ID: 932413294

View in Genome Browser
Species Human (GRCh38)
Location 2:71559699-71559721
Sequence TAACGCCTGCTGGCCCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932413289_932413294 0 Left 932413289 2:71559676-71559698 CCTTCCCACTCTTTGGGCCTTAC 0: 1
1: 0
2: 0
3: 16
4: 204
Right 932413294 2:71559699-71559721 TAACGCCTGCTGGCCCTGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 104
932413284_932413294 16 Left 932413284 2:71559660-71559682 CCATCAGCCAGGACGCCCTTCCC 0: 1
1: 0
2: 5
3: 28
4: 332
Right 932413294 2:71559699-71559721 TAACGCCTGCTGGCCCTGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 104
932413285_932413294 9 Left 932413285 2:71559667-71559689 CCAGGACGCCCTTCCCACTCTTT 0: 1
1: 0
2: 0
3: 39
4: 552
Right 932413294 2:71559699-71559721 TAACGCCTGCTGGCCCTGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 104
932413288_932413294 1 Left 932413288 2:71559675-71559697 CCCTTCCCACTCTTTGGGCCTTA 0: 1
1: 0
2: 4
3: 30
4: 234
Right 932413294 2:71559699-71559721 TAACGCCTGCTGGCCCTGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 104
932413290_932413294 -4 Left 932413290 2:71559680-71559702 CCCACTCTTTGGGCCTTACTAAC 0: 1
1: 0
2: 0
3: 10
4: 98
Right 932413294 2:71559699-71559721 TAACGCCTGCTGGCCCTGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 104
932413291_932413294 -5 Left 932413291 2:71559681-71559703 CCACTCTTTGGGCCTTACTAACG 0: 1
1: 0
2: 0
3: 2
4: 66
Right 932413294 2:71559699-71559721 TAACGCCTGCTGGCCCTGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932413294 Original CRISPR TAACGCCTGCTGGCCCTGCC AGG Intronic
901871179 1:12140189-12140211 CAAGGCCTGCAGGCCATGCCAGG - Intronic
902608160 1:17580745-17580767 TGCTGGCTGCTGGCCCTGCCTGG + Intronic
903785592 1:25859224-25859246 TTACGCCTCCAGGCCCTACCTGG + Intronic
905839414 1:41162220-41162242 AAATGCCTGCTCCCCCTGCCTGG + Intronic
905882729 1:41475105-41475127 TCAGGCCTGCTGCCCCTCCCTGG + Intergenic
906718667 1:47989444-47989466 TAATACTTGCTGGCCCCGCCAGG + Intronic
906735372 1:48120998-48121020 ACATTCCTGCTGGCCCTGCCTGG - Intergenic
910980650 1:92957519-92957541 AAACGTCTGTTGGCCCTTCCAGG + Intronic
911008482 1:93253267-93253289 TGAGACCTGCTGGCCCTGTCTGG - Intronic
922774764 1:228209528-228209550 GATCCCCAGCTGGCCCTGCCAGG - Intronic
923468939 1:234273134-234273156 TCACTCCAGCTGTCCCTGCCTGG + Intronic
1066345298 10:34579402-34579424 TAACGCCCCCTGCCCCTCCCAGG + Intronic
1067405970 10:46023602-46023624 AGACGCCTGCTGCCCCCGCCCGG + Intronic
1075044975 10:119139630-119139652 CATCCCCTGCTGGCACTGCCTGG - Intergenic
1075671803 10:124268106-124268128 GAACCCCTGCTGGCTCTGTCTGG + Intergenic
1076157989 10:128218148-128218170 TTACGCCTGCAGGCACTGCCTGG + Intergenic
1076820669 10:132937832-132937854 TGGCACCTGCTGGCCCTTCCTGG - Intronic
1078067464 11:8087796-8087818 AAATGCCTGAGGGCCCTGCCAGG - Intronic
1079450546 11:20597203-20597225 TTTCGCCCGCTGGCCCTCCCCGG - Intergenic
1081209103 11:40309937-40309959 TCCCTCCTGCTGGCCCTGCCTGG + Intronic
1081794089 11:45807878-45807900 TCATTCCTGCTGACCCTGCCAGG + Intronic
1096686862 12:53293782-53293804 CAAAGCCTGCTGGGCCTGGCTGG + Intergenic
