ID: 932412501

View in Genome Browser
Species Human (GRCh38)
Location 2:71555603-71555625
Sequence GAACCAGAGCAGGCTCGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932412489_932412501 24 Left 932412489 2:71555556-71555578 CCTCATTGGGTGGTAGAATCTGG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 932412501 2:71555603-71555625 GAACCAGAGCAGGCTCGGAGAGG 0: 1
1: 0
2: 1
3: 23
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932412501 Original CRISPR GAACCAGAGCAGGCTCGGAG AGG Intronic
900647914 1:3717331-3717353 GAAGGAGAGGAGGGTCGGAGAGG + Intronic
900695945 1:4010525-4010547 GAACCACAGCAGCCAGGGAGAGG - Intergenic
900757891 1:4449898-4449920 GAACCAAAGCTGCCTCAGAGAGG + Intergenic
900898541 1:5501434-5501456 AAACAAGAGCAGGCTTGGAATGG - Intergenic
901232115 1:7647109-7647131 GACCCAGCTCAGGCTGGGAGAGG + Intronic
901820875 1:11828643-11828665 GAGCCGCAGCAGGCTCGGGGGGG - Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
901925237 1:12561774-12561796 GAACCAGAGGTGGCTCAGACTGG - Intergenic
902258704 1:15207621-15207643 CAACCAGAGCCGGCAGGGAGGGG - Intronic
902704523 1:18195418-18195440 GGATCAGAACAGGCTTGGAGGGG + Intronic
903192820 1:21666383-21666405 GACCCAGTGCAGGCTCCAAGCGG - Intronic
903229154 1:21911444-21911466 GCCCCAGAGCAGGCAGGGAGTGG + Intronic
903262800 1:22140450-22140472 GAGCCCGAGCAGGCACAGAGGGG - Intronic
905875167 1:41427611-41427633 GAACTGGGGCAGCCTCGGAGGGG - Intergenic
905909111 1:41641671-41641693 GAACCAGAGCAGGCCCTGTGGGG + Intronic
906179298 1:43804706-43804728 GAGCCAGAGGAGGCTCGCTGTGG + Intronic
906196796 1:43934741-43934763 GATCCATAGGAGGCTGGGAGGGG + Intronic
906768568 1:48460929-48460951 GAACCAGAACAGGTTCAGAGAGG - Intronic
907103350 1:51857389-51857411 GAACCAGAATAGGTTCAGAGAGG - Intronic
907514810 1:54986803-54986825 GAACCAGAACAGGGTCCCAGTGG - Intronic
907751290 1:57265766-57265788 GACGGAGAGCAGGCTTGGAGTGG + Intronic
912207477 1:107524343-107524365 CACCCTGAGCAGGCTCTGAGAGG - Intergenic
912721731 1:112025872-112025894 GAAACAGAGCAGGCTGGATGTGG + Intergenic
913659820 1:120996683-120996705 GAACCAGAATAGGTTCAGAGAGG - Intergenic
914011177 1:143779807-143779829 GAACCAGAATAGGTTCAGAGAGG - Intergenic
914166657 1:145181323-145181345 GAACCAGAATAGGTTCAGAGAGG + Intergenic
914649800 1:149688462-149688484 GAACCAGAATAGGTTCAGAGAGG - Intergenic
918042471 1:180921633-180921655 AGAACAGAGCAGGCTGGGAGGGG - Intronic
921043145 1:211453560-211453582 GAACCAAAGCATGCTCGGTCAGG + Intergenic
921634320 1:217475146-217475168 AAACAAGAGAAGGCTCGGCGCGG + Intronic
922239745 1:223747993-223748015 GATTCAGAGCAGGCTAAGAGTGG - Intronic
923036583 1:230288770-230288792 AAAACAGTGCAGGCTCGGGGGGG - Intergenic
924475364 1:244378095-244378117 GAACCAGTGCAGGCCTGGTGTGG - Intronic
924953519 1:248906646-248906668 GGACCAGGGCAGGCTCGGGCGGG + Intronic
