ID: 932412141

View in Genome Browser
Species Human (GRCh38)
Location 2:71553789-71553811
Sequence GCACCCTGGAATGGAGAGAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 298}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932412141_932412153 20 Left 932412141 2:71553789-71553811 CCCGTCTCTCCATTCCAGGGTGC 0: 1
1: 0
2: 0
3: 26
4: 298
Right 932412153 2:71553832-71553854 GGGTAACGTGAAACCTGTGGTGG 0: 1
1: 0
2: 0
3: 5
4: 41
932412141_932412148 0 Left 932412141 2:71553789-71553811 CCCGTCTCTCCATTCCAGGGTGC 0: 1
1: 0
2: 0
3: 26
4: 298
Right 932412148 2:71553812-71553834 CACTACTACTACCTACCCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 85
932412141_932412152 17 Left 932412141 2:71553789-71553811 CCCGTCTCTCCATTCCAGGGTGC 0: 1
1: 0
2: 0
3: 26
4: 298
Right 932412152 2:71553829-71553851 CTGGGGTAACGTGAAACCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 81
932412141_932412147 -1 Left 932412141 2:71553789-71553811 CCCGTCTCTCCATTCCAGGGTGC 0: 1
1: 0
2: 0
3: 26
4: 298
Right 932412147 2:71553811-71553833 CCACTACTACTACCTACCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 95
932412141_932412145 -2 Left 932412141 2:71553789-71553811 CCCGTCTCTCCATTCCAGGGTGC 0: 1
1: 0
2: 0
3: 26
4: 298
Right 932412145 2:71553810-71553832 GCCACTACTACTACCTACCCTGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932412141 Original CRISPR GCACCCTGGAATGGAGAGAC GGG (reversed) Exonic
901595279 1:10380235-10380257 GCACAGTGGATTGGAGAGAAAGG + Intronic
902479667 1:16704881-16704903 GCACCCTGGGAGAGAGAGGCAGG + Intergenic
902664544 1:17928206-17928228 GTGCCCTGGGATGGGGAGACAGG + Intergenic
905170604 1:36107672-36107694 GCCCCCTGGAATGGTGAAACCGG + Intronic
905374304 1:37508529-37508551 GCACTTTGGAATGGAGAGGTGGG - Intronic
906003341 1:42446110-42446132 GCAGCCTGGAATGGGGAGTCAGG + Intronic
906143034 1:43545013-43545035 TCAACCTGTAATGGAGAGAAGGG - Exonic
906151981 1:43592777-43592799 GCCGCCTGGACTGGACAGACTGG - Intronic
909756308 1:79230276-79230298 GGGACCTGGAACGGAGAGACTGG + Intergenic
912421009 1:109542606-109542628 GGACCCTGGGAAGGAGAAACAGG + Exonic
912821462 1:112871158-112871180 TCTCCCTGGAAAGGAGAAACCGG + Intergenic
914388437 1:147195377-147195399 GCACCTTGGGATGCAGAGACGGG - Intronic
915646636 1:157277363-157277385 GTGCCCTGGAATGGACAGTCTGG - Intergenic
915920481 1:159972452-159972474 GCAGCCTGGCATGGAGTGAGGGG - Intergenic
920067958 1:203282459-203282481 GTACCCTGAGAGGGAGAGACAGG - Intergenic
920290200 1:204916817-204916839 GCACCCTGGAAGGCTGAGACAGG - Intronic
920365855 1:205448111-205448133 TCACTCTGGAATGAAGAGACTGG - Intronic
920459436 1:206127932-206127954 GCATCCTGGAATCTAGAGAGGGG + Intergenic
921063492 1:211606417-211606439 GCACAGTGGAAGGGAGAGAAAGG - Intergenic
923049278 1:230379349-230379371 GCATCCTGGAATGGGCAGATGGG - Intronic
923308053 1:232706534-232706556 GCAGCCTGGAGTTGAGAGAAAGG - Intergenic
923988975 1:239413032-239413054 CCAGGCTGGAATGGAGTGACGGG - Intronic
1063222870 10:3987178-3987200 GTAACCTGGAATTGATAGACAGG + Intergenic