1105041781 12:132966798-132966820 AAATGCCTGCTCCCCCTGCCTGG + Intergenic
1119036091 14:71231430-71231452 AAATGCCTGCTTGCGCTGCCTGG + Intergenic
1122144714 14:99682849-99682871 TAACTCAGGCTGGCCCTGCTGGG - Intergenic
1202849702 14_GL000225v1_random:9048-9070 TAACCCCTGCAGGCACGGCCTGG - Intergenic
1130227679 15:82072386-82072408 TCAGGCCTGCTGGGCCTGGCAGG + Intergenic
1131272811 15:90957209-90957231 TAACGCCTCCGGCCCCGGCCCGG - Exonic
1132746605 16:1438825-1438847 GAGCGCCTGCGGGCCCTGCAGGG - Exonic
1133234512 16:4381697-4381719 CTAAGCCTGCAGGCCCTGCCTGG + Exonic
1139373187 16:66480821-66480843 TCAGGCCTGCTGCCACTGCCGGG + Exonic
1139505298 16:67395491-67395513 TCACTGCTGCTGGCCCGGCCTGG + Exonic
1139775084 16:69311725-69311747 TCAGGCCTTCCGGCCCTGCCCGG + Intronic
1141650708 16:85391468-85391490 CATCGCCGGCTGGACCTGCCAGG - Intergenic
1150057314 17:62030250-62030272 CACCGTGTGCTGGCCCTGCCTGG - Intronic
1150696656 17:67411391-67411413 TACCTCCTGCTGGCCATCCCTGG - Intronic
1152168260 17:78724834-78724856 TCAGGCCTGGTGGCACTGCCTGG - Intronic
1152742411 17:82024096-82024118 AAACACCTGCAGCCCCTGCCAGG - Intronic
1154246288 18:12702608-12702630 TAACGCTCCCTGGCCCGGCCGGG - Exonic
1156911511 18:42416432-42416454 TAAGGGCTGCTGGTGCTGCCTGG - Intergenic
1161224524 19:3136880-3136902 TAGGGCGTGCTGGGCCTGCCCGG - Intronic
1161345944 19:3768777-3768799 TAACAGCCACTGGCCCTGCCTGG + Intergenic
1161724956 19:5923404-5923426 GGACGCCTGCTGCCCCTGGCAGG + Intronic
1162584748 19:11551964-11551986 TAAGGTCTGCTAGCCCTGGCAGG - Intronic
1164631832 19:29766931-29766953 TGACGCATACTGGCCCTCCCTGG - Intergenic
1167250984 19:48398373-48398395 CATCGCCTGCGGGCCCCGCCGGG - Exonic
1167506220 19:49872535-49872557 TAACTCCTGCTTGGCCTCCCAGG + Intronic
1167510877 19:49894845-49894867 GACCTCCAGCTGGCCCTGCCTGG - Intronic
1168354577 19:55693126-55693148 TAAGTCCAGCCGGCCCTGCCTGG - Intronic
925915826 2:8605035-8605057 TATCTCCTGATGGACCTGCCTGG - Intergenic
927243352 2:20937519-20937541 TATCAACTGCTGGCCCTGCATGG - Intergenic
929944034 2:46356996-46357018 TATCTCCTGCTGGCCCTGCATGG + Intronic
930124205 2:47783472-47783494 TAGCGCCTGCTGCCCCCACCAGG + Exonic
932280033 2:70482860-70482882 TAAAGCCTGCTGGCACACCCAGG + Intronic
932413294 2:71559699-71559721 TAACGCCTGCTGGCCCTGCCAGG + Intronic
933111546 2:78408041-78408063 TAAAGAATGCTGGGCCTGCCTGG + Intergenic
937909721 2:127069529-127069551 CAAAGCCTGCTGTCTCTGCCAGG - Intronic
947579033 2:231300483-231300505 TCCCGCCTGCTGGCAGTGCCGGG + Intronic
948456836 2:238108476-238108498 CATCAGCTGCTGGCCCTGCCCGG + Intronic
948646183 2:239406576-239406598 GAACTCCTGCTTGCCCAGCCTGG - Intergenic
948772017 2:240256326-240256348 GAGCGCTTGCTGGCCATGCCTGG + Intergenic
1169756871 20:9052304-9052326 TACTGCCTGCTCGACCTGCCGGG - Intergenic
1170421866 20:16201146-16201168 TAAAGCTTGCTGGCCCTGGCTGG - Intergenic
1170571807 20:17636918-17636940 GAAACCCTGCTGGCCCTGGCCGG + Intronic
1173699637 20:45057043-45057065 AAAGGCCTCCTGGCCCAGCCAGG - Intronic
1174890437 20:54386027-54386049 GAACTCCTGCTGGGCCTGCTGGG + Intergenic
1175723376 20:61300814-61300836 TACCTCCTGGTGGCTCTGCCAGG - Intronic
1175934334 20:62508161-62508183 GACCGTGTGCTGGCCCTGCCTGG + Intergenic
