ID: 932409299

View in Genome Browser
Species Human (GRCh38)
Location 2:71535677-71535699
Sequence GAGCAGAGCTTCAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 2, 2: 4, 3: 71, 4: 529}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932409291_932409299 19 Left 932409291 2:71535635-71535657 CCAGTGAGGAGAGGCTCACAAAC 0: 1
1: 0
2: 0
3: 17
4: 140
Right 932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG 0: 1
1: 2
2: 4
3: 71
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932409299 Original CRISPR GAGCAGAGCTTCAGGGAGGA TGG Intronic
900310831 1:2032472-2032494 AAGGTGAGCTCCAGGGAGGAGGG - Intergenic
900460452 1:2800123-2800145 GAGCAGAGCTTCAGGTGACAGGG + Intronic
900800821 1:4735940-4735962 GAGCAGAGCTTAGAGGAAGAGGG + Intronic
901121401 1:6897149-6897171 GAGAACAGGTTCAGGTAGGAGGG + Intronic
901411270 1:9085895-9085917 GAGAAAAGCTGAAGGGAGGAAGG + Intronic
901761597 1:11475292-11475314 GAACAGAGCTTCAGGGAGGAAGG + Intergenic
902383654 1:16064460-16064482 GAGCAGAGCCTCTGGGGGGAGGG - Intronic
902733022 1:18382431-18382453 GAGCAGGGCTTTGGGGAAGAAGG - Intergenic
903321109 1:22543679-22543701 GGGCAGAGCTGGTGGGAGGATGG - Intergenic
903427308 1:23263715-23263737 GAGAAGAGAGTCAGGGAGCATGG - Intergenic
903664086 1:24996125-24996147 GAGCAGAGAGACAGAGAGGAGGG - Intergenic
904483127 1:30806514-30806536 GGGCAGGGCTTCAGAGAGGCTGG - Intergenic
904631657 1:31847345-31847367 GAGCAGAGTGGCAGGGAGGAGGG + Intergenic
904745664 1:32709187-32709209 GAGCTGAGGTTCAGGGAGGTTGG - Intergenic
904803736 1:33116713-33116735 AAGCAAAGCTTGAGGGAGCATGG + Intronic
905992314 1:42348908-42348930 GAGCTGCACTTCAGAGAGGAGGG + Intergenic
906155041 1:43609131-43609153 GGGCAGTGCAGCAGGGAGGAAGG - Intronic
906204634 1:43980175-43980197 TGGCAGTGCTTCAGGGAGCAGGG - Intronic
906609677 1:47192703-47192725 GTGAAGACCTCCAGGGAGGAGGG - Intergenic
907009544 1:50950770-50950792 TAGTAGATCTTCAGGAAGGAAGG - Intronic
907112095 1:51935639-51935661 GAACAGAGACTGAGGGAGGAAGG + Intronic
907497556 1:54854931-54854953 GGGCAGAGCTGGAGGGAAGAGGG - Intronic
907563485 1:55412637-55412659 GATCAGATCTTAAGGGAGGAGGG + Intergenic
907798473 1:57740924-57740946 AAGGAGGGCTTCATGGAGGAGGG + Intronic
909332040 1:74425130-74425152 GAGTAGAGCTTCAGGCAGAAGGG + Intronic
910523110 1:88146032-88146054 GAGTAGAGCTTGAGCGAGGCAGG - Intergenic
910721430 1:90290570-90290592 GGGGAGAGCAGCAGGGAGGAGGG + Intergenic
911391833 1:97255194-97255216 GAGCAAAGCTTCAGGGACAAAGG + Intronic
912694205 1:111828693-111828715 GAGCAGAGCTGGTGGCAGGATGG - Intronic
913369675 1:118084056-118084078 GAGCTGAGCTGAAGGGAGAATGG + Intronic
914448918 1:147773575-147773597 GGGGAGGGCTGCAGGGAGGAGGG - Intergenic
915597003 1:156901680-156901702 GAGCTGAGGGTCAGGGAAGAGGG + Intronic
915634909 1:157179285-157179307 GAGCAGCATTTCAGGGTGGAGGG - Intergenic
915713992 1:157926734-157926756 ATGCAGAGCTCCAGGGAGGGAGG + Intergenic
915732803 1:158066198-158066220 GAGCTGAGGGTCAGGGAGGGAGG - Intronic
915754655 1:158248349-158248371 GAGGAGAGCTTCAATGGGGAAGG + Intergenic
916437074 1:164787344-164787366 GGGCAGATCTACAGGGAGGGTGG - Intronic
916455984 1:164971422-164971444 CAGCAGAGCTGCAGGGCAGAAGG + Intergenic
916869221 1:168894214-168894236 GACCAGAGATTCATGGAGAAGGG - Intergenic
917123488 1:171665010-171665032 GAGGAGAGCCTCTGGGAGGCTGG - Intergenic
918465808 1:184820432-184820454 GAGCAGAGGTAGAGGAAGGAAGG - Intronic
919516741 1:198534289-198534311 GAGCAGACACACAGGGAGGAAGG + Intronic
919785994 1:201259166-201259188 GGGCAGAGCTGGAGGGAGGCAGG + Intergenic
919803396 1:201366785-201366807 GAGCAGAGGCTCAGGGAGAGAGG - Intronic
919923129 1:202178038-202178060 GAGCAGGGCTTCTGGGTGAAGGG - Intergenic
919980276 1:202638581-202638603 GATCAGGGCTTCCAGGAGGATGG + Intronic
920049263 1:203153541-203153563 CTGCAGGGCTACAGGGAGGAGGG - Intronic
920224625 1:204429644-204429666 GAGCGGAGCCTCAGAAAGGAAGG - Intronic
920303854 1:205006436-205006458 AAGGGGAGATTCAGGGAGGAGGG + Intronic
921270400 1:213463735-213463757 GGGCAGAGTTTCAGAGAGGAGGG - Intergenic
921449111 1:215282272-215282294 GATCAAAACTTCAGGGTGGAAGG + Intergenic
922507708 1:226136055-226136077 GAGCCGACTTTCAAGGAGGAAGG + Intergenic
922620078 1:226983728-226983750 GAGGAGGGCATCAGCGAGGAAGG - Intronic
922626533 1:227051249-227051271 GAGCTGATCTTAAGGTAGGATGG + Intronic
923010258 1:230082949-230082971 GAGCAGAGCAGCTGGGATGATGG + Intronic
923401339 1:233618109-233618131 GGGCAGAGCTTCAGGGAAGAAGG + Intronic
923419764 1:233800901-233800923 GAGGACAGCTTGAGGGAGAAGGG + Intergenic
923986390 1:239387039-239387061 CAGCAGCGCTTCTGGGAAGACGG + Intronic
924575574 1:245277801-245277823 GAGTAGAACTGCAGGGAGGATGG + Intronic
924929955 1:248721781-248721803 GACCAGAGCTTGAGGGGGGGGGG + Intronic
1062841754 10:678573-678595 GAGCATGGCTGCAGGGAGGACGG - Intronic
1062883122 10:994778-994800 GAGAACAGCTTCAGAGTGGAGGG + Intronic
1063237658 10:4135125-4135147 GAGCAGTGCTTCAGCTAAGAAGG + Intergenic
1063342087 10:5275404-5275426 GAGCAGAGCAGGAGGGAGGTGGG - Intergenic
1063366806 10:5495729-5495751 CAGCAAAGCTTCATGCAGGAGGG + Intergenic
1063923275 10:10952246-10952268 GTGCGGAACTTCAGGGGGGAAGG - Intergenic
1064065823 10:12180720-12180742 GGGAAGAGCCTCAGGGAGGCTGG - Intronic
1067462642 10:46469041-46469063 GGGCAGAGGCTCAGGGAGGTGGG - Intergenic
1067515561 10:46938618-46938640 GGGCAGAGTACCAGGGAGGAGGG - Intronic