1066192095 10:33065466-33065488 AAACCAGAGTAGGCTCAGAGAGG - Intergenic
1067470683 10:46535753-46535775 GAACCTGAGCAGGGGCGGGGAGG - Intergenic
1068452271 10:57207126-57207148 AAACCATAGCAGGCTGGGCGCGG + Intergenic
1068561493 10:58519646-58519668 GAACCAGAATAGGTTCTGAGAGG + Intronic
1069040428 10:63690372-63690394 GATCCAGAGTATGCTCAGAGTGG + Intergenic
1071502990 10:86216766-86216788 GAAGCACAGCTGGCTCAGAGAGG + Intronic
1071939375 10:90572043-90572065 AAGCCAGAGTAGGCTCAGAGAGG - Intergenic
1073666093 10:105535378-105535400 AAACAAGGGCAGGCTCTGAGGGG + Intergenic
1075301802 10:121331374-121331396 GAGCAAGAGGAGGCTTGGAGAGG - Intergenic
1076516718 10:131049458-131049480 GAACCAGACAAGGCCTGGAGAGG - Intergenic
1076599985 10:131651051-131651073 GAGCCAGAGGGGGCTCGGGGAGG + Intergenic
1076790495 10:132774679-132774701 GAACCTGAGCAGGCTGGGCTGGG - Intronic
1077441658 11:2571807-2571829 GATTCAGAGCAGGCTCTGGGGGG + Intronic
1077610925 11:3642636-3642658 GGCCCAGAGCAGGCAGGGAGTGG - Intergenic
1077941513 11:6848479-6848501 GAACCAGAGCAGCCTAGATGTGG - Intergenic
1080492222 11:32778519-32778541 GAATCAGAGAAGGCCGGGAGTGG + Intronic
1082875529 11:57984544-57984566 TATCCAGAGCAGGCTGGAAGAGG + Intergenic
1083325584 11:61871414-61871436 GAGCCAGCGCAGGCTCCGAATGG - Intergenic
1083671662 11:64303549-64303571 GCAGCAGAGCAGGGTTGGAGGGG + Exonic
1083870220 11:65482901-65482923 GAACCAGAATAGGTTCAGAGAGG + Intergenic
1085389188 11:76173660-76173682 GAGACAGAGCAGGCCCGGAGGGG + Intergenic
1086810199 11:91300490-91300512 GGATCAGGGCAGGCTCAGAGAGG - Intergenic
1088120322 11:106361350-106361372 GAACCAGAGGAGGCTGGGCGCGG - Intergenic
1088406787 11:109490175-109490197 AAACCAGAACAGGCTGGAAGAGG + Intergenic
1090226287 11:125074028-125074050 GAAGCAGAGCTGGCTGGGAAGGG - Intronic
1091661964 12:2390997-2391019 GAACCAAGGCAGGGTCAGAGAGG + Intronic
1092013286 12:5134861-5134883 GAACCAGAGTAGGACAGGAGAGG + Intergenic
1092547088 12:9461610-9461632 GAACCACAGCGGGCTCTGAGAGG + Intergenic
1092816825 12:12319581-12319603 GAAGCAGGGCAGGCTGGGTGCGG - Intergenic
1094505850 12:31060454-31060476 GAACCACAGTGGGCTCTGAGAGG - Intergenic
1096203838 12:49705816-49705838 GCACCAGAGCTGGCTCAAAGAGG - Intronic
1096871755 12:54597043-54597065 GAACCAGAGAAGGCTTGCAGAGG + Intergenic
1100379836 12:94051241-94051263 GAGCCAGGGCAGGCTCAGGGTGG - Intergenic
1101678714 12:106943591-106943613 AAACCAGAGCAGGCCGGGCGCGG - Intergenic
1102377822 12:112437842-112437864 GAACCAGAATAGGTTCAGAGAGG + Intronic
1102556745 12:113731739-113731761 GAGCCAGAGGATGCTAGGAGGGG - Intergenic
1103568184 12:121827550-121827572 CCACCCGGGCAGGCTCGGAGCGG + Exonic
1105714078 13:23044101-23044123 AAACTAGAGGAGGCTGGGAGAGG - Intergenic
1107445336 13:40465609-40465631 CAACCAGGGCAGGCTGGGCGCGG - Intergenic
