ID: 932413198

View in Genome Browser
Species Human (GRCh38)
Location 2:71559221-71559243
Sequence GTGTAGCCCCAGACGCAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932413198_932413199 -9 Left 932413198 2:71559221-71559243 CCGTGCTGCGTCTGGGGCTACAC 0: 1
1: 0
2: 0
3: 3
4: 110
Right 932413199 2:71559235-71559257 GGGCTACACATGTTGCAGACAGG 0: 1
1: 0
2: 0
3: 6
4: 71
932413198_932413202 24 Left 932413198 2:71559221-71559243 CCGTGCTGCGTCTGGGGCTACAC 0: 1
1: 0
2: 0
3: 3
4: 110
Right 932413202 2:71559268-71559290 TCCCAGCACTGTCTTTTCCTGGG 0: 1
1: 0
2: 2
3: 41
4: 321
932413198_932413201 23 Left 932413198 2:71559221-71559243 CCGTGCTGCGTCTGGGGCTACAC 0: 1
1: 0
2: 0
3: 3
4: 110
Right 932413201 2:71559267-71559289 CTCCCAGCACTGTCTTTTCCTGG 0: 1
1: 0
2: 3
3: 40
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932413198 Original CRISPR GTGTAGCCCCAGACGCAGCA CGG (reversed) Intronic
900567072 1:3338729-3338751 CTGGAGCCCCAGAGGCAGCCAGG + Intronic
900758534 1:4454636-4454658 TGGAAGCCCCAGACCCAGCATGG + Intergenic
901827620 1:11872658-11872680 CTATAGCCCCAGAAGCAGCTCGG - Intergenic
904975084 1:34449752-34449774 GAGCAGCCCCAGGGGCAGCAGGG + Intergenic
906025958 1:42674055-42674077 CTGTAGCCTCATATGCAGCATGG - Intronic
908817355 1:68047900-68047922 GTGCAGCCCCAGAAGAGGCATGG + Intronic
917662191 1:177187547-177187569 ATGAAGCCCCAGAAGCTGCAAGG - Intronic
923009541 1:230077192-230077214 GGAAAGCCCCAGAGGCAGCAAGG - Intronic
1068958814 10:62845703-62845725 GAGTAGCCCCAGGCCCACCAAGG - Intronic
1069785899 10:70987775-70987797 GGGTTGCCCCTGAAGCAGCATGG + Intergenic
1073846771 10:107565961-107565983 GTGTGTCCCCATACACAGCAAGG - Intergenic
1074870373 10:117571263-117571285 GTGAAGTCCCAGCCCCAGCAGGG - Intergenic
1075048483 10:119165101-119165123 GTGCTGCCCTAGACGCTGCAGGG + Intronic
1076721251 10:132394314-132394336 CTGTAGGCACAGCCGCAGCAAGG - Intergenic
1077250342 11:1558034-1558056 GTGTGGCCACAGACACAGGAGGG - Intronic
1078655683 11:13236649-13236671 GAGGAGCCACAGAGGCAGCATGG + Intergenic
1081957107 11:47103054-47103076 GTGTGGCCCCAAAGGCAGGAAGG + Intronic
1083144227 11:60746705-60746727 CTGTAGGCCCAGACTAAGCAAGG - Intergenic
1084416492 11:69035739-69035761 GTGAAGCCCCAGGAGAAGCAGGG - Intergenic
1088729377 11:112667396-112667418 GTGTAGGTCCAGAGGCTGCAAGG - Intergenic
1096514026 12:52146631-52146653 GTGGAGCCCCAGACTCTCCAGGG + Intergenic
1097981292 12:65740573-65740595 GTGAAGCCCCACAGGCTGCAAGG - Intergenic
1104970975 12:132530570-132530592 GTGGAGACCCAGAAGCAGAAGGG - Intronic
1105067940 12:133216613-133216635 GTGCAGCCCCAGGGACAGCAAGG - Intergenic
1105827932 13:24139133-24139155 GTGTAGACCCAGGAACAGCAAGG - Intronic
1108687495 13:52833402-52833424 GTGCAGGCCCAGCCGCTGCATGG - Intergenic
1108960154 13:56216959-56216981 GTGTAGCCCTTGAAGCAGGAAGG - Intergenic
1113064829 13:106362219-106362241 GAGTAGCCCCGGACTCAGGATGG + Intergenic
1113517267 13:110913612-110913634 ATGTAGCACCAGGGGCAGCAAGG + Intronic