1067624553 10:47915596-47915618 GGGCAGAGGCTCAGGGAGGTGGG + Intergenic
1067646690 10:48113197-48113219 GGGCAGAGTACCAGGGAGGAGGG + Intergenic
1068159031 10:53239822-53239844 CTGCAGAGTTTCAGAGAGGAAGG - Intergenic
1069608033 10:69752553-69752575 CAGGAGAGAGTCAGGGAGGATGG + Intergenic
1070051131 10:72891003-72891025 GAGCTGAAGTTCAAGGAGGAGGG - Intergenic
1070373833 10:75810097-75810119 GAGCAGAGTCTCTGGCAGGAAGG + Intronic
1070467434 10:76737753-76737775 GTGCAAAGCTTCAGAGAGGATGG + Intergenic
1070594795 10:77824957-77824979 GAGCAGAGATTCCGGGAGCAGGG - Intronic
1070763145 10:79037938-79037960 GGGCAGAGCACCAGAGAGGAAGG + Intergenic
1071730433 10:88243292-88243314 CAGCAGAGCTTCAGGGAAAATGG - Intergenic
1072738468 10:97895469-97895491 GAGCAGGGAGCCAGGGAGGACGG + Intronic
1073347231 10:102792939-102792961 CAGAACAGCTTCTGGGAGGAAGG - Intronic
1073983280 10:109178799-109178821 GAGTAGGCCTTCTGGGAGGAAGG + Intergenic
1075913179 10:126144019-126144041 GAGCAGAGATGCTCGGAGGATGG - Intronic
1076081920 10:127590092-127590114 GAGCTGAGTCTCAGTGAGGAGGG - Intergenic
1076342886 10:129761711-129761733 GAGCACAGCATCAGGCAGGAGGG + Intronic
1077089775 11:773173-773195 CAGCAGGGGTGCAGGGAGGAAGG - Intronic
1077090984 11:777998-778020 GGGCTGAGCTCCTGGGAGGACGG + Intronic
1077101537 11:824705-824727 GCGCAGAGCTTCGGGCGGGAAGG - Exonic
1077173844 11:1180007-1180029 GAACAGAGCTGCAGGGAGGAAGG - Intronic
1077902545 11:6501038-6501060 AAACAGAGTTTCAAGGAGGAGGG + Intronic
1078203284 11:9204070-9204092 GACCAGAGCAGCATGGAGGATGG - Exonic
1079035067 11:17014007-17014029 GAGGAGGGCTTCACGGAGGAGGG - Exonic
1079167717 11:18061808-18061830 GAGTCAAGCTTCAGGTAGGATGG - Intergenic
1080283884 11:30586380-30586402 GAGCACAGCTCCAGGAAGCAGGG + Intronic
1080924247 11:36739634-36739656 GAGAAGAGCTTCAGGCAAAAAGG - Intergenic
1081962800 11:47150738-47150760 AAGGACAGCTTCAGGGAGGATGG + Intronic
1083296612 11:61718655-61718677 GAGCTCAGCTTCTGGGAGGCAGG - Intronic
1083770385 11:64863862-64863884 CAGCCGGGCTGCAGGGAGGAGGG + Intronic
1084093760 11:66896572-66896594 GAGCAGAGGGGCAAGGAGGATGG + Intronic
1084612532 11:70212676-70212698 GAGCAGAGGCTCAGGGAACAGGG - Intergenic
1084893613 11:72249909-72249931 GAGTGGAGCCTCAGGGAGCAGGG - Intergenic
1087805895 11:102555058-102555080 GATCAGAGAGACAGGGAGGAAGG - Intergenic
1088053747 11:105551105-105551127 GAACAGAGGTTCAGGAAGTAGGG + Intergenic
1089170843 11:116510497-116510519 GAGCAGAGGTTTATGGATGAGGG - Intergenic
1089179223 11:116569461-116569483 CTGGAGAGCTTCAGGGAGCAGGG + Intergenic
1089561533 11:119345739-119345761 GGGCAGATCTTCCGGGAGAAGGG - Intronic
1089602893 11:119626042-119626064 GAGCAGAGGTGCTGGGAGGAAGG - Intronic
1089697523 11:120225321-120225343 GATCAGGGCATCATGGAGGAGGG - Intronic
1089777428 11:120848133-120848155 GAGGAATGCTGCAGGGAGGATGG + Intronic
1090097408 11:123756575-123756597 GATCTAAGCTTCATGGAGGAAGG + Intergenic
1090666577 11:128918617-128918639 GAGCAGAGCCACAGAGAGGTAGG + Exonic
1091078496 11:132643437-132643459 ATGCAGAGCCTCAGGGAGGCTGG + Intronic
1091079805 11:132655627-132655649 GAGCAAAGCTTCAGGCAGCATGG + Intronic
1091326165 11:134689829-134689851 GGGCAGAGCTCCTGGGAGGAAGG - Intergenic
1091382276 12:69650-69672 AAGGAGAGCTGCAGGGATGAGGG - Intronic
1092051632 12:5474940-5474962 GAGCAGGGTTTGGGGGAGGATGG + Intronic
1092891822 12:12975934-12975956 GGGCAGAGCTGCAGTGAGTATGG + Intronic
1094042412 12:26132001-26132023 AAGCAGAGCTTCACCAAGGAAGG - Intronic
1094063653 12:26341108-26341130 TTGCAGAGCTTTGGGGAGGATGG - Intronic
1094524574 12:31223086-31223108 GTGCACAGCTTCGGGGAGGTGGG + Intergenic
1095800644 12:46267965-46267987 GGGCAGAGCACCAGGAAGGACGG + Intronic
1096443667 12:51668615-51668637 GAGCAGTGCTTCTGGGGGAAAGG + Intronic
1098579236 12:72079343-72079365 AAGTAGACCTTCAGTGAGGAGGG - Intronic
1100283524 12:93141077-93141099 GGGCACAGCCTCAGGCAGGATGG + Intergenic
1102554076 12:113714374-113714396 GAGAAAAGGCTCAGGGAGGAAGG + Intergenic
1103507542 12:121452161-121452183 GAGTAGAGCTTCAGTGGGTATGG + Intronic
1103583267 12:121932430-121932452 GAGCAAAGCTGCTGAGAGGAGGG - Intronic
1103970302 12:124666652-124666674 GAGCAGAGAAGCAGGAAGGATGG + Intergenic
1104235970 12:126936917-126936939 GAGGAGAGCTGGAGAGAGGATGG + Intergenic
1104420059 12:128627746-128627768 GAGCAGAGCTGCAGGGCGGGGGG - Intronic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1105037104 12:132933529-132933551 GAGAAGGGCTGCAGCGAGGAAGG - Intronic
1105519177 13:21116242-21116264 GAGCAGGACCACAGGGAGGAAGG - Intergenic
1106032827 13:26018089-26018111 GGGCTGAGCAGCAGGGAGGAGGG - Intronic
1106594894 13:31127524-31127546 GACCATGGCTTCAAGGAGGAAGG - Intergenic
1107654563 13:42578385-42578407 GAGGAGAGGTTCAGGGTGCAAGG - Intronic
1108454133 13:50596412-50596434 GAGCTGAGCCCCTGGGAGGAAGG + Intronic
1108510959 13:51155580-51155602 GAGCAGAGATTGAGAGAGGTGGG - Intergenic
1108520308 13:51241187-51241209 GTTCACTGCTTCAGGGAGGATGG - Intronic
1108605071 13:52029472-52029494 GAGCAGAGCTTCAGAGGGCTCGG + Exonic
1110548156 13:76780091-76780113 GATCAGAGGTTTAGGGAGAAAGG - Intergenic
1110620172 13:77586010-77586032 ATGGAGAGTTTCAGGGAGGAGGG - Intronic
1111947801 13:94683589-94683611 GGGAAGAGTTTCAGGAAGGAGGG + Intergenic
1112563336 13:100532594-100532616 GGGCAGAGCTGCAGGGAGAGGGG + Exonic
1112631086 13:101162018-101162040 GAGCACAACTCCAGGGAGAAGGG - Intronic