1109374284 13:61469610-61469632 GAAGCAGAGGATGCTCTGAGTGG - Intergenic
1110954682 13:81539477-81539499 GAACCAGAAGAAGTTCGGAGCGG + Intergenic
1112990305 13:105505500-105505522 GAACCACAGCAGACTCACAGAGG + Intergenic
1115976150 14:38999296-38999318 AAACCAGAGCAGTTTCAGAGGGG + Intergenic
1117724850 14:58662863-58662885 GAACCACAGGAGGCTTGCAGGGG - Intergenic
1118727103 14:68636796-68636818 ATACAAGAGCAGGCTGGGAGGGG + Intronic
1119406157 14:74401034-74401056 GAGCCACAGCAGGCTCCCAGAGG + Intergenic
1119752251 14:77087883-77087905 GAAGGAGTGCAGGCTCAGAGAGG - Intergenic
1121008800 14:90507774-90507796 GGACCAGGGCAGGCAGGGAGAGG - Intergenic
1121472732 14:94167786-94167808 GAACTAGACCAGGCTCCTAGTGG - Intronic
1121834605 14:97080507-97080529 AAACCAGAGAGGGCTCAGAGAGG - Intergenic
1122938137 14:104969338-104969360 GGGCTAGAGCAGGCACGGAGAGG - Intronic
1124617394 15:31251493-31251515 GACCCAGAGCTGGCTCCCAGAGG + Intergenic
1131038584 15:89242440-89242462 GCGCCAGTGGAGGCTCGGAGAGG + Intergenic
1132798893 16:1741793-1741815 GAACCAGGGCCGGCTGGGACTGG - Intronic
1132883760 16:2173494-2173516 AAACCAGAGCAAGCTCAGCGAGG + Exonic
1133265310 16:4579899-4579921 GTACCAGACCAGGCTGGGCGTGG - Intronic
1133762333 16:8809107-8809129 GAATAAGAGGAGGCTTGGAGAGG + Intronic
1134031891 16:10998756-10998778 GGACCAGAGCAGGGGCGGACAGG - Intronic
1134863703 16:17585250-17585272 GAACCAGTGGAGGCTCAGAAAGG - Intergenic
1134911088 16:18026963-18026985 TAACCAGAGTAGGCCGGGAGCGG - Intergenic
1135096170 16:19566583-19566605 GAGCCAGAGTAGGTTCAGAGAGG + Intronic
1136407793 16:30058770-30058792 GAAGCAGAGCAGGCCAGGCGTGG - Intronic
1137466282 16:48712769-48712791 AAACCAGAACAGGTTCAGAGAGG - Intergenic
1138142830 16:54583204-54583226 GCACCAGACCAGGCACAGAGGGG - Intergenic
1139975922 16:70810179-70810201 GAACTAGAGAAAGCTAGGAGAGG - Intronic
1141534589 16:84670299-84670321 CACCCAGTGCAGGCTCGGGGTGG - Intergenic
1141698985 16:85633840-85633862 GCACCAGAGCAGGGTCGGCAGGG - Intronic
1142428954 16:90016135-90016157 GCCCCAGAGCAGGCTGGGACTGG + Intronic
1143495759 17:7311867-7311889 GAGCCAGGCCAGGCTCGGGGAGG - Exonic
1143772453 17:9177349-9177371 GACCCAGAGCAGACTCTGGGTGG - Intronic
1144426043 17:15143378-15143400 GAACAAGAGCAGGTTTGGAATGG + Intergenic
1146002638 17:29140380-29140402 GAGCCAGAGCAGCATCAGAGCGG - Intronic
1146197213 17:30824218-30824240 GGACCAGAGCAGAATCCGAGGGG - Intronic
1148697053 17:49567050-49567072 GAACCACAGCAGCCTCTGATTGG - Intergenic
1148734220 17:49855683-49855705 GAAGGAGAGCAGGCTCGGGGTGG + Intergenic
1148856304 17:50580914-50580936 GAGCCTGAGCAGGCTGGGAGTGG + Intronic
1148906605 17:50916361-50916383 GAGACAGAGCAGGCTGGGGGTGG + Intergenic
1148974119 17:51511868-51511890 GAGACAGAGAAGGCTGGGAGAGG + Intergenic
1149140505 17:53427760-53427782 GAACCAGAAGAGGTTCAGAGAGG + Intergenic