1064951431 10:20854976-20854998 GCACTCTGGGAGGCAGAGACAGG + Intronic
1067089175 10:43257919-43257941 GCAGCCTGGAGAGGACAGACAGG + Intronic
1068597726 10:58921412-58921434 ACACTCTGGTAGGGAGAGACTGG - Intergenic
1068913712 10:62406131-62406153 GCTGGCTGGAGTGGAGAGACAGG - Intronic
1069616228 10:69807877-69807899 GGGCCCTGGAATGGAGAGCAGGG - Intronic
1069737648 10:70667742-70667764 GGAACCCGGAATGGAGGGACCGG + Intergenic
1069784512 10:70979116-70979138 GCCCCGAGGAATGGAGAGTCTGG - Intergenic
1069876612 10:71566981-71567003 CCACCCTGGAAGAGAGTGACGGG + Intronic
1070283471 10:75067204-75067226 GCACTCTGGAAGGCCGAGACAGG - Intergenic
1072246282 10:93547102-93547124 GCACTCTGGGAGGCAGAGACAGG - Intergenic
1072401928 10:95111410-95111432 CCATCTTGGAATGGAGAGCCAGG + Intergenic
1072503449 10:96042318-96042340 GGACCCTGCAACTGAGAGACAGG + Intergenic
1072639143 10:97197828-97197850 GCACCTTGGAAGGCTGAGACAGG + Intronic
1073407575 10:103311386-103311408 GCACTTTGGAAGGCAGAGACGGG - Intronic
1075517062 10:123117886-123117908 GGAGCTTGGAATGGAGAGAAGGG - Intergenic
1076416430 10:130293057-130293079 GTTCCCTGGAAAGGAGAGCCAGG + Intergenic
1076527126 10:131118920-131118942 GCACCTGGGAGTGGAGAGCCGGG + Intronic
1078095284 11:8292643-8292665 GCAGCCTGGAATGGAGGGAAGGG + Intergenic
1080639230 11:34149084-34149106 GCAGCCTGAAAGGGAGAGGCCGG + Intergenic
1080897527 11:36458944-36458966 GCACTGTGGAAGGCAGAGACAGG + Intronic
1083555759 11:63625739-63625761 GCACCCTGGAAGGCCAAGACAGG + Exonic
1085304300 11:75476537-75476559 GGGGCCTGGAGTGGAGAGACCGG + Intronic
1085691832 11:78670542-78670564 GCACCATGGACTGGAGGGAGAGG + Exonic
1089609860 11:119663198-119663220 GGACCCTGGGATGGAGAGGCAGG - Exonic
1089963908 11:122639568-122639590 GCACCCTGGGAGGCAGAGGCGGG + Intergenic
1090019646 11:123116318-123116340 GCACTCTGGGATGCCGAGACAGG + Intronic
1090168302 11:124575750-124575772 GAACCATTGAATAGAGAGACAGG + Intergenic
1090332747 11:125944353-125944375 GGACCCTCGAAGGGAGAGTCAGG - Intergenic
1090606348 11:128426051-128426073 GCACACTGGAAGGCAGAGAGAGG - Intergenic
1090677526 11:129014335-129014357 GAACCTTGGCATGGAGAGGCAGG + Intronic
1093621287 12:21292838-21292860 GCACTTTGGAAGGCAGAGACCGG - Intronic
1094480790 12:30879944-30879966 GAACCCAGGTCTGGAGAGACTGG - Intergenic
1094780397 12:33785609-33785631 GCACCCAGTACTGGAGAGAATGG - Intergenic
1095917726 12:47497325-47497347 GAACCCAGGAAGGGAGAAACTGG - Intergenic
1096718453 12:53504679-53504701 GCTCCTTGGAAGGGAGACACAGG - Exonic
1097094586 12:56536234-56536256 GCACTCTGGAAGGGCGAGGCAGG + Intronic
1099137028 12:78918304-78918326 CCTGCCTGGAATGGAGAGAATGG - Intronic
1100133434 12:91524153-91524175 TCACCCTGGGATGTAGAGAATGG + Intergenic
1100298207 12:93282392-93282414 GCACTTTGGAAGGGCGAGACAGG + Intergenic
1103059793 12:117849169-117849191 GCCCTCTGGAATGGAGGGACTGG - Intronic
1103245198 12:119450917-119450939 GCAGCCTGGACTGCAGAGTCTGG + Intronic
1105427904 13:20311443-20311465 ACATCTTGGAATTGAGAGACGGG + Intergenic
1105482561 13:20792344-20792366 GCACTCTGGGAGGGTGAGACAGG + Intronic