1113365155 13:109669034-109669056 GAGAGGAGCCTGAGGGAGGAAGG + Intergenic
1113428698 13:110230840-110230862 GAGCAGAGGTTCCGGGCGGCTGG - Intronic
1114560952 14:23589937-23589959 GAGCAGAGGATGAGGGAAGAAGG + Intergenic
1114657766 14:24326226-24326248 GAGCAGACCCCCAGGGAGGATGG + Intronic
1117197824 14:53359082-53359104 GAGCTGAGCTGCTGGGATGATGG + Intergenic
1117661656 14:58012556-58012578 GGGCAGAGATTAAGGGAGGAAGG + Intronic
1118764677 14:68901870-68901892 AAGCAGAACCTCTGGGAGGAAGG - Intronic
1120669180 14:87344422-87344444 GAGAAGAGTTCCAGGGAGAAAGG - Intergenic
1120752460 14:88210579-88210601 GCGCAGAGCTGGTGGGAGGACGG - Intronic
1121052902 14:90831055-90831077 GAGCAGAGTTTGAGAGAGCAAGG + Intergenic
1121656986 14:95604472-95604494 GATCAGAGCCTCTGGGAGGTCGG + Intergenic
1121874133 14:97435328-97435350 GAGGAGAGACGCAGGGAGGAAGG - Intergenic
1121917465 14:97848866-97848888 AAGGAGACCTGCAGGGAGGAGGG - Intergenic
1122604532 14:102939444-102939466 GAACAGAGCTTCAGCGGAGACGG + Intronic
1122809237 14:104279897-104279919 GAGCTGAGGTTCAGAGAGGTAGG - Intergenic
1122828317 14:104383079-104383101 AAGCAGAGGCTCAGGGAGCAGGG - Intergenic
1123785030 15:23663053-23663075 GAGAGGAGCTACATGGAGGAAGG + Intergenic
1124049366 15:26180685-26180707 GACCAGAGCCCCAGAGAGGAGGG + Intergenic
1124932443 15:34134954-34134976 GAACAGAGCCTCAGGGGGCATGG - Intergenic
1125404264 15:39336444-39336466 GAAGAGGGCTTCATGGAGGAGGG - Intergenic
1125719919 15:41840357-41840379 GAGAGGAGCTTCTGGGTGGAAGG + Intronic
1125724843 15:41862892-41862914 GATCAGGGCTTCCTGGAGGAGGG + Exonic
1127714913 15:61640592-61640614 GAGCAGAGACTGAGTGAGGAAGG + Intergenic
1128144355 15:65324327-65324349 GAGCAGGGTTCCAGTGAGGAAGG - Intergenic
1128210768 15:65900103-65900125 TAGCAGAGCTTCACAGAAGAAGG - Intronic
1128325455 15:66721120-66721142 GAACAGAGGCTCAGGGAGGTTGG + Intronic
1128607912 15:69051061-69051083 AAGGAGAGATGCAGGGAGGAGGG - Intronic
1128718448 15:69927632-69927654 GAGCAGAGAGTCAGAAAGGAGGG + Intergenic
1128752799 15:70161160-70161182 GGGCAGTGCTTCTCGGAGGAGGG + Intergenic
1129112240 15:73344197-73344219 CAGCTGACCCTCAGGGAGGATGG - Intronic
1129946763 15:79545289-79545311 GAGCTGAACCTCAGAGAGGAAGG + Intergenic
1130770119 15:86915853-86915875 GAGCAGAGCTGCAGGAAAGCAGG + Intronic
1131176046 15:90210459-90210481 GAGCAAAGCCTGAGGCAGGAGGG + Intronic
1131177265 15:90217850-90217872 GAGCTGAGCTGCAGGAGGGATGG + Intronic
1131460909 15:92616917-92616939 GAGTAGCTCCTCAGGGAGGAGGG + Intergenic
1131597214 15:93810628-93810650 GAGAAGAACTTCATAGAGGAAGG - Intergenic
1131784229 15:95894219-95894241 GATGAGACATTCAGGGAGGAAGG + Intergenic
1132279807 15:100602827-100602849 GGGCAGAGGTGCAGGGAGGCAGG - Exonic
1132476604 16:142357-142379 GAGCAGGGCTTGAGGCTGGAGGG + Intergenic
1132601765 16:775950-775972 AAGCAGAGCCTCAGGGAGCATGG - Intronic
1132615751 16:840458-840480 AAGCAGAGCTGCAGCAAGGAGGG - Intergenic
1132713102 16:1277989-1278011 GAGGAGAGATGTAGGGAGGAGGG + Intergenic
1132744621 16:1431552-1431574 GGGGAGGGCTTCAGGGAGGGAGG - Intergenic
1133154432 16:3862845-3862867 GAGCAGAACTTCAGAGGGAAAGG - Intronic
1133168031 16:3962596-3962618 GAGCACTGCTTCAGAGAGGAGGG - Intronic
1134995603 16:18736157-18736179 GAGCACAGCATGAAGGAGGATGG - Intergenic
1135424460 16:22325442-22325464 CAGCAGAGCCTCAGGGACGGAGG + Intronic
1135732531 16:24906926-24906948 AGGCAGAACCTCAGGGAGGACGG - Intronic
1136079911 16:27845079-27845101 GAGCAAAGCGTCAGGAAGTAAGG + Intronic
1136620371 16:31424367-31424389 GAGCAGAGCCTCAGAAAGGAGGG + Intronic
1137503243 16:49027614-49027636 GAGCAGAGCTCCAGGAACCAGGG + Intergenic
1137504494 16:49041327-49041349 GAGCAGAAGCCCAGGGAGGAAGG + Intergenic
1137604609 16:49779212-49779234 GAGCAGAGCATCAGGGAGCTGGG + Intronic
1137936517 16:52640084-52640106 GAGATGAGCATCAGGGAGGAAGG + Intergenic
1138552284 16:57754392-57754414 GAGAAGTGCTTCTGGCAGGAAGG + Intronic
1138633691 16:58319631-58319653 TAGAAGAGCTTCCGGGAGCAAGG - Intronic
1138983736 16:62301497-62301519 GAGGAAAGCTTCAGTGTGGAGGG - Intergenic
1139205664 16:65026034-65026056 GAACAAAGCTCCAGGGTGGATGG + Intronic
1140121016 16:72082956-72082978 GAGGAGATCTTCGGGAAGGAAGG - Intronic
1140487092 16:75302081-75302103 AAGCAGAGCATAAAGGAGGATGG + Intronic
1140702830 16:77598316-77598338 GAAGAGAGGTTCAGGGAGGAAGG + Intergenic
1141484711 16:84330943-84330965 GAGCAGCCCTCCAGGGAGTAGGG - Intergenic
1141611339 16:85182707-85182729 GTGCAGGTCTTCAGGGAGGCAGG + Intronic
1141762669 16:86038968-86038990 GAGCAGAGCCTCAAGGCCGAGGG - Intergenic
1141789736 16:86226409-86226431 GAGCAGGGCTTTAGGGAGTTGGG + Intergenic
1141861187 16:86717705-86717727 CAGGAGGGCTTCATGGAGGAGGG + Intergenic
1141904856 16:87017783-87017805 GAGGAGAGCTCCAGGCAGAAGGG - Intergenic
1141950389 16:87335697-87335719 GGGCAGAGCTTTAGGTGGGAGGG + Intronic
1142182287 16:88677102-88677124 GAGCAGGACTCCAGGGAGGGGGG + Intergenic
1142508374 17:380314-380336 GAGAAGGGCTTCCGGGAGGCTGG - Intronic
1142590495 17:1003345-1003367 GGGCAGAGCTGCGGGGAGGTGGG - Exonic
1143415325 17:6743873-6743895 GAACAGAGCTCCCAGGAGGAGGG + Intergenic
1143416705 17:6755976-6755998 GCCCACAGCTTCAGGGAGGGAGG - Exonic
1143667346 17:8371612-8371634 GAGTACAGCTTCATGGATGAGGG + Exonic
1144676616 17:17166224-17166246 GAGCACTGCTGCAGGGAGGCAGG - Intronic
1145270362 17:21401524-21401546 GAGCAGTTCATAAGGGAGGAAGG + Intronic
1145308575 17:21688921-21688943 GAGCAGTTCATAAGGGAGGAAGG + Intergenic