1149311733 17:55401032-55401054 GAACCAGAATAGGTTCAGAGAGG - Intronic
1149981576 17:61315449-61315471 CATGCAGAGCAGTCTCGGAGCGG + Intronic
1150219182 17:63486497-63486519 GCTCCAGAGCAGCCTCTGAGCGG - Intronic
1151035366 17:70792622-70792644 GACCCAGAGCAGGCCAGGTGCGG - Intergenic
1151425429 17:74028149-74028171 GGAGCAGAGCAGGCTGGGCGCGG + Intergenic
1151791175 17:76307082-76307104 GACCCAGAGCTGGCTCAGAGTGG - Intronic
1151830418 17:76546059-76546081 GAAGCAGAGCCAGCTGGGAGTGG - Intronic
1152912531 17:83013436-83013458 GAACCAGAGGGGGTTGGGAGGGG - Intronic
1153567968 18:6439232-6439254 GGACCAGAGCAGGCTAGGGAAGG - Intergenic
1153659443 18:7314194-7314216 GAACCGGAGCAGCCTGGGGGTGG + Intergenic
1154406193 18:14093621-14093643 GAACCAGAGTATGTTCAGAGTGG + Intronic
1155509231 18:26560393-26560415 GAACCACTGCAGTCTAGGAGAGG - Intronic
1158628832 18:59094500-59094522 GAACCAGAGCTGGTTGGGACTGG + Intergenic
1159431334 18:68357139-68357161 GAAACAGAGCAGGATCGGGGGGG - Intergenic
1160099143 18:75904300-75904322 GAAGCAGAACAGGCCAGGAGTGG + Intergenic
1160764718 19:802351-802373 GACCAAGCGCAGGCTCGGGGAGG + Intronic
1161267169 19:3369719-3369741 GGCCCAGAGCAGGCGCGGGGAGG - Intronic
1163022316 19:14489211-14489233 AAACCATAGCAGGCTGGGTGTGG - Intronic
1163126963 19:15249527-15249549 GAAGCTGAGCAGGCTGGGGGCGG - Intronic
1163646003 19:18489506-18489528 GTGCCAGAGCTGGCTGGGAGAGG - Intronic
1164175690 19:22772004-22772026 GTGCCAGAGCAGGCTGGGCGCGG - Intronic
1165128680 19:33618967-33618989 GAACCAGAACAGGCTGGGCATGG - Intergenic
1166295695 19:41888203-41888225 GAACCAGGCCAGGCCGGGAGGGG - Exonic
1167151642 19:47713577-47713599 GAACCAGGGCAGGCTTGGGCGGG - Intronic
1167516259 19:49924732-49924754 GAACTAGAACAGGCTGGGAGGGG + Intronic
925153454 2:1633286-1633308 CAACCAGGGCCGGCTGGGAGCGG + Exonic
925234625 2:2267057-2267079 GAACCAGAGCAAGCCAGGTGGGG + Intronic
925971956 2:9112279-9112301 GACACATTGCAGGCTCGGAGGGG - Intergenic
926159485 2:10477603-10477625 GGAAGAGAGCAGGCTCAGAGGGG - Intergenic
928446360 2:31336924-31336946 GAACCAGCCCAGCCTCTGAGTGG - Intronic
929044059 2:37773508-37773530 GAGCAAGAGGAGGCTGGGAGGGG + Intergenic
929086855 2:38176527-38176549 TGGCCAGAGCAGGCTCTGAGAGG + Intergenic
929551330 2:42894879-42894901 AAACCAGAATAGGCTCTGAGAGG - Intergenic
931372687 2:61678336-61678358 AAACCAGAACAGGTTCAGAGAGG - Intergenic
932412501 2:71555603-71555625 GAACCAGAGCAGGCTCGGAGAGG + Intronic
932878173 2:75474699-75474721 GTATCAGACCAGGCTCGGGGAGG - Intronic
933902344 2:86859114-86859136 GACCCAGGACAGGCTGGGAGAGG + Intronic
935202568 2:100870680-100870702 TAAGCAGAGAAGGCTGGGAGTGG - Intronic
935232447 2:101110684-101110706 GAACCAGAACAGGCCAGGCGCGG + Intronic
935734131 2:106092766-106092788 AAACCTGAGCAGGCGCTGAGAGG - Intergenic
935778201 2:106490154-106490176 GACCCAGGACAGGCTGGGAGAGG - Intergenic