1105502591 13:20985797-20985819 GCACCCTGGGAGGCTGAGACAGG + Intronic
1105553680 13:21424461-21424483 GCACCTTGGAAGGCAGAGGCAGG + Intronic
1106267643 13:28124449-28124471 GCACTCTGGAAGGCAGAGACGGG + Intergenic
1106578499 13:30998166-30998188 GCAGCCAGGAATAGAGAGACAGG - Intergenic
1106862184 13:33921690-33921712 GCACCCTGGAATGGAGCCCTGGG + Intronic
1112328579 13:98460149-98460171 GCAGCCTGGAATGTGTAGACTGG - Intronic
1113076467 13:106472345-106472367 GCACTCTGGAGGGGAGAGGCAGG - Intergenic
1113309803 13:109120573-109120595 GCATCCAGGAATCGAGAGAGTGG - Intronic
1113399637 13:109979107-109979129 GCACTCTGGGAGGGAGAGGCAGG - Intergenic
1117828334 14:59726602-59726624 CAGCCCTGGAATGGAAAGACAGG + Intronic
1118372257 14:65147389-65147411 GGACCCTGGAACGGAGGGACCGG - Intergenic
1121708619 14:96020068-96020090 GCCCCCTGGCATGGAGGGAAGGG + Intergenic
1121904513 14:97727431-97727453 GCACTCTGGAAGGCTGAGACGGG - Intergenic
1122574853 14:102735505-102735527 GCACCAAGGAATGGAGGGAGGGG - Intergenic
1122850368 14:104524929-104524951 GCACCCTGGAGAGGAGTGCCTGG - Intronic
1122900168 14:104779117-104779139 GAACCCTGGCATGGAGACCCAGG - Intronic
1125453152 15:39829732-39829754 CCAGCTTGGAAAGGAGAGACAGG - Intronic
1125514493 15:40310164-40310186 CCACCCTGGAGGGGTGAGACTGG - Intergenic
1125600493 15:40912902-40912924 GCTCCCTGCAAGGGAGAGAGTGG - Intergenic
1126679941 15:51192908-51192930 GCACCCTGGAAAAGAGAGCGAGG + Intergenic
1126695320 15:51321074-51321096 GCAGGCTGGAGTGGGGAGACAGG - Intronic
1128134847 15:65255200-65255222 GTACCTGGGAATGGAGAGGCAGG - Intronic
1128717906 15:69922120-69922142 GCTCCCTGGAATGGGGGGAGGGG - Intergenic
1128851736 15:70965009-70965031 CCACCATGGAATAGAGAGAGAGG - Intronic
1130757351 15:86779007-86779029 GGAACCTGGAAGGGAGGGACCGG - Intronic
1131007875 15:88993320-88993342 GCACTTTGGAAGGGAGAGGCAGG + Intergenic
1131084992 15:89568397-89568419 GCACCTTGGGAGGCAGAGACGGG + Intergenic
1132038100 15:98503115-98503137 GCAGCCAGGAGAGGAGAGACGGG + Intronic
1132583980 16:698043-698065 GCAGACTGGAGTGCAGAGACAGG + Intronic
1133306948 16:4816013-4816035 GCACTTTGGAAGGCAGAGACTGG - Intronic
1134061553 16:11202571-11202593 GCAGCCTGCAAAGGAGAGCCAGG + Intergenic
1134396554 16:13870255-13870277 GCACTCTGGGAGGCAGAGACAGG + Intergenic
1136609134 16:31355730-31355752 GGACCCTGGGAAGGAGAGAAGGG + Intronic
1137359155 16:47797383-47797405 GGACCCTGGGATGGTGGGACGGG + Intergenic
1137398816 16:48136364-48136386 GCACACTGGGTTGGGGAGACTGG - Intronic
1140532468 16:75678702-75678724 GCACCTTGGGATGCTGAGACGGG + Intronic
1141445605 16:84055889-84055911 GCTCCCAGGAAGGCAGAGACAGG + Intronic
1141648505 16:85379910-85379932 GCAGCCTGGCATGGACAGGCAGG - Intergenic
1142413935 16:89931153-89931175 GCGCTTTGGAATGGAGACACAGG - Intronic
1142802231 17:2353514-2353536 GCACCTTGGAAGGCTGAGACGGG + Intronic
1143261411 17:5601441-5601463 GCGCCTTGGGATGGAGAGACTGG + Intronic
1143341534 17:6215105-6215127 GCACTCTGGGAGGCAGAGACAGG - Intergenic
1144422954 17:15114642-15114664 GCACCTAGGTATGGAGAGTCAGG - Intergenic