1145850747 17:28093172-28093194 GAGGGGAGTTGCAGGGAGGAGGG + Intronic
1146742429 17:35298354-35298376 GAGAAGAGGATGAGGGAGGAGGG - Intergenic
1147137240 17:38441427-38441449 GGGAAGAGGTTAAGGGAGGAGGG - Intronic
1147236328 17:39060281-39060303 GGCCAGAGGTGCAGGGAGGAAGG - Intergenic
1147917542 17:43897751-43897773 GAGGAGGGCTTCCTGGAGGAAGG - Intronic
1147969486 17:44211951-44211973 GAGCTGAACATCAGTGAGGAGGG - Exonic
1148026372 17:44591713-44591735 GGGTAGAGATTCAGGCAGGAAGG - Intergenic
1149661334 17:58335545-58335567 GGGCAGAGCTTCAGGTCTGATGG + Intergenic
1150217424 17:63478165-63478187 GAGCAGCCCATCAGGGAGGGAGG + Intergenic
1150508790 17:65726412-65726434 CAGCAGAGCTTCATGGAGGAGGG + Intronic
1151235899 17:72719708-72719730 GAGCAGACCTTGGGGGAGGGAGG - Intronic
1151350165 17:73527145-73527167 CAGGGGAGCTCCAGGGAGGAAGG + Intronic
1151512133 17:74567299-74567321 GAGCAGAGCTGAAGGCAGCATGG + Intergenic
1151932539 17:77241603-77241625 CAGCAGAGCTTTTGGCAGGACGG - Intergenic
1151973421 17:77470871-77470893 GAGCAGCTCTTCTGGGAGGTGGG + Intronic
1152222833 17:79078535-79078557 GATCAGAGCTTAAGGGAAGAAGG - Intronic
1152264928 17:79288608-79288630 GGGCAGAGCCTCTGGGATGACGG - Intronic
1152461234 17:80443597-80443619 GAGCAGAGGCGCAGGGAGGAGGG + Intergenic
1152754561 17:82081864-82081886 GGGCAGAGCTGCGGGGAGGTCGG + Intronic
1152987001 18:330257-330279 CAGCTGAGCAGCAGGGAGGAGGG - Intronic
1153473581 18:5472456-5472478 GAGCAGAGATCCATGGAGGAGGG + Intronic
1153677814 18:7470968-7470990 GAGCTGAGCTTGAGGGAGGGAGG - Intergenic
1153924594 18:9824959-9824981 GAGAAGAGCGGCAGGAAGGACGG - Intronic
1154084353 18:11288102-11288124 GAGCCGGGCTTCAGAGACGAGGG + Intergenic
1155117484 18:22783899-22783921 GGACAGAGCCCCAGGGAGGAGGG - Intergenic
1156702739 18:39843763-39843785 TAGCAGAGCGGCAGGGAGCACGG - Intergenic
1156917887 18:42483310-42483332 GAGCAGGGCTCTAGGGAAGAAGG - Intergenic
1157191217 18:45583323-45583345 AGACAAAGCTTCAGGGAGGAAGG - Intronic
1158352144 18:56573774-56573796 GGGCATAGATTCAGGGAGGACGG + Intergenic
1159385427 18:67718817-67718839 GCAAAGAGATTCAGGGAGGAAGG - Intergenic
1160072872 18:75643583-75643605 GAGCAGAGACTGAAGGAGGAGGG - Intergenic
1160345362 18:78127910-78127932 GAGCAGAGGGCCAGGGAGGCAGG - Intergenic
1160462372 18:79048734-79048756 GGGCAGAGCCTCTGGGAGAAAGG + Intergenic
1160535881 18:79591096-79591118 GAGGAGAGCTGCAGGGTGGGGGG - Intergenic
1160673780 19:377929-377951 GAGCAGAGCATCAGGGAGATGGG - Intergenic
1160757479 19:765194-765216 GAGCAGAGACTGAGGGAGGAGGG + Intergenic
1161146610 19:2682679-2682701 AAGAAGAGCTACAGGGAGGCAGG + Intronic
1161458019 19:4379671-4379693 GTGCAGAGGTGCAGGGAGGGCGG - Intronic
1161701970 19:5800622-5800644 GGGCAGAGGTTCTGGGAGGCCGG - Intergenic
1161741975 19:6026894-6026916 CAGCAGAACTTCCTGGAGGAAGG + Intronic
1162011263 19:7816759-7816781 GAGAGGAGTTTCAAGGAGGAGGG - Intergenic
1162029342 19:7910633-7910655 GAGCAGAGCCTCTGGGGGGTGGG + Intronic
1162937315 19:13987603-13987625 TGGCAGAGGGTCAGGGAGGAAGG + Intronic
1163254011 19:16143893-16143915 GGGGAGAGCTTCGTGGAGGAGGG + Intronic
1163298880 19:16430431-16430453 AAGCAGATCTTCAGGGTGGTTGG - Intronic
1163517866 19:17775709-17775731 TAGCAGGGCTTCCTGGAGGAGGG + Intronic
1163641444 19:18464702-18464724 GTGCCGGGCTTCAGGGAGGAGGG - Intronic
1163696823 19:18768454-18768476 GAGGAGAGCGTCAGGCAGGGCGG - Intronic
1163731411 19:18951636-18951658 AAACAGAGGCTCAGGGAGGAAGG - Intergenic
1164441147 19:28281842-28281864 GAGAAGAGTGTCAGGGAAGAAGG - Intergenic
1164476663 19:28580822-28580844 CAGCAGGGGTTCAGGCAGGAGGG + Intergenic
1164530313 19:29043417-29043439 AAGCAGAGCTGCCAGGAGGAGGG + Intergenic
1164799935 19:31067993-31068015 AGACAGGGCTTCAGGGAGGAAGG - Intergenic
1164966597 19:32490062-32490084 GGGCAGAGCACCAGAGAGGAGGG + Intergenic
1165008359 19:32824483-32824505 GAGCACAGCTACAGCTAGGAGGG - Intronic
1165394478 19:35556937-35556959 GAGCACAGCATCAGGGACGGTGG + Exonic
1166328712 19:42066646-42066668 GAGGAGAGTTACAGGGAGGCAGG + Intronic
1166563365 19:43747953-43747975 GAGCAGAGAAGGAGGGAGGAGGG - Intronic
1166842914 19:45709875-45709897 GTGTAGTGCTTCTGGGAGGAAGG + Intergenic
1167464076 19:49640960-49640982 GAGGAGGGTGTCAGGGAGGAAGG + Intergenic
1167521389 19:49958244-49958266 GGGCTGAGGTTCAGGGAGAAAGG - Intronic
1167695108 19:51010516-51010538 GAGGAGAGAGGCAGGGAGGATGG - Intergenic
1167740838 19:51324097-51324119 CAGGAGAGCTACAGGGATGAGGG + Intronic
1168386493 19:55967637-55967659 GAGCAGAGCTACAGCAAGCATGG + Intronic
924982219 2:234692-234714 GAGCACAGCACCAGGGACGATGG + Intronic
925295009 2:2770378-2770400 GTGCAGAGCTGCATGGAGCAGGG - Intergenic
925412975 2:3650617-3650639 GAGCAGAGCATCTGGAAGGGAGG - Intergenic
925826136 2:7850140-7850162 GAGAAGAGATTCAGGGAGCTTGG - Intergenic
925930763 2:8706074-8706096 GAGCAGAGCACCAGTGAGAAAGG - Intergenic
926722830 2:15974645-15974667 GAGCACAGGTGCAGAGAGGAGGG - Intergenic
927148725 2:20183758-20183780 AATCAGAGCTTCAGGAAGGCTGG - Intergenic
928122686 2:28594617-28594639 GAGCAGAGTCCCAGAGAGGATGG + Intronic
928227128 2:29460051-29460073 GAGCAAGGCTCCAGGGTGGATGG - Intronic
928239071 2:29570973-29570995 GAGCAGAGACTCAGGGAGAAAGG + Intronic
928748427 2:34442964-34442986 GAGCACCTCTTCAGGAAGGAGGG - Intergenic
928946395 2:36775721-36775743 GAGCAAAGTTGCAGGGATGATGG - Intronic
929592851 2:43158260-43158282 GAGCAGTGCTGCAGGGGGCAGGG - Intergenic