936400031 2:112157872-112157894 GAACCAGGACAGGCTGGGTGCGG - Intronic
937713074 2:125000204-125000226 AAACCAGATTAGGCTCAGAGAGG - Intergenic
938901882 2:135805334-135805356 GGGCCAGAGCAGGCTCCCAGAGG - Intronic
941759302 2:169223745-169223767 GAACCAGAGGAGCCTCCAAGGGG + Intronic
941821738 2:169850467-169850489 GATCCAGAGCAGGCCGGGTGCGG - Intronic
941863336 2:170308046-170308068 GAGCCAGAGCAGGCTAGATGTGG - Intronic
942177591 2:173349345-173349367 GAACCAGAGTAGGTTCAGAGAGG + Intergenic
944440474 2:199738198-199738220 GAACTAGAGAAGGCTGGGATGGG - Intergenic
944504625 2:200397926-200397948 CAGCCAGAGCAGGCAGGGAGAGG + Intronic
947887432 2:233584810-233584832 GAAGCAGAGCAGGCTGAGAGAGG + Intergenic
947889244 2:233602496-233602518 GAAGCAGAGCAGGCAGAGAGAGG + Intergenic
948902960 2:240965401-240965423 GAACCAGAGGAGGAGTGGAGAGG + Intronic
1168851887 20:982704-982726 CAACCAAAGTAGGCTCAGAGAGG - Intronic
1172483427 20:35284917-35284939 GAACGCGAGCAGGCTAGGCGTGG - Exonic
1173208385 20:41012750-41012772 GGCCCAGAGCAGGCTCACAGAGG + Intergenic
1173323141 20:42007682-42007704 GAATAAGAACAGCCTCGGAGAGG - Intergenic
1173498592 20:43536190-43536212 GAACCAGAGCCGGCTGAAAGCGG + Exonic
1174037243 20:47675764-47675786 AAGCCAGGGCAGGCTTGGAGAGG - Intronic
1174056242 20:47800350-47800372 GCACCAGGCCAGGCTCAGAGAGG - Intergenic
1174481116 20:50832195-50832217 GAGCCAGGGTAGGCTCAGAGAGG - Intronic
1174770061 20:53291179-53291201 TATCAAGAGCAGGCTGGGAGCGG + Intronic
1175324095 20:58110545-58110567 GAACCAGAACAGGGATGGAGAGG - Intergenic
1175992724 20:62797420-62797442 GGACCCCAGCAGGCACGGAGGGG - Intronic
1176309862 21:5143739-5143761 GAATCAGAGAAGGCCCAGAGGGG + Intronic
1177266752 21:18796099-18796121 GAACCAGAACAGGTTCAGAGAGG - Intergenic
1179347791 21:40577459-40577481 GAAGGACAGCCGGCTCGGAGGGG - Intronic
1179840949 21:44072928-44072950 AAACCACAGCAGGCCTGGAGCGG - Intronic
1179847194 21:44118293-44118315 GAATCAGAGAAGGCCCAGAGGGG - Intronic
1180032768 21:45223690-45223712 AAACCAGAGCAGGGGCAGAGGGG + Exonic
1182903649 22:33919777-33919799 GAAGCCGAGCAGGCCCTGAGGGG + Intronic
1183380272 22:37487168-37487190 GAGCCAGTGCAGGCTCTGAGTGG - Intergenic
1184051249 22:42006521-42006543 GAAACAAAGCCGGCTGGGAGCGG - Intronic
1184398594 22:44260521-44260543 AAATCAGAGGAGGCTTGGAGAGG + Intronic
1185130253 22:49034951-49034973 GATCCAGAGCAAGCTCGGGAGGG + Intergenic
1203296181 22_KI270736v1_random:44904-44926 GAGCAAGAGGAGGCTGGGAGGGG + Intergenic
949925946 3:9041808-9041830 GAAACAGATGAGGCTGGGAGTGG + Intronic
959067111 3:101668813-101668835 GAAACAGAATAGGCTCAGAGAGG - Intronic
961003250 3:123388231-123388253 TAACCAGGGCAGGTTGGGAGGGG + Intronic
961414594 3:126748107-126748129 GTAACAGAGCAGGCTCTAAGAGG - Intronic
962023757 3:131526759-131526781 GAACCATAGCAGGGGCGGATGGG - Intergenic
