 AGATGTCAGTTCAGGGGAGATGG - Intronic
1097821730 12:64134767-64134789 TGGTGTGGGATAATGGTAGATGG - Intronic
1099130682 12:78826559-78826581 AGCTGAGAGTCAAGGGTAGGAGG - Intergenic
1102211537 12:111130931-111130953 AGGTGTGGGATAATGGTGGAAGG - Intronic
1103052310 12:117790869-117790891 AGGTGTGAGGTGAGGGTATTTGG - Intronic
1104762367 12:131305174-131305196 AGGTGTGAGTAGAGGGTCGCTGG - Intergenic
1104817409 12:131655622-131655644 AGGTGTGAGTAGAGGGTCGCTGG + Intergenic
1106086115 13:26543263-26543285 AGGAGAGAGTTAAGCATAGATGG + Intergenic
1106586221 13:31058515-31058537 AGGTGTGGGTTGAGAGTGGAGGG + Intergenic
1108423201 13:50271515-50271537 AGGGGTGAGGTAGGGGGAGAAGG + Intronic
1108490784 13:50979082-50979104 TAGTGTGAGTAAAGGGTAAAAGG - Intergenic
1109158375 13:58940371-58940393 AGGGGTGAGTAAAGAGTAGGGGG - Intergenic
1109272488 13:60269688-60269710 AGGAAAGAGTTAAGGGTAGAAGG + Intergenic
1110935936 13:81289113-81289135 AGGTGTGAGTGAGGAGTTGAAGG + Intergenic
1113934032 13:113984050-113984072 ATGGGTGAGTAATGGGTAGATGG - Intronic
1113934057 13:113984161-113984183 AGGGGTGAGTGATGGGTGGATGG - Intronic
1113934385 13:113986048-113986070 ATGGGTGAGTAATGGGTAGATGG - Intronic
1113934410 13:113986159-113986181 AGGGGTGAGTGATGGGTGGATGG - Intronic
1113934729 13:113988038-113988060 ATGGGTGAGTAATGGGTAGATGG - Intronic
1113934754 13:113988149-113988171 AGGGGTGAGTGATGGGTGGATGG - Intronic
1115111364 14:29827368-29827390 ATGTGGGAGTTATGGTTAGATGG + Intronic
1115755901 14:36525557-36525579 GGGTGTGAGGGAAGGGTGGAGGG + Intergenic
1116389516 14:44376304-44376326 TGAAATGAGTTAAGGGTAGAAGG - Intergenic
1116918029 14:50544227-50544249 AGGTATGAGTTAAGGGTTATGGG + Intronic
1117498510 14:56329447-56329469 AGGTGTGCGTAAAAGGAAGAAGG + Intergenic
1117802704 14:59461731-59461753 AGTTGTGAATAAAGGGCAGAGGG - Exonic
1117861268 14:60094775-60094797 AGGTGGGAGTTAAAGAAAGATGG - Intronic
1117879845 14:60302567-60302589 AGGGGTGAGTTAGGGGGAGGAGG + Intergenic
1119740006 14:77008103-77008125 AGGTGTGGGTGAAGGGCAGCAGG + Intergenic
1119809497 14:77504802-77504824 ATCTATGAGTTAAGGGTTGAAGG + Intergenic
1119866475 14:77979223-77979245 AGCTGAGACTTAATGGTAGATGG + Intergenic
1120039197 14:79733134-79733156 AGGTGGGGGTGAAGGGAAGATGG + Intronic
1120082323 14:80229804-80229826 TGGTATGAGTTAATGGTGGAAGG - Intronic
1120599499 14:86484259-86484281 AGGTATGAGATATGGGTTGAGGG + Intergenic
1121241892 14:92436877-92436899 GGGTGTGGGTAAAGGGGAGAAGG - Intronic
1122531315 14:102429409-102429431 AGAACTGAGTTAAGGGTAAACGG - Intronic
1123828254 15:24105571-24105593 ACTTGTAAGTGAAGGGTAGAAGG - Intergenic
1123842556 15:24263521-24263543 ACTTGTAAGTGAAGGGTAGAAGG - Intergenic
1123852126 15:24369534-24369556 ACTTGTAAGTGAAGGGTAGAAGG - Intergenic
1123857595 15:24429564-24429586 ACTTGTAAGTGAAGGGTAGAAGG - Intergenic