929689382 2:44061783-44061805 GACCAGAGCGACAGGGAGGTTGG - Intergenic
929850843 2:45589032-45589054 AAACAGAGCTTGAGGGGGGAGGG - Intronic
930308625 2:49709310-49709332 GATCAGAGTTTCAGGAGGGAGGG - Intergenic
930378113 2:50593044-50593066 GAGCAGAGCATCAAGGTGAAGGG - Intronic
930912144 2:56641815-56641837 GGGGAGAGGTTCAGGGAGAATGG + Intergenic
931153623 2:59602919-59602941 GGGCAGGGCTCCAGGGAGGAGGG - Intergenic
932396842 2:71454440-71454462 GACCAGACCTTCAGGGGAGAAGG - Intronic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
932816342 2:74865170-74865192 GAGGAGGGCTGCAGGGAGGAGGG + Intronic
933288982 2:80415386-80415408 AAACAGAGCTTCATGGAGAAAGG - Intronic
934578490 2:95418600-95418622 GTAGAGAGCTTCAGGAAGGAGGG + Intergenic
934600954 2:95658113-95658135 GTAGAGAGCTTCAGGAAGGAGGG - Intergenic
934765885 2:96879787-96879809 GAGCTGGGCTTCAGAGAGGTTGG - Intronic
935070466 2:99689381-99689403 GAGAAGGGCATCAGGCAGGAAGG - Intronic
935660877 2:105465894-105465916 GAGCAGAGCCTCTGGCAGGATGG + Intergenic
935855679 2:107270344-107270366 GAGCAGAGTCTGAGGGAAGAGGG + Intergenic
936007620 2:108905275-108905297 GAGAAGAGCTTCCTGGTGGATGG + Intronic
936236022 2:110743546-110743568 GTTCAGAGACTCAGGGAGGAGGG + Intronic
936267927 2:111024371-111024393 GAGCAGAGACTCATGGAAGAAGG + Intronic
936534326 2:113300262-113300284 GTAGAGAGCTTCAGGAAGGAGGG - Intergenic
937121811 2:119445544-119445566 GAACAGAGCTCTAGGGATGAGGG + Intronic
937428298 2:121817734-121817756 GAGAAGAGTTCCAGGGAGGCAGG + Intergenic
937920105 2:127122730-127122752 GAGGAGAGCTGGAGGGAGGGGGG + Intergenic
938617288 2:133012627-133012649 GAGCAAAACTTCAGGAGGGAAGG - Intronic
938815739 2:134902431-134902453 GAGCAGATCTTCACAGAGGGTGG + Intergenic
939175184 2:138739993-138740015 GAGCAGAGATAGAGGGATGAGGG - Intronic
939534381 2:143408375-143408397 GTCCAGAGTTTCAGTGAGGAAGG - Intronic
940885300 2:158984709-158984731 GGGGAAAGCTTCAGGGAGGAGGG + Intronic
943736726 2:191364685-191364707 GAGCAGAGGGTCAGGGAAAAAGG + Intronic
944083107 2:195812183-195812205 GGGCAGGGCGTTAGGGAGGAGGG - Intronic
944396601 2:199274818-199274840 AAGCAGAGCTCCAGGGATGGGGG + Intronic
944658060 2:201896782-201896804 GTGCAGAAAATCAGGGAGGATGG - Intergenic
944662617 2:201933969-201933991 GAGCTGGGCTTCACAGAGGAAGG - Intergenic
944809315 2:203312310-203312332 GAGCAGAGCTGGGGAGAGGAAGG + Intergenic
944893655 2:204142650-204142672 CAGCAGAGGATCAGGGAGGAGGG - Intergenic
946313332 2:218894922-218894944 GAACAGACCCTCAAGGAGGAGGG + Intronic
946811539 2:223530776-223530798 GAGGAGAGCTGGAGAGAGGATGG - Intergenic
947451067 2:230209475-230209497 AAGGAGAGGATCAGGGAGGAAGG + Intronic
947952733 2:234161942-234161964 GAGCACAGGCTGAGGGAGGAGGG - Intergenic
948050734 2:234977483-234977505 GAGCAGAGCTGCAGGGACAATGG + Intronic
948253131 2:236546599-236546621 GAGTAAAGCTTCAGGCAGGAGGG - Intergenic
948995479 2:241576166-241576188 GAGTAGAGCTGCAGGGAAGGAGG - Intergenic
949059316 2:241947601-241947623 GAGCAGTGGTTCCGGGAGGCTGG + Intergenic
1169472645 20:5901484-5901506 GTCCAGAGCTCCTGGGAGGAGGG - Intergenic
1169930124 20:10823591-10823613 GAGCACAGAGTCAGAGAGGAGGG + Intergenic
1170489737 20:16861049-16861071 TAGCAGAGCTTCAGAGAAGGTGG + Intergenic
1171445744 20:25203427-25203449 GAGCAGAGCCTCAGGGACTTAGG - Intronic
1173223775 20:41149824-41149846 GGGCAGAGCTTCAAGGAGAGAGG + Intronic
1173375069 20:42475747-42475769 GAGGTGAGCTCCAGGGAGAATGG - Intronic
1173793051 20:45840624-45840646 GTGTAGAGCTGCAGGGAGGGTGG - Exonic
1173826553 20:46051552-46051574 GAGCTGAGCTTCAGGAAGATTGG + Intronic
1174079982 20:47963694-47963716 GCACAGAGCTTCAGGGATGCAGG - Intergenic
1174225264 20:48993692-48993714 CAGCTGAGCTTCAGGTAGGAGGG + Intronic
1174863111 20:54111124-54111146 AAGCACAGCCTCAGAGAGGAGGG - Intergenic
1175647869 20:60691113-60691135 AATCAGAGCTTCAGGAAGGAAGG + Intergenic
1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG + Intronic
1175945672 20:62557686-62557708 GAGCAGGGCTGCAGAGAGCACGG - Intronic
1177968056 21:27753710-27753732 GAGAAGAGCAGCAGGGAGGAAGG - Intergenic
1178416662 21:32410742-32410764 GAGCTGAGCCCGAGGGAGGAAGG - Intergenic
1178994320 21:37384200-37384222 GAGCAGAGTTCCAGAGAGGAGGG + Intronic
1179492822 21:41752415-41752437 GAGCACATCTGCAGGGAGGTAGG + Intronic
1179493190 21:41754947-41754969 GAGCAGAGGTGCAGAGTGGACGG - Intronic
1179627198 21:42655390-42655412 GAGGAGAGCTTCAGGAGGGGTGG + Intronic
1179708436 21:43195626-43195648 GAGCAGCGCTTCAGGGAGGAGGG + Intergenic
1180013435 21:45066744-45066766 CAGCAGAGCAGCAGGGAGAAGGG + Intergenic
1180065570 21:45410463-45410485 GGCCAGAGCCACAGGGAGGAAGG + Intronic
1180216332 21:46325368-46325390 GAGCAGAGCTCCCAGGAGGGTGG + Intronic
1180571944 22:16732313-16732335 GAGATGAGAATCAGGGAGGAAGG + Intergenic
1181013406 22:20055055-20055077 GGGCAGCACTTCGGGGAGGAAGG + Intronic
1181042587 22:20199241-20199263 CAGCAGAGCTCCTGGAAGGAAGG + Intergenic
1182083184 22:27543521-27543543 GAGCAGAGAAACAGGGAGGAGGG - Intergenic
1182239781 22:28906507-28906529 AAGCAGAGGTTCAGAGAGGTTGG - Intronic
1182444014 22:30379924-30379946 GAGCAGAATTTCAGGGGGGTGGG - Intronic
1182473976 22:30565858-30565880 CAGCAGTGCTGAAGGGAGGATGG - Intronic
1182602348 22:31475956-31475978 GGGGAGGGGTTCAGGGAGGATGG + Intronic
1182827614 22:33279313-33279335 GAGCATAGCTGCAGGGAGAGAGG + Intronic