1144991785 17:19238050-19238072 GCCCCCAGGAAAGGTGAGACGGG - Intronic
1146693754 17:34893615-34893637 GCAGCCTGGAGGGGAGAAACTGG + Intergenic
1147197451 17:38777006-38777028 GCACCTTGGAAGGGTGAGGCAGG - Intronic
1147338389 17:39740130-39740152 GCAGCCTGGAATGAAGTCACTGG + Intronic
1147360597 17:39927388-39927410 GCGCCCCGGGCTGGAGAGACGGG - Intronic
1148059638 17:44827061-44827083 GCACTCTGGAAGGCAGAGGCAGG + Intronic
1148078779 17:44955905-44955927 GCAAGCTGAAATGGAGAGCCGGG + Intergenic
1150233748 17:63575451-63575473 GCACCCTGAGAGGGCGAGACAGG + Intronic
1150765516 17:67998838-67998860 ACACCCTGAAATGTAGAGGCAGG + Intergenic
1151531289 17:74706777-74706799 GCAGCCTGGATTGGAGAGCAGGG + Intronic
1152683080 17:81679788-81679810 ACACACTGGAAAGCAGAGACTGG + Intergenic
1153343867 18:4005564-4005586 GTACTCTGGGATGGAGAGATAGG + Intronic
1153602141 18:6791256-6791278 GGAACATGGAAAGGAGAGACTGG - Intronic
1155053596 18:22167743-22167765 AAACTCTGGAATGGAGAGGCTGG - Intergenic
1155748756 18:29393609-29393631 GCACCCTGGCATGCAGAGGAAGG + Intergenic
1157144562 18:45148536-45148558 GCACCTTGGGAGGTAGAGACAGG + Intergenic
1157269424 18:46259965-46259987 GCACTCTGGGAGGGTGAGACGGG - Intronic
1157275172 18:46305115-46305137 GGTCCCTGGAAGGGAAAGACAGG + Intergenic
1157727343 18:49974943-49974965 GCAGCCTGGCATGGAGGGAGGGG - Intronic
1157967402 18:52223648-52223670 GCACCCTGGTAAGGAGAAATAGG - Intergenic
1159002129 18:62983619-62983641 CCAGCCTGGAATGCAGAGACTGG + Intergenic
1160593094 18:79955074-79955096 GCACCCTGCTCTGAAGAGACAGG + Intergenic
1160728997 19:632261-632283 GCAGCCGGGAAGGGAGAGGCGGG - Intronic
1161819445 19:6520625-6520647 GCACCCTGGGAGGCTGAGACGGG + Intergenic
1162743043 19:12783912-12783934 GCACCCAGGAAGTGAGAGGCGGG + Intronic
1162765335 19:12915900-12915922 CCAGCCTGGAATGGGGAGCCAGG - Intronic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1163398524 19:17077757-17077779 GCAGCCAGGAATGGAGAGTGGGG - Intronic
1165112754 19:33511848-33511870 GAACAATGGAGTGGAGAGACGGG + Intronic
1165217409 19:34286083-34286105 GCACTCTGGAAAGCCGAGACAGG + Intronic
1167573943 19:50308801-50308823 ACAACCTGGAGGGGAGAGACTGG + Intronic
1168258506 19:55179984-55180006 GCAGCCTGAAGCGGAGAGACAGG - Intronic
1168320082 19:55503860-55503882 GGGCCCGGGAATGGAGGGACGGG + Intronic
1168366612 19:55793320-55793342 GCACCTTGGGAGGGGGAGACAGG + Intronic
1202713703 1_KI270714v1_random:30787-30809 GCACCCTGGGAGAGAGAGGCAGG + Intergenic
926505301 2:13706750-13706772 GCACCCTGGAGTAGATAGACTGG - Intergenic
927696713 2:25244400-25244422 GCTACCTGGAATGGAAAGACCGG + Intronic
927846596 2:26475496-26475518 GCAGCATGGGATGGGGAGACAGG + Intronic
928157194 2:28887643-28887665 GTAGCCTGGCATGGAGGGACAGG - Intergenic
928176577 2:29038151-29038173 GCATCCTGGAAAGGAGAGCCTGG + Intronic
928754959 2:34513372-34513394 TCAATCTGGGATGGAGAGACTGG - Intergenic
931761876 2:65424702-65424724 GCACTCTGGAAGGTCGAGACAGG + Intronic
932412141 2:71553789-71553811 GCACCCTGGAATGGAGAGACGGG - Exonic
932572835 2:72946894-72946916 GCTCCTTGGACTGGAGACACAGG + Intronic