1118057350 14:62093859-62093881 GTGAAGCCCCTGAGTCAGCAGGG - Intronic
1119732367 14:76958922-76958944 GTGGAGCCCCAGGCTCAGAAGGG - Intergenic
1121310102 14:92931322-92931344 GTGAAGCCACAGACGGAGCCAGG + Exonic
1121442002 14:93955388-93955410 GTGAAGCAACAGACCCAGCAAGG + Intronic
1123050834 14:105541248-105541270 TTGCAGCCCAAGACCCAGCAAGG - Intergenic
1124585691 15:31004397-31004419 AGGTAGCCACAGAAGCAGCAGGG - Intronic
1129344801 15:74910337-74910359 GAGAAGCCCCAGGCCCAGCAAGG - Intergenic
1130564022 15:84979924-84979946 TTGGAGCCCCAGAAGCGGCAAGG + Intergenic
1131355575 15:91742902-91742924 GTCTAGCCCCAGCCCCAGAAGGG - Intergenic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1132634976 16:939595-939617 GGGTCGCCGCAGACACAGCAGGG - Intronic
1132860960 16:2071594-2071616 ATGTAGTCGCAGACGCAGTAGGG - Exonic
1133236328 16:4388940-4388962 CTTTAGCCCCTGGCGCAGCAGGG - Intronic
1139346072 16:66304715-66304737 GTGATGCACCAAACGCAGCATGG + Intergenic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1140530341 16:75660368-75660390 ATCTTGCCCCAGAGGCAGCAGGG + Intronic
1140774085 16:78233946-78233968 GTTTGGCCCCAGAGGCATCAGGG + Intronic
1142237334 16:88928387-88928409 GTGTGGCCACAGAGGCAGCTTGG - Intronic
1142425239 16:89999099-89999121 GTGTAGCTGCAGACACAGCTGGG + Intergenic
1142719370 17:1766219-1766241 GTGGGGCCCCAGCCCCAGCAGGG - Intronic
1146000726 17:29128798-29128820 GTCTATCCCCAGACTTAGCATGG + Intronic
1151232348 17:72694028-72694050 GTCCAGCCCCAGACTGAGCAAGG - Intronic
1151653409 17:75484086-75484108 GTGTAGGCCCCGACGACGCAGGG - Intronic
1152274678 17:79349339-79349361 GAGTGACCCCAGACCCAGCAAGG - Intronic
1153743936 18:8157831-8157853 TTCCAGACCCAGACGCAGCAAGG + Intronic
1154104237 18:11506280-11506302 CTGAAGCCCCTGACGCAGCTGGG - Intergenic
1156486828 18:37471713-37471735 GGGAAGCCCCAGGGGCAGCAGGG + Intronic
1166140332 19:40802000-40802022 CTGTGGCCCCAGACCAAGCACGG + Intronic
1166979376 19:46623743-46623765 GTGTTGGCCCAGGCCCAGCAGGG + Exonic
1167423210 19:49415695-49415717 GTGGAGCCCCAGTCTCTGCAAGG - Intronic
925210461 2:2041395-2041417 GAGTAGACCAAGACCCAGCAGGG - Intronic
930077452 2:47418439-47418461 GTGTAGGCCCAGACTCTGCTTGG - Intronic
932413198 2:71559221-71559243 GTGTAGCCCCAGACGCAGCACGG - Intronic
937407214 2:121641301-121641323 GTGTAGCCCCAGAAGCACTTGGG + Intronic
939619720 2:144404061-144404083 TTGTAGCCCCGGTCGCAGTAGGG + Exonic
942195958 2:173520330-173520352 GTGTAGCCTCAGAAGGAGCCAGG + Intergenic
946517879 2:220432971-220432993 GAGGAGCCCCAGAGGAAGCAGGG - Intergenic
947241500 2:227999343-227999365 GTGCAGCCAAAGAGGCAGCATGG + Intronic
948587444 2:239028176-239028198 GGGTGGGCCCAGGCGCAGCATGG + Intergenic
1168888180 20:1274969-1274991 GTGCAGCCCCAGAGGGAGAAGGG + Intronic
1170894039 20:20398370-20398392 GTGCATCCCCAGACGCAGCCTGG + Intronic
1171235456 20:23520779-23520801 GTGTATCTTCAGAGGCAGCAGGG + Intergenic
1173430373 20:42982565-42982587 GTGAAGGCCCTGAGGCAGCAAGG + Intronic