1123862224 15:24480106-24480128 ACTTGTAAGTGAAGGGTAGAAGG - Intergenic
1127320486 15:57840539-57840561 AGGTGTGAGTTGATGATAGATGG - Intergenic
1127866187 15:63035177-63035199 AACTGTGAGCCAAGGGTAGATGG + Intergenic
1128348941 15:66876356-66876378 GGTTGTGTGTTTAGGGTAGAAGG + Intergenic
1128688291 15:69703546-69703568 AGGTGTGAGGGAAGGGAAGGTGG - Intergenic
1128719462 15:69936467-69936489 ATGTGTGTGTGAAGGGTAAAAGG + Intergenic
1129061650 15:72865132-72865154 AGGTTTGTGTTTAGAGTAGAGGG - Intergenic
1129295557 15:74598252-74598274 AGGCGTGGGTGAAGGGGAGAAGG - Intergenic
1130176237 15:81574270-81574292 AGGCCTGAGGTAAGGATAGATGG + Intergenic
1132257579 15:100390039-100390061 AGGTGTGAGGAAAGGGTTTATGG + Intergenic
1134233879 16:12450585-12450607 CGGTGTGAGAGAAGGGAAGACGG + Intronic
1138167839 16:54819445-54819467 AGGTGTGTGTAGTGGGTAGAGGG + Intergenic
1139561932 16:67748663-67748685 AGGTGTTAGAAAAGGGGAGAGGG + Intronic
1139934474 16:70559123-70559145 AGCTGTAAGTAAAGGGTTGACGG - Intronic
1140703362 16:77603107-77603129 AGGAGTGAGGGAAGGGTAGTTGG + Intergenic
1141091879 16:81135993-81136015 TGGTTAGAGATAAGGGTAGAGGG - Intergenic
1141155473 16:81593934-81593956 AGGGGGAAGGTAAGGGTAGAGGG - Intronic
1141323490 16:83034343-83034365 AGCTGTGAGTTAAGGATAGATGG + Intronic
1143331583 17:6140256-6140278 AGGTGAAAGGTAAGGGGAGATGG + Intergenic
1144843903 17:18205954-18205976 AGGTGGGAGCAAAGGGCAGAAGG - Intronic
1147137295 17:38441724-38441746 AGGGTTGAGTCAAGGGAAGAAGG + Intronic
1149239322 17:54630714-54630736 AGGTCTGAGAGAAGGGAAGATGG - Intergenic
1149302427 17:55317683-55317705 AGGTCTGAGCTAAGGGTAGATGG + Intronic
1153403235 18:4704949-4704971 AGGTGAGAGATAAGGACAGAGGG - Intergenic
1155337278 18:24777636-24777658 AGGTGTGGGATAATGGTGGAAGG - Intergenic
1155488252 18:26370700-26370722 GGGTGTAGGTTCAGGGTAGAAGG + Intronic
1156061823 18:33086807-33086829 TGGTGTGTGTGAAGGGGAGAGGG + Intronic
1156192341 18:34733973-34733995 AGGTGTGGGATAATGATAGAAGG - Intronic
1156496454 18:37528962-37528984 AGGAATGAGCTAAGAGTAGATGG - Intronic
1159730659 18:72023135-72023157 ATGTGTGAGTTGGGGGAAGAGGG - Intergenic
1163207485 19:15814281-15814303 GGGTGAGAGTTAAGGCCAGATGG - Intergenic
1164400654 19:27900035-27900057 ATGTGTGAGTGAGTGGTAGATGG - Intergenic
1168313876 19:55475405-55475427 AGGGATGGGTTAAGGGTAGAAGG + Intergenic
925233009 2:2252606-2252628 AGGTGTGTGTTGCTGGTAGATGG + Intronic
927041893 2:19238370-19238392 AGGTGGGAATTAAGGGGTGAGGG + Intergenic
927147642 2:20177477-20177499 AGGTGTGTGTAGAGGATAGATGG + Intergenic
927816955 2:26226638-26226660 TGGTGTGAGGTAAGGATTGAGGG - Intronic
929803898 2:45127946-45127968 AGGTGAGAGTTAAGGGGTAAAGG - Intergenic
930142565 2:47967698-47967720 AGGAGTGAATTTGGGGTAGAAGG - Intergenic
930851511 2:55965936-55965958 AGGTGTGTGTGAAGGGAAGGAGG + Intergenic