932878029 2:75473761-75473783 GCACTCTGGGATGCAGAGGCAGG - Intronic
934075788 2:88427799-88427821 GCACCCTGGAAGGCCGAGGCGGG - Intergenic
935053444 2:99544174-99544196 GCACTTTGGAATGCCGAGACAGG - Intergenic
935238149 2:101155053-101155075 GCACTTTGGAAGGCAGAGACAGG + Intronic
935729816 2:106056044-106056066 TCCCCCTGGAGAGGAGAGACCGG - Intergenic
936952696 2:117993976-117993998 GCACACTGGAAGGCTGAGACGGG - Intronic
937023939 2:118682050-118682072 GCACCCTCCCATGGAGAGACAGG + Intergenic
937435323 2:121875446-121875468 GCAGCCAGGAATGGACAGAGCGG + Intergenic
937877678 2:126837564-126837586 CCAGCCTGGAAAGGAGAGAGTGG + Intergenic
938195722 2:129325819-129325841 GCACTCTGGAAGGGCGAGGCAGG + Intergenic
938735661 2:134184354-134184376 GCAGGCTGGAATGTAAAGACAGG - Intronic
939391721 2:141576902-141576924 GCACTCTGGGAGGCAGAGACAGG - Intronic
940057370 2:149526927-149526949 GAACCCTGTAATGGAGGGAAGGG - Intergenic
940640888 2:156342803-156342825 GCACCCTGGGATGGCGAGGAGGG + Intergenic
941167342 2:162097094-162097116 GCACCCTGGGATTGACAGAGGGG - Intergenic
942156281 2:173131994-173132016 GGTCCCTGGAATGGAAAGTCAGG + Intronic
943408992 2:187521811-187521833 GCACTCTGGAAGGCAGAGGCAGG - Intronic
943735616 2:191351126-191351148 GCACCATGGGATGGTGAGGCAGG - Intronic
944845373 2:203662790-203662812 GTACACAGGAATGGAGAGAAAGG - Intergenic
945611621 2:212011502-212011524 GCACCCTGGGAGGCTGAGACGGG + Intronic
947709989 2:232307952-232307974 GCTTCCTGGCATGGAGAGAAAGG - Intronic
947966568 2:234287150-234287172 TCAGCCTGGGATGGAGAGAGGGG + Intergenic
948312439 2:236998833-236998855 GCAACCTGGCATGGAGTGCCGGG - Intergenic
1169289591 20:4337615-4337637 GGGCCCTGGAATGGAGCGAGGGG + Intergenic
1170462369 20:16589215-16589237 TCACCCTGGAGTGCAGTGACAGG - Intergenic
1170708712 20:18769343-18769365 CCACCCTGGAAGAGAGAGAGTGG - Intergenic
1173377931 20:42506558-42506580 ACAACCTGGAATGGAGAAAAAGG - Intronic
1173825003 20:46042660-46042682 AGACCTTGGAATGGAGAGAAGGG + Intronic
1173877723 20:46385859-46385881 CCACCCTGGTATGGGAAGACTGG + Intronic
1175155206 20:56966612-56966634 GCCCCCTAGAATGCAGAGCCAGG + Intergenic
1177762518 21:25418259-25418281 TCACCCTGGCATGGAGAGGCAGG - Intergenic
1178402282 21:32297279-32297301 CCACCCTGGAAAGGGGAGAGAGG + Intronic
1178775648 21:35547888-35547910 CCACCATGGAAGGGAGAGTCAGG - Intronic
1179681171 21:43022259-43022281 GCACCCTGGAGAGGAGACAGTGG - Intronic
1183060026 22:35330674-35330696 TAACCCTGGAAAGGAGATACAGG - Intronic
1183130723 22:35832584-35832606 GCACTCTGGGATGCAGAGGCAGG + Intronic
1183639214 22:39083088-39083110 TCACCCTGGAGTGGACAGAGGGG - Intronic
1183914814 22:41109208-41109230 CCAGCCTGGAGTGGAGCGACGGG - Intronic
950009869 3:9715393-9715415 GCACACTGGGATGGAGGGCCTGG - Intronic
950236551 3:11326542-11326564 GCACTCTGGAAGGCAGAGGCGGG - Intronic
954566680 3:51605886-51605908 GCACACTGGAATGAAGAGAAAGG + Intronic
954773974 3:52999402-52999424 CCACCCTGGAATGCAGGGCCAGG - Intronic
954965479 3:54606667-54606689 GCAGGCTGGAATGGAGCGAGCGG - Intronic