1175820712 20:61907367-61907389 GTGTGGCCACAGCCTCAGCAAGG + Intronic
1181517130 22:23421269-23421291 AAGGAGCCCCAGAAGCAGCATGG + Intergenic
1183359343 22:37375514-37375536 GCACAGCCCCAGGCGCAGCATGG + Exonic
1185226057 22:49653485-49653507 GTGCAACCCCACACACAGCATGG - Intronic
950454611 3:13085257-13085279 GAGCAGCCCCAGTAGCAGCAAGG + Intergenic
952487578 3:33830227-33830249 GTGAAGCCCCAGACACATCTGGG - Intronic
953881869 3:46694920-46694942 GTGGAGCCCCTCAGGCAGCAGGG - Intergenic
954438563 3:50509087-50509109 GTGTAGCCTCACAGGCAGCATGG + Intergenic
958855153 3:99376375-99376397 CTTTAGCCCCTGGCGCAGCAGGG + Intergenic
961794598 3:129400756-129400778 GAATAGCCACAGATGCAGCAGGG - Intergenic
968983052 4:3861053-3861075 GTGTAACCCCAAAGCCAGCAGGG + Intergenic
969075589 4:4575400-4575422 GCGCCGCCCCAGACGCCGCAGGG + Intergenic
969715935 4:8868163-8868185 GTGTCTCCCCAGCCGCCGCAGGG + Exonic
969725549 4:8916125-8916147 GTGTTGCCCAAGAAACAGCAAGG - Intergenic
974954074 4:68617198-68617220 GTGTAGCCCAAGACCTAGCAAGG + Intronic
985886976 5:2687393-2687415 GTGAAGCCCCACAGCCAGCAAGG - Intergenic
987103546 5:14614732-14614754 GTGTGGCCCAAGAGCCAGCATGG + Intronic
987465830 5:18270755-18270777 ATGTAGCCCCAGGCACAGAATGG - Intergenic
990810121 5:59714065-59714087 GTGCAGACCCAGACCAAGCAGGG - Intronic
992096808 5:73370308-73370330 TTGTGGCCTCAGACTCAGCAGGG + Intergenic
997960292 5:138315945-138315967 GTGTAGCTCCAGCAGCACCAGGG - Intronic
999891950 5:155987573-155987595 ATGAAGCCCCAAACTCAGCATGG + Intronic
1000228523 5:159293286-159293308 GTCTTGCCCCACACCCAGCAGGG - Intergenic
1001088387 5:168718429-168718451 GTCTTGCCCCAGTCGCAGGAGGG - Intronic
1002309369 5:178305537-178305559 GTATCGCCCCACACTCAGCACGG - Intronic
1019365951 7:632891-632913 GTGTGGCCCCAGGCTCAGGAGGG - Intronic
1021150633 7:17146855-17146877 GTGTAGCCCCAGACACTACGTGG - Intergenic
1021942308 7:25689744-25689766 GTGCAGCCCCAGGTGCAGGATGG + Intergenic
1022812258 7:33881380-33881402 GTGTAGCAGCAGATGCAGGAAGG + Intergenic
1030891392 7:115003367-115003389 GAGTATCCCCAGACTTAGCAAGG + Intronic
1032688215 7:134257071-134257093 GAGTAGTCCCTGACTCAGCAAGG - Intronic
1038992111 8:32879027-32879049 ATGTAGCCCTAGACCCAGAAAGG - Intergenic
1039846413 8:41328958-41328980 CTGCAGCCCCAGCCGCAGCTTGG + Intergenic
1047971904 8:130091913-130091935 GTGGAGCCCCACACGCTGCCTGG + Intronic
1049265175 8:141664065-141664087 GTGGAGACCCAGGCCCAGCAGGG - Intergenic
1049798781 8:144508380-144508402 CTGAAGCCACAGACACAGCAAGG + Intergenic
1049816576 8:144605887-144605909 GGCCAGCCCCACACGCAGCAGGG + Intergenic
1056705877 9:88952500-88952522 GTGTGGCCCCAGGATCAGCAGGG - Intergenic
1056879966 9:90381524-90381546 GTGTAGCCCCAGGGTCAGCCAGG - Intergenic
1061203175 9:129148679-129148701 GTGTGGACCCAGACACAGGAGGG - Exonic
1062015690 9:134290045-134290067 GGGTGGCCTCAGACGCACCAGGG - Intergenic
1187705796 X:22008177-22008199 GTGTAGCCCAGGAGGCAGTAAGG + Intergenic