1183646903 22:39132299-39132321 GAGCAGAGCTGCGAGGAGGGCGG + Exonic
1184430166 22:44437879-44437901 GGGCAGAGGCTCAGGGAGGTGGG + Intergenic
1184443972 22:44536344-44536366 GAACAGAGCTGCTGGGAAGATGG - Intergenic
1184448860 22:44571031-44571053 TTGCAGGGCTTTAGGGAGGAGGG + Intergenic
1184645064 22:45891083-45891105 GGCCAGAGCTCCTGGGAGGAAGG - Intergenic
1184710465 22:46246611-46246633 GAACTGAGCTTCAGAGAGGCTGG - Intronic
949106296 3:203837-203859 GAGCAGAGCAGGATGGAGGAAGG + Intronic
950463996 3:13142518-13142540 GAGCTGGGCAGCAGGGAGGAAGG - Intergenic
950883137 3:16339288-16339310 GAGCAGAGCATAAGGAGGGAGGG - Intronic
952272139 3:31843501-31843523 AGGCAGAGCCTCAGGGATGAAGG - Intronic
952818196 3:37463707-37463729 GAGCAGGGATACAGGAAGGATGG + Intronic
953167935 3:40482026-40482048 AAGCTGAGTTTCAGAGAGGAAGG - Intronic
953240935 3:41148917-41148939 GAGCAGCCCACCAGGGAGGAAGG + Intergenic
953388542 3:42521064-42521086 TAGCAGAGTCTCAGGGAGAAAGG - Intronic
954326519 3:49867077-49867099 GAGTAGAGCAGCAGAGAGGAGGG - Intronic
955112526 3:55963055-55963077 CAGAAGAGCTTCAGGATGGAAGG + Intronic
955203590 3:56875299-56875321 AATCAGAATTTCAGGGAGGAAGG - Intronic
955778821 3:62462336-62462358 GAGAGGAGCTGGAGGGAGGAGGG - Intronic
956168809 3:66416754-66416776 CAGAGGAGATTCAGGGAGGATGG - Intronic
956176302 3:66476358-66476380 GAGGAGAGGCTAAGGGAGGAAGG - Intronic
956527502 3:70181147-70181169 GAGCAATGCTGCTGGGAGGATGG - Intergenic
957106245 3:75892092-75892114 GAGATGAGAATCAGGGAGGAAGG - Intergenic
958552615 3:95636604-95636626 GACCAGGGCTTGAGGGAGGAGGG - Intergenic
958807059 3:98824007-98824029 GAGCACAGCATGAGGCAGGATGG + Intronic
959167205 3:102795362-102795384 GAGCTGAGATTCAGGTTGGATGG - Intergenic
959365153 3:105448734-105448756 GAGCATAGCTTCATGGGGGAAGG - Intronic
960056476 3:113279648-113279670 GAGCTGAGCTGCAGGGGAGATGG - Intronic
960249156 3:115433311-115433333 TAGCAGAGCTCCAGAGAAGAAGG + Intergenic
960926893 3:122803310-122803332 GAGAAGAGCTTCAGGAAGGTAGG + Intronic
962429792 3:135308429-135308451 TGGCAGAGCCTCAGGCAGGAAGG - Intergenic
962812432 3:138971230-138971252 GAGAACAGCCTGAGGGAGGAAGG - Intergenic
963607675 3:147424784-147424806 GGGCAGACCTGGAGGGAGGAGGG - Intronic
965819501 3:172670546-172670568 GAGCAGAGCTTAAAGCAGCAAGG + Intronic
965930390 3:174035687-174035709 GAGCAGAGCTAGAGGGAGCATGG + Intronic
966221173 3:177552712-177552734 GAGCTGACGTACAGGGAGGAGGG + Intergenic
966833710 3:184032865-184032887 GAGCAGAGACTGAGAGAGGAGGG - Exonic
966985874 3:185179862-185179884 GAGCACAGATGCAGGGAGGTGGG + Intergenic
967266822 3:187698775-187698797 GAGCAGTGCTACGAGGAGGATGG - Exonic
967879163 3:194287026-194287048 GAACCAAGCTGCAGGGAGGAGGG - Intergenic
968892377 4:3376390-3376412 GAGCTGGGCTGCAGTGAGGAGGG + Intronic
968933236 4:3595478-3595500 GGGCAGAGGATCAGAGAGGAGGG - Intergenic
968936576 4:3614246-3614268 GAGCTGGGCTGCAGGGAGGTGGG - Intergenic
969115307 4:4867383-4867405 GAGCTGAGCGTCTGGGAGGGCGG - Intergenic
969305958 4:6326454-6326476 AAGGAGAACTTCATGGAGGAGGG + Intronic
969417937 4:7073359-7073381 GAGCTGTGCTTGAGGGTGGAGGG + Intergenic
969475418 4:7419976-7419998 GTGCAGAGCTACAGGATGGAAGG - Intronic
969559418 4:7938082-7938104 AAGCAAAGCTTCAGAGAGAAGGG + Intronic
969584699 4:8084993-8085015 GGGCAGAGCTTCAGGGACACAGG + Intronic
969662529 4:8538555-8538577 GAGCAGGGCCCCAGGGAGGCAGG + Intergenic
969663175 4:8542305-8542327 GACCAGAGCCTCATGGAAGACGG + Intergenic
969671845 4:8594013-8594035 CAGGAGAGCTTCCTGGAGGAGGG - Intronic
969931363 4:10634206-10634228 GAGTAGAGCCTAGGGGAGGAAGG + Intronic
970603519 4:17658845-17658867 GAGCAGCACCTGAGGGAGGAGGG - Intronic
973677994 4:53286045-53286067 TGGCAGAGCCTCAGGGATGATGG - Intronic
975559918 4:75699428-75699450 GAGCAGAGTTTCAGAGAGTTTGG + Intronic
976186729 4:82449570-82449592 GAGGACAGCATCAAGGAGGATGG + Intronic
976801915 4:89002506-89002528 GAGCAGGGCTTGGGGGAGGTGGG - Intronic
977461990 4:97337253-97337275 CACCTGAGCTTCATGGAGGAGGG + Intronic
979506919 4:121509577-121509599 CAGCAGAGCTTCCAGGAGGGGGG + Intergenic
981216026 4:142168806-142168828 GAGCAGAGTACCAGAGAGGAAGG - Intronic
981941161 4:150282976-150282998 TAGCACAGCTTCAAGGAGGCTGG + Intronic
982301435 4:153882758-153882780 AAGCAGTGGTTGAGGGAGGAGGG + Intergenic
983350509 4:166581900-166581922 GATCAGAGAGACAGGGAGGAGGG + Intergenic
983627521 4:169816570-169816592 GAGAAGGACATCAGGGAGGAAGG + Intergenic
984069579 4:175094308-175094330 TAGCAGAACCTCAGGGATGAAGG - Intergenic
984878612 4:184391027-184391049 GGACAGAGCTGCAGTGAGGAGGG - Intronic
985007127 4:185545010-185545032 AGGCAGAGCTTCAGGGACTATGG - Intergenic
985383392 4:189419485-189419507 GAGGAGCACTTCAGGGAAGACGG + Intergenic
986153706 5:5152289-5152311 GAGCAGAGCTCCGGTGGGGATGG + Intronic
986307464 5:6526121-6526143 CAGCAGAGGTCCAGGGAGAAAGG + Intergenic
988537399 5:32081179-32081201 GCACAGAGCTCCAGGGAGTACGG - Intronic
988676811 5:33441104-33441126 CAGCAGTCCTTCAGGGAAGATGG + Exonic
989187695 5:38641156-38641178 CCTCAGAGCCTCAGGGAGGAGGG - Intergenic
990467168 5:56081397-56081419 AAGGAGAGTTTCAGGGTGGAGGG - Intergenic
990580326 5:57161772-57161794 GATCACTGCTTCAGGAAGGAAGG + Intergenic
991509456 5:67360687-67360709 GGGGAGAGCTTCAAGAAGGAAGG + Intergenic
991939847 5:71839914-71839936 GAGGAGAAGTTCAAGGAGGATGG + Intergenic
992190220 5:74284682-74284704 GAACAGAGCATCAGGAAGCAGGG - Intergenic