955094360 3:55782457-55782479 GCCCTGTGAAATGGAGAGACGGG - Intronic
956640370 3:71409901-71409923 GCTACCTGGAAGGGTGAGACGGG + Intronic
956809165 3:72847828-72847850 GTTCCCAGGAAGGGAGAGACTGG + Intronic
957895049 3:86411583-86411605 AGACCCTGAAATTGAGAGACAGG + Intergenic
958047500 3:88303460-88303482 GCACCCTGGAAGGCCGAGGCGGG - Intergenic
961703927 3:128769138-128769160 GCACTCTGGGAAGCAGAGACAGG - Intronic
965365123 3:167788597-167788619 GCAACCTGGAATGAATAAACTGG + Intronic
965611593 3:170549533-170549555 GCAGCCTGGATTGCAGAGAGGGG - Intronic
966136388 3:176703983-176704005 GCACTCTGGAAGGCTGAGACGGG + Intergenic
966731074 3:183151901-183151923 ATACCCTGGAAGGGACAGACAGG - Intronic
967812903 3:193775440-193775462 GCCCCTTGGAAAGGAGAGAATGG + Intergenic
968906377 4:3453646-3453668 CCAGCCTGGAATGCAGTGACAGG - Intergenic
969044408 4:4326349-4326371 GCAGCCTGGAATGGAGCGCAGGG + Intergenic
969112839 4:4854386-4854408 GCACCCAGGAATGAAGGGAGTGG + Intergenic
969598021 4:8159701-8159723 GGAACCTGGCATGGAGAGAGAGG + Intergenic
970088477 4:12374834-12374856 GCACCCAGCACAGGAGAGACAGG + Intergenic
970168867 4:13268657-13268679 ACAGCCAGGAATGGAGAGAAGGG + Intergenic
970664490 4:18321166-18321188 GATCCCTGGAGTGGAGAGAAGGG + Intergenic
971604777 4:28643697-28643719 GCACTTTGGAAAGGCGAGACTGG - Intergenic
971867957 4:32196872-32196894 GCACCTTGGGATAAAGAGACAGG + Intergenic
972067509 4:34968294-34968316 GCATCCAGGAATGAAGAGGCCGG + Intergenic
972897140 4:43637537-43637559 GGACCCCTGAATGGAGGGACTGG + Intergenic
972938662 4:44170060-44170082 GGACTATGGAATGGAGAGAGAGG + Intergenic
973818615 4:54642033-54642055 GCAGCATGGATTGGAGAGGCGGG + Intergenic
980097862 4:128511998-128512020 GCAGCATGGGATGGAGAGATGGG - Intergenic
981545836 4:145892274-145892296 GCACACCGGAATGGACAGAGCGG + Exonic
982562751 4:156950235-156950257 TCATCCTGGAATGGAGGGAAAGG - Intronic
984263737 4:177471711-177471733 GCACTCTGGGAGGCAGAGACGGG + Intergenic
984753697 4:183304179-183304201 GCCCCCAGAATTGGAGAGACAGG + Intronic
985242546 4:187946128-187946150 GCACCCGGGAATGGGGATGCTGG - Intergenic
985792164 5:1935173-1935195 GCACTCGGCAATGGAGAGACGGG - Intergenic
985792783 5:1939365-1939387 GGGTCTTGGAATGGAGAGACAGG + Intergenic
986422711 5:7600349-7600371 GCACAGTGGACTGGAGAAACTGG + Intronic
987566467 5:19594395-19594417 GCACTTTGGAAGGCAGAGACAGG - Intronic
990306175 5:54496029-54496051 GCACTCTGGAATGCTGAGGCAGG + Intergenic
990947016 5:61260331-61260353 GAACCCTGGGCTGGAGAAACAGG + Intergenic
994473637 5:100240079-100240101 GCACCCTGGGAGGCAGAGGCAGG - Intergenic
997196181 5:131981489-131981511 GCACCCTGGAAGGGTGATAAGGG - Intronic
998075522 5:139233060-139233082 CCAGCCTGGAGTGCAGAGACAGG - Intronic
998471346 5:142386345-142386367 TCACCCTGGCATGGTGAGAGTGG + Intergenic
998518564 5:142779234-142779256 GCACCTCAGAATGGAGAGAGAGG + Intronic
998636359 5:143959212-143959234 GCACCTTGGAATGCAGAGGCAGG + Intergenic
1000717347 5:164662180-164662202 GCACCTTGGAAGGCTGAGACAGG + Intergenic
1000913005 5:167045014-167045036 GAACACTAGAATGGAGAGACTGG + Intergenic