930909860 2:56618572-56618594 GGGTGTGGGTTAATGGTGGAAGG + Intergenic
932006263 2:67930182-67930204 ATGTGTGGGTGAAGGGTGGATGG + Intergenic
932018528 2:68058723-68058745 AGATGGGAGTTAAGGCTGGAAGG - Intronic
932409093 2:71534745-71534767 AGGTGTGAGTTAAGGGTAGAAGG + Intronic
933855567 2:86410999-86411021 AGGTGATAATTAAGGGTACAGGG + Intergenic
934715853 2:96542835-96542857 ATGTGTGAGCTGAGGGTAGCAGG + Intronic
934900268 2:98154420-98154442 ATGTGTGCGCTAAGGGAAGAGGG - Intronic
935074888 2:99731499-99731521 AGGTGGGAGGGAAGGATAGATGG - Intronic
936263065 2:110979032-110979054 GGGGGTGAGTGCAGGGTAGAGGG + Intronic
936465124 2:112741334-112741356 AGGTGTGGTGTAAGGGTAGAAGG - Intronic
939334369 2:140806506-140806528 AGGTGTGAGTGAAGGGTGGAGGG + Intronic
939428904 2:142076999-142077021 TGGTGTTAGTGTAGGGTAGACGG - Intronic
941887884 2:170548143-170548165 AGGTTTGAGTAAAGGCTTGAGGG + Intronic
942711649 2:178842971-178842993 GTGTGTGTGTTGAGGGTAGAGGG + Intronic
942798579 2:179850209-179850231 AGGAGTGACTTTAGGGGAGAGGG - Intronic
943218293 2:185068561-185068583 AGGTGAGAGTGAAGGGAAAATGG + Intergenic
944712606 2:202348534-202348556 AGGTCTGAGTTAAGGCTGAAAGG - Intergenic
945248728 2:207745101-207745123 AGGAGTGGGTTAAGGAGAGATGG + Intronic
946024836 2:216665418-216665440 AGGTGTGACATAAGTGTAGCTGG + Intergenic
946353753 2:219172233-219172255 AGGTGGGAGATAAGGGAAGTGGG - Exonic
946498746 2:220222794-220222816 AGGTGTGAGAAAAGGGTAGAAGG - Intergenic
948315431 2:237025095-237025117 AGGTGTGAATGAAGGGTCGAAGG + Intergenic
948810735 2:240476323-240476345 TGGTGTAAGATAAGGGTATATGG - Intergenic
1168800335 20:640625-640647 GGGTGTGTGTGAAGGGTGGAGGG + Intergenic
1168803718 20:660901-660923 AAGTCTGAGTTGAGGGTAGGTGG + Intronic
1170085745 20:12529821-12529843 AGGTGTGTGTGAAGGATGGATGG + Intergenic
1170385232 20:15809264-15809286 AGTTGAGTGTGAAGGGTAGAGGG - Intronic
1170498692 20:16952019-16952041 TGGTGGGAGGTAAGGGTTGAGGG - Intergenic
1171108934 20:22462691-22462713 AGCTGTGTGTTAAAGGTGGATGG - Intergenic
1172062208 20:32194206-32194228 AGGTGGCAGTTAAGGTGAGAAGG + Exonic
1173516259 20:43667334-43667356 AGGGGTGAGTTAAAGGGAGGGGG - Intronic
1173764792 20:45597490-45597512 ACCTATGAGTTAAGGGGAGAGGG - Intergenic
1174571570 20:51505823-51505845 GGGTGTGAGTTAGGGGCAGACGG - Intronic
1174961405 20:55161226-55161248 AGGTGGGGGTTAAGAGTAGGAGG - Intergenic
1181014830 22:20062781-20062803 AGTCATAAGTTAAGGGTAGATGG + Intronic
1181890507 22:26058923-26058945 AGCTGAGATTTAAGGGTGGAAGG + Intergenic
1183890149 22:40920700-40920722 TGGTGTGGGATAATGGTAGAAGG - Intronic
949727720 3:7069510-7069532 AGGTGAGAATTAAGGATGGAGGG + Intronic
949960816 3:9310589-9310611 AGGTGTGATATAAGGTTACAAGG + Intronic
951035802 3:17930621-17930643 GGGTGGGAGGTGAGGGTAGAGGG + Intronic
951571673 3:24070499-24070521 AGGGCTTACTTAAGGGTAGAGGG - Intergenic