962257731 3:133883908-133883930 GGACCAGAGGAGGCTGGAAGAGG + Intronic
962937167 3:140091673-140091695 GAACCACAGAAGGCCCAGAGTGG - Intronic
964832358 3:160898440-160898462 ACACCAGAGCAGTCTCTGAGAGG - Intronic
965267928 3:166571669-166571691 GAACCAGAGTTGGTTCAGAGTGG + Intergenic
966748473 3:183300324-183300346 GAACCTGAGAAAGCTCGGAATGG + Intronic
966850344 3:184161012-184161034 GAGCCAGAGCTGGATGGGAGTGG + Intronic
967870321 3:194224124-194224146 GAAGTAGAGGAGGCTTGGAGGGG - Intergenic
967884358 3:194322987-194323009 GAAACAGAGCTGGCCTGGAGAGG + Intergenic
968476573 4:812974-812996 GAAACTGAACAGGCTGGGAGCGG + Intronic
968954267 4:3710298-3710320 GCACCAAAGCAGGCTCAGAGAGG - Intergenic
969311687 4:6356654-6356676 GAACAGGACCAGGCTCAGAGTGG + Intronic
972897626 4:43643513-43643535 AAACCAGATCAGGCTTGAAGAGG - Intergenic
981719687 4:147788603-147788625 GGAGCAGAGCAGGCTGGTAGAGG - Intronic
982452778 4:155572602-155572624 GAACCATAACAGGCTGGGCGCGG + Intergenic
985798357 5:1982781-1982803 GATACAGAGCAGACTCAGAGAGG + Intergenic
988993623 5:36693972-36693994 GAATCAGAGGAGGCAAGGAGAGG - Intergenic
991048569 5:62248463-62248485 GAAACAGACCAGGCGGGGAGCGG + Intergenic
991921557 5:71662651-71662673 GAACCTGAGGAGGATGGGAGGGG + Intergenic
993498841 5:88640399-88640421 TAACCAGATCAGCCTCAGAGAGG + Intergenic
996265681 5:121536446-121536468 GAACCAGATCAGGCTAAGAGGGG + Intergenic
996799047 5:127381959-127381981 AAACCAGAACAGGCTGGGTGCGG - Intronic
999227702 5:150040806-150040828 AAATCAGATCAAGCTCGGAGAGG + Exonic
1001268378 5:170291705-170291727 GAAGCAAGGCAGGCTCAGAGAGG + Intronic
1002444261 5:179279579-179279601 GTGCCCGAGCAGGCTCTGAGAGG - Intronic
1003082678 6:3034440-3034462 GACCCAGAGAAGCCTCCGAGGGG + Intergenic
1003332377 6:5140268-5140290 GAACCAGAATAGGCTCACAGAGG - Intronic
1003919648 6:10821237-10821259 GAATCATAGCAGGCTGGGTGTGG - Intronic
1004587502 6:17016272-17016294 GAAGCAGAGGAGGCGCTGAGAGG + Intergenic
1006707482 6:36033603-36033625 GAACCAGTGGAGGCTGGGTGTGG - Intronic
1006811440 6:36822823-36822845 ACAACAGAGCAGGCTGGGAGGGG - Intronic
1007304130 6:40891213-40891235 GAACAAGAGCAGGCTTCAAGGGG + Intergenic
1007768156 6:44173316-44173338 GAGCCTGAGCAGGTTCTGAGGGG - Exonic
1010632640 6:78216809-78216831 GAACCAGACCAAGCCAGGAGTGG - Intergenic
1011145863 6:84215424-84215446 CAACCATAGTAGTCTCGGAGTGG - Exonic
1011355629 6:86470206-86470228 GAACCAGAATAGGTTCAGAGAGG - Intergenic
1014119151 6:117703045-117703067 GAGCCAGAGCAGCCTCAGAGAGG - Intronic
1015029779 6:128580684-128580706 GAACCAGAGCCTGCGCGGCGTGG - Intergenic
1016135595 6:140537984-140538006 GACCCAGAGCAGATTCGCAGTGG + Intergenic
1017010865 6:150063308-150063330 GAACCAGACCAGGCTAACAGAGG + Exonic
1017126111 6:151066144-151066166 GAACCACAGGAGGCTGGGCGCGG + Intronic
1018513678 6:164554862-164554884 CAAGTAGAGCAGGCTGGGAGAGG - Intergenic