1001254169 5:170171025-170171047 CCACCCTGGACTTGAGAGGCGGG - Intergenic
1001278223 5:170366382-170366404 CCACCCTGGAAGGGAGAAGCTGG + Intronic
1001391894 5:171386364-171386386 GCACTTTGGAAGGCAGAGACAGG + Intergenic
1001769837 5:174285625-174285647 GAACCTTGGAATTGAGAAACTGG + Intergenic
1003296802 6:4836915-4836937 GTGCCCTGGAATGGAGTGATGGG + Intronic
1004667351 6:17760873-17760895 CCTCCCTGGAATGCAGAGGCTGG + Intronic
1005144269 6:22669608-22669630 GCACAATGTATTGGAGAGACAGG + Intergenic
1005806171 6:29476174-29476196 GCATCCTGCAATGGAGAATCTGG - Intergenic
1006233751 6:32609064-32609086 GCACTCTGGGAGGCAGAGACAGG + Intergenic
1006449105 6:34095811-34095833 CCACCCTGGAGTGGAGGGATCGG + Intronic
1009844877 6:69122200-69122222 GCACCCTGGGAGGCTGAGACGGG + Intronic
1010551590 6:77230059-77230081 CCACCCTCAAATGGAGAGAAAGG + Intergenic
1011256227 6:85424151-85424173 CCACACTGGAATGCAGTGACAGG + Intergenic
1012258048 6:97056482-97056504 GCCACCTGGAAAGGAGTGACGGG - Intronic
1014702053 6:124701914-124701936 CCAACCTGGGATGGAGGGACAGG - Intronic
1015945990 6:138501734-138501756 GCATCCTGGAATGGATACAGAGG - Intronic
1016495143 6:144653115-144653137 GCGACCTGGAAGGGAGGGACTGG - Intronic
1018117569 6:160602146-160602168 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1018118122 6:160607735-160607757 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1018118745 6:160614192-160614214 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1018119346 6:160619744-160619766 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1018119949 6:160625290-160625312 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1018120550 6:160630834-160630856 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1018121146 6:160636383-160636405 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1018121748 6:160641926-160641948 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1018122341 6:160647480-160647502 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1018976266 6:168569688-168569710 GCACTCTGGAAGGCCGAGACAGG - Intronic
1019939126 7:4275357-4275379 ACAGCCTGGGATGGAGAGTCAGG + Intergenic
1021744990 7:23731128-23731150 GCACTTTGGAAGGCAGAGACAGG - Intronic
1021849792 7:24796222-24796244 GCACACTGGAATCGACAGAGGGG + Intergenic
1022147553 7:27560363-27560385 GCACCATGGGAAGCAGAGACAGG - Intronic
1022357397 7:29629150-29629172 GCACCTTGGGAGGCAGAGACAGG + Intergenic
1024514064 7:50229016-50229038 GCATCCTGGAATGAAGAAAATGG - Intergenic
1027690657 7:81341109-81341131 ACACCCTGGACTGGAAAGCCAGG - Intergenic
1027855964 7:83511636-83511658 GCACTTTGGAAGGGCGAGACAGG + Intronic
1028725509 7:94082796-94082818 GCACTTTGGAATGGAGATGCTGG + Intergenic
1029488486 7:100857478-100857500 TCACCCAGGAGTGGAGAGAAGGG + Intronic
1032131565 7:129233421-129233443 GCACTTTGGAAGGGTGAGACAGG - Intronic
1033468437 7:141620507-141620529 GCCCCCAAGATTGGAGAGACAGG + Intronic
1033910511 7:146258136-146258158 GCACTCTGGAAGGGCGAGGCAGG - Intronic
1035095669 7:156352776-156352798 CCACCCTGGTTTAGAGAGACTGG - Intergenic