952443668 3:33359255-33359277 AGGTGGGAGGTAAAGGAAGAGGG - Intronic
954396560 3:50296354-50296376 AGGTGAGAGGTGAGGGTAGGGGG + Intronic
954543202 3:51409986-51410008 AGTTATGAGATATGGGTAGAAGG - Intronic
955039220 3:55298660-55298682 AGCTGTGGGTTCAGGGTGGACGG - Intergenic
955217390 3:56995918-56995940 AGGTGGGAGTTAATGGTTGATGG - Intronic
959746306 3:109779516-109779538 GGGTGTGAGATAATGGTGGAAGG - Intergenic
959793888 3:110398348-110398370 AGGTGTGAAATAATGGTGGAAGG - Intergenic
959966236 3:112358574-112358596 TAGTGCGAGTCAAGGGTAGAGGG + Intronic
960389789 3:117063671-117063693 AGGAGTGAGATCAGGGTAGCAGG - Intronic
960611244 3:119556660-119556682 AGGTGTGAGAGAGAGGTAGAGGG - Intronic
962202719 3:133414442-133414464 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962202817 3:133414844-133414866 AGGTGTGAGTAGATGGAAGAGGG - Intronic
962202843 3:133414951-133414973 AGGGGTGAGTAGAGGGGAGATGG - Intronic
962203070 3:133415826-133415848 AGGGGTGAGTAGAGGGAAGAGGG - Intronic
962203128 3:133416072-133416094 AGGGGTGAGTAGAGGGAAGATGG - Intronic
962203201 3:133416374-133416396 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962203248 3:133416581-133416603 AGGGGTGAGTATAGGGGAGATGG - Intronic
962203255 3:133416605-133416627 AGGGGTGAGTAGAGGGGAGATGG - Intronic
962203363 3:133417042-133417064 AGGGATGAGTTGAGGGGAGATGG - Intronic
962203375 3:133417090-133417112 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962203478 3:133417468-133417490 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962203510 3:133417585-133417607 AGGAGTGAGTAGAGGGGAGATGG - Intronic
962203624 3:133418083-133418105 AGGGGTGAGTTAAGGCGAGAGGG - Intronic
962203630 3:133418107-133418129 AGGGGTGAGTAGAAGGTAGAGGG - Intronic
963025878 3:140918094-140918116 AGGTGTAAGGCAAGGGTGGAGGG + Intergenic
964297192 3:155246543-155246565 GGGTTTGAGATAATGGTAGAAGG + Intergenic
966067345 3:175833527-175833549 ACGAGTGAGTTAAGGGAAGTAGG - Intergenic
966643260 3:182214366-182214388 TGGTATGAGTTAAAGGTACATGG - Intergenic
969599890 4:8170100-8170122 AGGTCTGGGTTCAGGGTAGGAGG + Intergenic
971186296 4:24380221-24380243 AGGTGGAAATTCAGGGTAGAAGG + Intergenic
971573310 4:28241824-28241846 AGGTGTAAGGGAAGGGGAGAAGG - Intergenic
973540228 4:51928022-51928044 AAGTGTGGGTTAATGGTGGAAGG - Intergenic
974626056 4:64430041-64430063 ATGTTTGAGGTAAGGCTAGATGG + Intergenic
975353604 4:73373232-73373254 GGTTGTGAGGTAAGGGCAGATGG - Intergenic
976367422 4:84246460-84246482 AGGTGGCAGTTAAGGTGAGAAGG - Intergenic
977065158 4:92304871-92304893 AAGTGTGAGGGAAGGGTAGCGGG - Intronic
977175286 4:93812661-93812683 AGGGGTGAGGGAAGGGTTGATGG - Intergenic
979017991 4:115459159-115459181 GGGTGTGAGATAATGGTGGAAGG - Intergenic
979564061 4:122134319-122134341 AGGTGTGAGGTTGGGGTAGTAGG + Intergenic