1019916510 7:4136508-4136530 GAACCACAGCAGGCACCTAGAGG + Intronic
1025099380 7:56122707-56122729 GAACCAGACCAGACAAGGAGTGG - Intergenic
1025187258 7:56870953-56870975 GAACCAGACCAGACAAGGAGTGG - Intergenic
1025236756 7:57239805-57239827 GCACCAGGCCAGGCTCAGAGAGG + Intergenic
1025684665 7:63705967-63705989 GAACCAGACCAGACAAGGAGTGG + Intergenic
1025976093 7:66371233-66371255 GAAACAGGGCTGGCTGGGAGTGG + Intronic
1027129020 7:75577707-75577729 AAACCAGAGCAGGCTGGGCACGG + Intronic
1032541137 7:132704033-132704055 GGACCAGAGCAGTCACGGGGTGG + Intronic
1033709692 7:143929359-143929381 AAACCAGAGGATGCTAGGAGGGG + Intergenic
1034625945 7:152492829-152492851 GAACCAGGACAGGCTCAGAGGGG + Intergenic
1035597512 8:870564-870586 GAACCAGAGCAGGAAGTGAGAGG - Intergenic
1038122631 8:24635011-24635033 GAGCCAGCGTAGGCTCAGAGAGG + Intergenic
1039573120 8:38602698-38602720 GAACTGGAGCAGGGTGGGAGTGG + Intergenic
1040444029 8:47475306-47475328 GGCCCAGAGCATGCTCGGATTGG + Intronic
1042855992 8:73268187-73268209 GAAACATAGCAGGCTGGGCGCGG + Intergenic
1043418471 8:80075303-80075325 GAAACAGAGCAGGAGGGGAGGGG + Intronic
1043943729 8:86226533-86226555 AAGCCAGAGGAGGCTCAGAGTGG - Intronic
1046613649 8:116452325-116452347 GAACCAGAATAGGTTTGGAGAGG - Intergenic
1046821265 8:118636682-118636704 GAGCCAGAGCAGGCTGGCAGTGG + Intergenic
1048886354 8:138913053-138913075 GACCTAGAGAAGGCTGGGAGAGG + Intronic
1049362384 8:142218442-142218464 CAACCAGACCAGGCTCTGAGTGG - Intronic
1049717614 8:144100377-144100399 GAACCAAAGCAGGCCCTCAGTGG + Intronic
1052271737 9:26634657-26634679 GGACCACAGCAGCCTCCGAGAGG + Intergenic
1057601635 9:96463234-96463256 AAACTAAAGCAGGCTAGGAGTGG - Intronic
1060662527 9:125412889-125412911 GGCCCAGAGCAGGCAAGGAGGGG - Intergenic
1060743377 9:126114026-126114048 CAACCAGAGCTGGCTGGCAGTGG + Intergenic
1061202098 9:129143803-129143825 GACCCAGGGCAGAGTCGGAGTGG - Intronic
1061542480 9:131285088-131285110 GAACAAGTGCAGGCCCAGAGTGG - Intergenic
1061798033 9:133099790-133099812 GAACCAGTGCAGGCTCAGAGTGG - Intronic
1186100281 X:6148802-6148824 GAACCAGTGCAGGCCAGGCGCGG - Intronic
1189392569 X:40588739-40588761 GAACCAGAATAGGTTCAGAGAGG + Intronic
1190104660 X:47550955-47550977 GAACCAGAATAGGTTCAGAGAGG + Intergenic
1190280493 X:48926104-48926126 GAGCCAGAACAGGCTCAGCGAGG + Intronic
1190739691 X:53280829-53280851 GAGCCAGAGCAAGCTGGGAGTGG + Intronic
1192562788 X:72138608-72138630 GAACCTCACCAGGCACGGAGTGG + Exonic
1195207977 X:102623264-102623286 GAACCACATCAGGCTAAGAGTGG - Intergenic
1195919230 X:109966132-109966154 GAAGAAGAGCAGGCTGGGATGGG + Intergenic
1196013074 X:110908740-110908762 GAACTAGAGAAGGCCGGGAGTGG - Intergenic
1196685724 X:118508893-118508915 GAAGCAGGGCAGGCAGGGAGAGG - Intronic
1198098355 X:133402372-133402394 CTACCAGAGCAGGCTGGAAGTGG - Intronic