1176169142 20:63689251-63689273 GAGCGACTGCTGGCCCTGCTGGG + Intronic
1178405231 21:32317947-32317969 CAAAGGCTGCTGCCCCTGCCTGG + Intronic
1180215233 21:46319231-46319253 TTACTCCTGCTGGCCCTGGAGGG + Intronic
1182353380 22:29711136-29711158 TATGGCCCGCTCGCCCTGCCAGG - Intergenic
1183504924 22:38203445-38203467 CAATGCCTACTGACCCTGCCTGG - Intronic
949832428 3:8229959-8229981 AAACACCTGGTGGCCCAGCCTGG - Intergenic
950502938 3:13376011-13376033 TACAGCCTGCTGCCCCTTCCAGG + Intronic
953570906 3:44070866-44070888 GAGCTGCTGCTGGCCCTGCCAGG - Intergenic
954708518 3:52493772-52493794 TAACTCATCCTGGCCCAGCCAGG + Intergenic
957426940 3:80051387-80051409 AAACGCCTGCTTCCGCTGCCTGG + Intergenic
963973268 3:151452913-151452935 TACCTGCTGCTGCCCCTGCCTGG - Intronic
965551153 3:169966672-169966694 TAAGGACCGCTGGCCCCGCCAGG + Intronic
969321458 4:6415476-6415498 GAAAGCCTGCTTGCCCTGACTGG - Intronic
979309943 4:119191559-119191581 TTAGGCCTGCTGGCTCTCCCAGG - Intergenic
986658766 5:10040726-10040748 CACAGGCTGCTGGCCCTGCCTGG - Intergenic
989441885 5:41481821-41481843 TAAGCCCTGCTGTCCATGCCAGG - Intronic
993974758 5:94465059-94465081 TAACGTGTGCTGGCTTTGCCAGG - Intronic
998104271 5:139458255-139458277 GAATGCCTTCTGGCCCAGCCTGG + Intronic
1000072766 5:157756178-157756200 CTACACATGCTGGCCCTGCCTGG - Exonic
1003271490 6:4611575-4611597 CAATGCCTGCAGGCCCTTCCTGG - Intergenic
1004169840 6:13287387-13287409 TAGTGCCTGCTGGGCCTGGCTGG - Exonic
1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG + Exonic
1006015490 6:31077481-31077503 TAAAGCCTGAAGGCCCGGCCAGG - Intergenic
1007752077 6:44076790-44076812 TAAAACCTGCAGGCGCTGCCCGG + Intergenic
1010357802 6:74954980-74955002 TAACAAATGCTAGCCCTGCCAGG + Intergenic
1019403053 7:867358-867380 GAAAACCTGTTGGCCCTGCCAGG - Intronic
1019428665 7:988709-988731 TACCGCCTGCTGCCCCCGCCTGG + Exonic
1021431223 7:20560602-20560624 AAATGCCTGCTTCCCCTGCCTGG - Intergenic
1021788348 7:24174913-24174935 TACTCCCTGCTGGGCCTGCCTGG - Intergenic
1024973578 7:55092780-55092802 CACCGCCCGCTGGCCCTGCCAGG - Intronic
1028900351 7:96092592-96092614 TAACCCTTGCTCGCCTTGCCTGG - Intronic
1035237394 7:157507682-157507704 TCATGCCTGCTGACCCTGCAGGG + Intergenic
1040434824 8:47380200-47380222 CAACGCGTGCTGCCCCTGCCTGG + Intronic
1040491533 8:47927670-47927692 AAACGCCTGCTGGGACTGCCAGG + Intronic
1049698222 8:143994000-143994022 TGACGCCTGCTGCTCCTGCAGGG + Intronic
1049758573 8:144321650-144321672 CAAGCCCAGCTGGCCCTGCCCGG + Intronic
1054175088 9:61869280-61869302 TAACGCTTTCTGGCGCTGACAGG - Intergenic
1054662449 9:67711513-67711535 TAACGCTTTCTGGCGCTGACAGG + Intergenic
1059665858 9:116446036-116446058 TAACCCCTCCAGGCACTGCCTGG - Intronic
1061773284 9:132944348-132944370 TATCTCCGGCTGGCCCGGCCGGG - Intronic
1062236306 9:135510155-135510177 TAACTCCTCCTGGCCGGGCCTGG - Intergenic
1062273446 9:135720101-135720123 CTGCTCCTGCTGGCCCTGCCTGG - Intronic
1062500687 9:136850720-136850742 AGACGCCTGCTGGCACTACCTGG - Intronic
1188095604 X:26017389-26017411 TCACTCCTGCTGGCTCTGCAGGG - Intergenic
1199766609 X:150946032-150946054 TAACACCTGCAGGCCCGGCATGG + Intergenic