979909452 4:126343533-126343555 AGGTCAGAGTTAAGGGAAGGAGG - Intergenic
980962824 4:139493255-139493277 CGGTGTGAGTCAAGGGCTGAAGG + Intergenic
984186783 4:176554090-176554112 TGGTGTGTGCTAAGGGTTGAGGG + Intergenic
984844845 4:184100525-184100547 AGGTGAGAAAAAAGGGTAGAGGG + Intronic
984864545 4:184270469-184270491 AGGTGTGTGTTCAGGGAAGGAGG - Intergenic
986037331 5:3952707-3952729 GGGTGTGGGATAATGGTAGAAGG - Intergenic
986806154 5:11310826-11310848 ACGTGTGGGTTAAGGGCACATGG - Intronic
987794025 5:22605468-22605490 AGCTTTGAGTTCAGGGGAGAAGG - Intronic
989120390 5:37998790-37998812 AGGTAGGGGTAAAGGGTAGAGGG + Intergenic
989611930 5:43302305-43302327 ATTTGAGAGTAAAGGGTAGAGGG - Intronic
992018621 5:72600256-72600278 AGGTGTCTGTTAAGGGAAGCAGG - Intergenic
993319552 5:86456328-86456350 GGGTGTGGGATAAGGGTAGAAGG + Intergenic
993398033 5:87414920-87414942 AGGTGTGGGTGGAGGGTAGAAGG - Intergenic
995269840 5:110207731-110207753 GGGTGTGGGATAATGGTAGAAGG - Intergenic
996050810 5:118930895-118930917 AGGTGACAGTTAAAGGTAGAGGG + Intronic
996769860 5:127074224-127074246 AGGTTTGTGCTAAGGGTAGCCGG + Intergenic
996908980 5:128634294-128634316 GGGTGTGGGATAACGGTAGAAGG - Intronic
998298239 5:140992668-140992690 ATGTGTGTGTTAGGGGTTGAGGG + Intronic
998818294 5:146035400-146035422 AGGTGTCACTTCAGGGGAGATGG - Intronic
998887996 5:146714834-146714856 AGGTGTGAGGTCAGGGGAGAGGG - Intronic
1004959379 6:20769134-20769156 GGGTGTGAGTTACGGGAAAAAGG - Intronic
1005403035 6:25454929-25454951 AGGTGTGAGTTATGGAGAGGAGG + Intronic
1006839928 6:37022218-37022240 AGCTGTGGGTTAAGGGGAGTTGG - Exonic
1010323286 6:74538218-74538240 GGGTGTGCGATAAGGGTGGATGG + Intergenic
1012529828 6:100221822-100221844 AGCTGGGGGTTAAGAGTAGAGGG + Intergenic
1012921089 6:105221754-105221776 GGGTGTGAGATAATGGTGGAAGG - Intergenic
1013051249 6:106537795-106537817 AGGTGTGGGATATGGGTAGGAGG - Intronic
1014474937 6:121860408-121860430 AGGTGTGGATAAAGGGTAGCAGG + Intergenic
1015133628 6:129842229-129842251 ATGTGTGTGTTTTGGGTAGAGGG - Intronic
1015467222 6:133560502-133560524 GGGTGTGGGATAAGGATAGAAGG - Intergenic
1016143995 6:140647138-140647160 AAGGTTGAGTTAATGGTAGAAGG + Intergenic
1016871715 6:148824572-148824594 AGGTGTGAGCTACTGGGAGATGG + Intronic
1016996785 6:149966526-149966548 AGGTGTGAGCTAAGGGTGAGGGG + Intronic
1017228112 6:152043356-152043378 GGGTGTGGGCTAATGGTAGAAGG - Intronic
1017715459 6:157207911-157207933 ATGTGTGAGTGAAGATTAGAGGG + Exonic
1018540498 6:164874545-164874567 AGGTGTGGGATAATGGTGGAAGG + Intergenic
1023310214 7:38879071-38879093 AGGGCTGAGTTGGGGGTAGAAGG - Intronic
1024572206 7:50732629-50732651 ATGTGTGAGTTAAATTTAGAGGG - Intronic
1026929679 7:74216947-74216969 AGGTGTGAGTGAAGGGGTGAAGG - Intronic
1029473341 7:100768148-100768170 AGGTAGGAGTTAAGGGAAGACGG + Intronic
1029953598 7:104613602-104613624 AGGGGTGAGTGGAGGGTAGATGG - Intronic