992557163 5:77915343-77915365 CAGCAGAGCTACAAGCAGGAAGG + Intergenic
994020832 5:95023485-95023507 GAGCTGCGCTCCTGGGAGGATGG + Intronic
997295414 5:132765740-132765762 GAGCAAAGCTACAGAGTGGAAGG - Intronic
997741932 5:136262939-136262961 CAGCAGAGCTCCAGAGAGAAGGG + Intronic
998296788 5:140978270-140978292 GAACAGTGATTCAGTGAGGAGGG + Intronic
998781645 5:145663483-145663505 GAGGGAAGCTTCACGGAGGAAGG + Intronic
999254738 5:150204041-150204063 GAGTGGCGCTACAGGGAGGATGG + Intronic
1000046400 5:157525348-157525370 GGGCAGAGTCTCAGGGAGGTGGG - Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1000836600 5:166162189-166162211 GAGCAGGACTTCATGAAGGAAGG - Intergenic
1001323555 5:170702490-170702512 GCAGAGAGCTTGAGGGAGGAAGG + Intronic
1001368434 5:171169334-171169356 CACCAGAGCATCAGGGAGTATGG + Intronic
1002063045 5:176637738-176637760 GAGGAGGGCTGGAGGGAGGAGGG + Intronic
1002428765 5:179191248-179191270 CAGCAGAGTTCCAGGGAGGCAGG - Intronic
1002690121 5:181044717-181044739 GAGCAGAGCATCAGGAGTGAGGG + Intronic
1003064407 6:2891068-2891090 GAGCATAGTTTCAGGAAGGTGGG + Intronic
1003098894 6:3162547-3162569 CAGAAGAGCTCCAGGGAGGGAGG - Intergenic
1003118900 6:3304174-3304196 GACCAGAGCCTGAGGCAGGAGGG + Intronic
1003282432 6:4705689-4705711 GTGCAGGGGTGCAGGGAGGATGG - Intergenic
1004143650 6:13045048-13045070 TAGGAGGGCTTCAGGGATGAGGG - Intronic
1004472769 6:15943940-15943962 GAAAACAGCTTCTGGGAGGAAGG + Intergenic
1004813227 6:19283280-19283302 AAGCAGAGATTCTGGGAGTAGGG + Intergenic
1005401255 6:25436750-25436772 GACTTAAGCTTCAGGGAGGAAGG - Intronic
1005604923 6:27467168-27467190 TAGGAGAGTTTCATGGAGGATGG - Intronic
1005987234 6:30882845-30882867 GAGCACAGCTCCTGGAAGGAGGG + Intronic
1006123579 6:31822499-31822521 GAGCAGAGCAGCAGCCAGGACGG + Intergenic
1006125878 6:31837800-31837822 GAGCACAGCATCAAGGAGGATGG + Intronic
1006170977 6:32092422-32092444 GAGAAGTGCTTCTGGGAAGAGGG + Intronic
1006928147 6:37670392-37670414 GTGCAGGGCTTCAGAGGGGATGG + Intronic
1006947039 6:37791540-37791562 GTGCAGAGTTACAGGGAGGAGGG + Intergenic
1007247943 6:40475830-40475852 AAACTGAGCTTCAGAGAGGATGG + Intronic
1007688802 6:43684443-43684465 AAGCAGGGCTTGAGGCAGGAAGG - Intronic
1007728130 6:43929206-43929228 GAGAAGGGGTTCTGGGAGGAGGG - Intergenic
1011120987 6:83952424-83952446 TATCAGAGCTTCATGGAAGAAGG + Intronic
1012929965 6:105306589-105306611 GAGAAGAGTTTCAAGGAGGATGG - Intronic
1013385718 6:109628340-109628362 AAGCAGAGCAGCAGGGAGAAGGG - Intronic
1014315816 6:119863322-119863344 GAGCTGAGCTACAGTAAGGAAGG - Intergenic
1015707965 6:136108915-136108937 GAAGAGAGATTCAGGAAGGAAGG - Intronic
1016086154 6:139917952-139917974 GAGCATAACTTCATGGAGGAGGG - Intergenic
1016319933 6:142831448-142831470 GAGCTGCGCTTCAGGGAGATGGG - Intronic
1016743975 6:147558602-147558624 GGGCAGAGTTTCTAGGAGGACGG - Intronic
1017496666 6:154989647-154989669 GAGCACAGCCTCTTGGAGGAAGG - Intronic
1018213467 6:161504367-161504389 GAGCAGGGTTTCAGGCAGGGCGG + Intronic
1018352570 6:162976012-162976034 GAGCAGAAATTCATGGAGGTGGG + Intronic
1018373332 6:163187861-163187883 GTGAAGAGCTCCAGGGAGGCCGG + Intronic
1018923911 6:168193801-168193823 GGGCAGAGCTGCTGGGAAGAAGG + Intergenic
1020009269 7:4799581-4799603 GAGCAGGGCATCTGGGAGAAGGG + Intronic
1020126330 7:5534317-5534339 GAGCATTGCTTCAGCGTGGAAGG + Intronic
1020569541 7:9841776-9841798 GAGCAGAGCTGTTGGAAGGAAGG + Intergenic
1022531636 7:31070396-31070418 GAGCAGACTTGGAGGGAGGAGGG + Intronic
1022973232 7:35536027-35536049 GAGCAGCGCTGAAGGGAGAAGGG + Intergenic
1023416224 7:39935508-39935530 TTGCAGAGGTTCAGGGAGGAAGG - Intergenic
1023538238 7:41236818-41236840 GAGCAGAGCTCCTGGGAGAAAGG - Intergenic
1023874243 7:44278155-44278177 CAGGACAGCTTCATGGAGGAGGG + Intronic
1024157362 7:46638943-46638965 GAGCAGAACTTCACTGTGGAAGG - Intergenic
1024284452 7:47744966-47744988 AAGCTGAGTCTCAGGGAGGAGGG + Intronic
1024325673 7:48107537-48107559 GAGCAGAAGTGAAGGGAGGAGGG - Intronic
1024555451 7:50599598-50599620 GAGGAAGGCTCCAGGGAGGACGG + Intronic
1026677617 7:72441249-72441271 GAGCAGACCTACAGGGAGGTGGG + Intronic
1026807918 7:73439257-73439279 GAGCAGGACTTCATAGAGGAAGG + Intergenic
1027516825 7:79152601-79152623 TATCAGAGCTCCAGGGAGGCGGG + Intronic
1029365463 7:100113579-100113601 GAGCAGGGTGGCAGGGAGGAGGG - Intronic
1029787454 7:102806873-102806895 GAGCTGAGCTTCTGGGGAGACGG + Intronic
1030022410 7:105288772-105288794 GAGAAGAGCATCTGGGAGGATGG - Intronic
1031123053 7:117742944-117742966 GGGCAGGGCTGCAGGGAGAATGG - Intronic
1031413889 7:121472734-121472756 AAGCAGAGCATCAGGGTGAATGG - Intergenic
1032005646 7:128300262-128300284 GAACAGAGCCTCTGGCAGGAAGG - Exonic
1032463730 7:132130301-132130323 GAGAAGAGATCCAGGAAGGAGGG + Exonic
1032494717 7:132352384-132352406 GAGTAGAGCCCCAGGGAGGGAGG + Intronic
1032539680 7:132692813-132692835 AGGCAGAGGATCAGGGAGGATGG - Intronic
1033274825 7:139963915-139963937 GAGGAGAGCATGATGGAGGATGG - Intronic
1033663500 7:143420066-143420088 GGCCAGACCTTCAGGGAGGACGG - Intergenic
1033686068 7:143642612-143642634 GAGCAGAAATTCTGGGAGAAGGG - Intronic
1033689670 7:143724703-143724725 GAGCAGAAATTCTGGGAGAAGGG + Exonic
1033698545 7:143815009-143815031 GAGCAGAAATTCTGGGAGAAGGG + Intergenic
1034563204 7:151894724-151894746 GGGCAGAGGAGCAGGGAGGATGG - Intergenic
1035140261 7:156752572-156752594 GAGGGGAGCTGCAGGGAGGAGGG + Intronic