1035569442 8:662400-662422 GCACTTTGGAAGGGTGAGACGGG + Intronic
1035662023 8:1355607-1355629 GCACCCTGGGAGGCCGAGACAGG - Intergenic
1036195104 8:6707782-6707804 ACACCCTGGTAGCGAGAGACGGG + Intergenic
1036286692 8:7449088-7449110 GCACCCTGGCAGGGAGGGACGGG + Intronic
1036334786 8:7862435-7862457 GCACCCTGGCAGGGAGGGACGGG - Intronic
1036631368 8:10518194-10518216 GCACCCTGGAAGGGCCAGGCTGG + Intergenic
1037580846 8:20245355-20245377 GCACCGGGGATTGGAGAGGCAGG - Intergenic
1038218036 8:25580920-25580942 GCACACTGGAAATCAGAGACAGG + Intergenic
1040982672 8:53260228-53260250 GCAACCTGGAAGGGTGAGGCAGG + Intergenic
1041462045 8:58121811-58121833 TGACCCTGGAATAGAGATACAGG - Intronic
1041557642 8:59175773-59175795 GCACTCTGGGATGGAGAGAGAGG - Intergenic
1045205983 8:100041240-100041262 GCACTTTGGAAGGGCGAGACAGG + Intronic
1045358698 8:101412436-101412458 GGACCCTGATATGGGGAGACTGG - Intergenic
1045988790 8:108281783-108281805 CCATCCTGGAAAGGAGAGCCAGG + Intronic
1047082561 8:121479544-121479566 GCACTTTGGAATGCAGAGGCGGG - Intergenic
1048153524 8:131918040-131918062 GCACTTTGGAAGGCAGAGACGGG + Intronic
1048451809 8:134540180-134540202 GCACACTGGAATGCAGGGGCAGG + Intronic
1049056096 8:140238834-140238856 CTAGCCTGGAATGGAGAGAGAGG + Intronic
1049947543 9:611962-611984 GCACCCTGGGAGGCCGAGACTGG - Intronic
1050526177 9:6548793-6548815 TCACCCTGGAAGGGAAAGGCTGG - Intronic
1052813614 9:33083120-33083142 GCATCCTGGACTGGTGAGCCAGG - Intergenic
1057650590 9:96916564-96916586 GCACACTGTAATGGGGTGACTGG - Intronic
1059227212 9:112683030-112683052 GCAGCCTGGAGAGGAGAGAATGG - Intergenic
1059941143 9:119361083-119361105 CCACACAGGAATGGAGAGCCTGG - Intronic
1060648740 9:125305897-125305919 GCACGCTGGAATGCTGAGGCAGG - Intronic
1062000168 9:134211900-134211922 GCACCCTGGAGTGGAAAGGAGGG + Intergenic
1062205846 9:135336677-135336699 GCACCCAGGAAGTGAGAAACGGG + Intergenic
1062361408 9:136190075-136190097 GCACCCTGGAAGGGTGTGGCCGG - Intergenic
1185747745 X:2585279-2585301 GCCCTGGGGAATGGAGAGACAGG + Intergenic
1187017617 X:15345908-15345930 GCACCAAGGAATGGAGAGGAGGG - Exonic
1190994863 X:55596614-55596636 GCACTCTGGAAGGCAGAGACAGG - Intergenic
1192200276 X:69062152-69062174 GCCCCCTGGGAAGGGGAGACAGG + Intergenic
1195343570 X:103926960-103926982 GGTCCCTGGAATGACGAGACAGG - Intronic
1195897385 X:109760635-109760657 GCCCCCAGAATTGGAGAGACAGG + Intergenic
1196288065 X:113905665-113905687 GCACTCTGGAAGGCTGAGACAGG - Intergenic
1196352567 X:114749200-114749222 GCACCTTGGAATGCGGAGGCAGG + Intronic
1197742641 X:129906837-129906859 GTTCCCAGGAATGGAGAAACAGG - Intronic
1198162440 X:134021016-134021038 GCATACAGGACTGGAGAGACTGG - Intergenic
1198414107 X:136402361-136402383 GAAGGCTGGAAGGGAGAGACAGG - Intronic
1199190416 X:144963617-144963639 TGCCCCTGGAATGCAGAGACTGG + Intergenic
1200577676 Y:4909871-4909893 GCACTCTGGGAGGCAGAGACGGG + Intergenic
1201749248 Y:17414348-17414370 GTGCTCTGTAATGGAGAGACAGG + Intergenic
1201892552 Y:18958500-18958522 GGAACCCGGAATGGAGGGACTGG + Intergenic