1030626508 7:111851069-111851091 TGGTGTAAGGTAAGGATAGAGGG - Intronic
1031763204 7:125740465-125740487 AGGTTTGAGATAATGATAGATGG - Intergenic
1031957696 7:127958892-127958914 AGATGAGAGTTGAGGGTACAGGG + Intronic
1033266055 7:139888199-139888221 AGGAGTGAGATAAGAGGAGAAGG - Intronic
1033447622 7:141436531-141436553 GGGTGTTGGTGAAGGGTAGAGGG + Intronic
1033566996 7:142588402-142588424 AGCTGTGAGTTGAGAGGAGAAGG - Intergenic
1034405430 7:150899582-150899604 AGGTGGGACTCACGGGTAGATGG - Intergenic
1035776948 8:2195717-2195739 TGCTGTAAGTTAAGGGAAGAAGG - Intergenic
1038584524 8:28777156-28777178 AGGAGTGAGATGAGGGTGGAGGG - Intronic
1038596757 8:28893054-28893076 AATTTTGAGGTAAGGGTAGATGG - Intronic
1043006971 8:74831794-74831816 AGGTGTGAGTTAAGGAAAGAGGG + Intronic
1047541533 8:125771239-125771261 TGGTGTGAGATAAGGGTTTAAGG + Intergenic
1047550240 8:125863665-125863687 AGTTGAGAGTTAAGGGGAGACGG - Intergenic
1049311771 8:141937360-141937382 AGGTGGGAGGGAAGGGAAGAGGG - Intergenic
1050841603 9:10156869-10156891 GGGTGTTAGGTAATGGTAGAAGG - Intronic
1051071949 9:13180469-13180491 AGGTGTGAATAAGGAGTAGAAGG + Intronic
1051181130 9:14412989-14413011 AGGTGTGATTTGAGGGAAGGAGG - Intergenic
1051398980 9:16659120-16659142 AGGTGTGGGTAAATGGCAGATGG + Intronic
1051595310 9:18819044-18819066 AGGTGTGTGTTGAGGGGTGATGG - Intronic
1052203069 9:25805889-25805911 ATGTGTGAGTGACGGGTTGAGGG + Intergenic
1052227317 9:26106106-26106128 GGGTGTGGGATAATGGTAGAAGG + Intronic
1052290871 9:26838986-26839008 ATGTGAGAGTTAAGAGCAGAAGG - Intergenic
1054810932 9:69433302-69433324 GTGTGTGAGGTAAGGGTGGAGGG - Intronic
1054925124 9:70581182-70581204 ACTGGTGAGTTAAGGATAGAGGG - Intronic
1055408997 9:76007557-76007579 GGGTGTGAGAGGAGGGTAGATGG + Intronic
1056236348 9:84598601-84598623 AGTTATCAGTTAAGGGCAGAGGG - Intergenic
1056536558 9:87533038-87533060 AGGTGGGAGTTAAAAGCAGATGG + Intronic
1059057909 9:111003757-111003779 TTGTGGGAGTTAAGGGGAGATGG + Intronic
1059471832 9:114510896-114510918 AGGTGTGAGGTAAGGGTCCCAGG + Intergenic
1060002698 9:119973116-119973138 AGGTGTCTGTTAAGGGCAGAGGG - Intergenic
1060510926 9:124231638-124231660 TGCTGGGAGTGAAGGGTAGATGG - Intergenic
1186708870 X:12171963-12171985 AAGTGTGTGTTAAGGGCTGATGG - Intronic
1188548187 X:31333645-31333667 TGGTGTGAGTTAGGGACAGAAGG - Intronic
1190376424 X:49792903-49792925 AGGTCTGTGTTAAGGGTTTAAGG + Intergenic
1193275659 X:79584312-79584334 AGGCCCTAGTTAAGGGTAGAAGG - Intergenic
1197002011 X:121450780-121450802 AGGTGTGGGATAATGGTGGAAGG + Intergenic
1197084479 X:122455778-122455800 AGGTGTGGGATAATGGTGGAAGG - Intergenic
1197874847 X:131091734-131091756 AGGTGTGAGGCCAGGGTATATGG - Intergenic
1198233753 X:134717182-134717204 ACGTGTGCGTTCTGGGTAGATGG + Intronic
1200521008 Y:4209774-4209796 GGGTGTGGGATAATGGTAGAAGG + Intergenic