1035311498 7:157972485-157972507 GAGCAGGGCTTCAGAGACCACGG + Intronic
1035311505 7:157972524-157972546 GAGCAGGGCTTCAGAGACCACGG + Intronic
1035311512 7:157972563-157972585 GAGCAGGGCTTCAGAGACCACGG + Intronic
1035311519 7:157972602-157972624 GAGCAGGGCTTCAGAGACCACGG + Intronic
1035311526 7:157972641-157972663 GAGCAGGGCTTCAGAGACCACGG + Intronic
1035311533 7:157972680-157972702 GAGCAGGGCTTCAGAGACCACGG + Intronic
1035311540 7:157972719-157972741 GAGCAGGGCTTCAGAGACCACGG + Intronic
1035311547 7:157972758-157972780 GAGCAGGGCTTCAGAGACCATGG + Intronic
1036226339 8:6960962-6960984 GAGCAGAGCTGCAGGGCTGGGGG - Intergenic
1036417902 8:8567305-8567327 GAGAGGAGCTACAGGTAGGAAGG - Intergenic
1036571135 8:9980558-9980580 GAGGAGGGATTGAGGGAGGAGGG - Intergenic
1036722799 8:11192735-11192757 GATCAGAGCCTCAGGGAGTTGGG - Intronic
1036763963 8:11534558-11534580 GAGCAGACCTTCAGGAAGGAAGG - Intronic
1037537311 8:19836585-19836607 AAGAAAAGCTTCAGGCAGGAAGG - Intronic
1038037213 8:23696606-23696628 AAACAGAGGGTCAGGGAGGAAGG + Intergenic
1039469630 8:37805192-37805214 GGGCAGAGCTCCAGGATGGAGGG - Intronic
1039968556 8:42301743-42301765 CACCAGATCTTCAGTGAGGAGGG - Intronic
1040915546 8:52564314-52564336 GGGCAGCGCTGGAGGGAGGAGGG - Intronic
1041070620 8:54124613-54124635 AAGGAGAGTTTCAGGGTGGAGGG - Intergenic
1041480738 8:58317181-58317203 GAACAGAGGTTGAGTGAGGAAGG - Intergenic
1041643856 8:60230611-60230633 GAGCAAAATTTCAGGAAGGAAGG - Intronic
1042366145 8:67939107-67939129 GAGAAGAGTATCAGGGATGAGGG - Intergenic
1045653646 8:104365812-104365834 GACCAGAGCTTCAGGGCAAAAGG - Intronic
1046316334 8:112507817-112507839 TAGCAGAGGTGCATGGAGGAAGG - Intronic
1047526555 8:125638813-125638835 AGGCAGGGCTTCAGGGAGGAGGG + Intergenic
1047720508 8:127634770-127634792 GGGCAGAGCTTGAGTGATGATGG - Intergenic
1047778416 8:128092314-128092336 GGGAAGAGCTTCAGGGAGCTGGG - Intergenic
1048303535 8:133267864-133267886 GAGCACAGCACCAGGCAGGATGG + Intronic
1049313051 8:141943552-141943574 GAGGAGAGCCGCAGAGAGGAGGG - Intergenic
1049324465 8:142014862-142014884 GAGCAGAGCATCGGGGAGCCGGG - Intergenic
1050406151 9:5310366-5310388 GGGGAGAGGTACAGGGAGGAAGG - Intergenic
1050865981 9:10499926-10499948 AAGCAGAGATTCCTGGAGGATGG + Intronic
1053141339 9:35684701-35684723 GAGCAGAGGGGCAGTGAGGATGG - Intronic
1053534541 9:38912863-38912885 GAGCAGAGAAGCTGGGAGGAAGG - Intergenic
1054206760 9:62137283-62137305 GAGCAGAGAAGCTGGGAGGAAGG - Intergenic
1054456895 9:65436331-65436353 GGGCAGAGGATCAGAGAGGAGGG + Intergenic
1054631592 9:67451064-67451086 GAGCAGAGAAGCTGGGAGGAAGG + Intergenic
1055192422 9:73541550-73541572 GGACAAAGCTTCAGGCAGGAAGG - Intergenic
1057130576 9:92651573-92651595 GACCTGAGCTTCAGGAGGGAGGG - Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057529609 9:95832307-95832329 GAGCTGGGCTACAGAGAGGATGG + Intergenic
1058171805 9:101690508-101690530 GTGCAGAGCTGCAGGGAGAGAGG + Intronic
1058185111 9:101845659-101845681 GAGCAGGGCTTTAGAAAGGAAGG - Intergenic
1058599940 9:106658389-106658411 GAGCACAGCTGCAGGGTGGAGGG - Intergenic
1059374637 9:113872705-113872727 GGGCAGAGCTTCAAGGGGGAGGG - Intergenic
1060243067 9:121921386-121921408 GAACAGAGCTTCAAGGAAGAGGG + Intronic
1060471323 9:123950904-123950926 GACCAGGGGTTGAGGGAGGAGGG + Intergenic
1060807204 9:126585397-126585419 GAGCAGAACTTGAAGGGGGATGG + Intergenic
1060934822 9:127508750-127508772 AAGGAGAGCTTCCTGGAGGAAGG + Intronic
1061000315 9:127899081-127899103 GAGGAGGGCTCCAGGGAGAAGGG + Intronic
1061443804 9:130626054-130626076 GAGGAAAGCTCCAGGGAGAAAGG + Intronic
1061728128 9:132592492-132592514 GAGGAGAACTTTAGGGAAGAGGG - Intergenic
1061887871 9:133601878-133601900 GGGAGGAGCCTCAGGGAGGAAGG + Intergenic
1062151092 9:135019432-135019454 CAGGAGAGCTCCAGGGAAGACGG + Intergenic
1062572143 9:137190608-137190630 AAGCAGAGCTCCTGAGAGGAGGG - Intergenic
1185776232 X:2804983-2805005 GAGCAGGGGTCCAGGCAGGAAGG - Intronic
1187343466 X:18442007-18442029 AATCAGAGCAGCAGGGAGGAGGG - Intronic
1189294847 X:39910849-39910871 GTGCAGAGCTGCAGGGAACAGGG + Intergenic
1189332580 X:40152747-40152769 AAGCAGACATTCAGTGAGGAGGG - Intronic
1190024619 X:46912370-46912392 GAGGAGAGGTTGGGGGAGGAAGG + Intronic
1190221376 X:48514407-48514429 TAGAGGAGCTGCAGGGAGGAGGG + Intronic
1190278418 X:48913902-48913924 GACCACAGGTTCTGGGAGGAAGG + Exonic
1191132581 X:57030644-57030666 GGACAGAGCATCAGGGGGGATGG - Intergenic
1192903551 X:75524852-75524874 GAGCAGGATTTAAGGGAGGAGGG + Intergenic
1194593199 X:95826459-95826481 AAACAGTGCTTTAGGGAGGAGGG - Intergenic
1195146756 X:102026262-102026284 CAGCAGGGCTTCAGGGATGTGGG - Intergenic
1195210840 X:102651539-102651561 GAGGAGAGCTGAAGAGAGGAGGG + Exonic
1196764955 X:119235287-119235309 AAGCAGACCTCCACGGAGGAAGG - Intergenic
1197715337 X:129702207-129702229 GTGCAGAGCTTTAGGCGGGACGG + Intergenic
1197744105 X:129919408-129919430 GAGCAGAGCTTCAGAGGGCTCGG + Exonic
1199464148 X:148116815-148116837 TGGCAGAGCCTCAGGGATGAAGG - Intergenic
1199711123 X:150470433-150470455 GGGCAGAGCGACAGGGAGCATGG - Exonic
1200071276 X:153530653-153530675 GGGCAGAGCTTCAGGCAGGTGGG + Intronic
1200106832 X:153718876-153718898 GAGCAGATCCTCCTGGAGGATGG - Intronic
1200273867 X:154713375-154713397 GAGGATGGCTGCAGGGAGGAGGG + Exonic
1200750690 Y:6941718-6941740 GAGCAGAGCTTATGGGAAGATGG + Intronic
1201293772 Y:12446726-12446748 GAGCAGGGGTCCAGGCAGGAAGG + Intergenic