ID: 932414269

View in Genome Browser
Species Human (GRCh38)
Location 2:71564393-71564415
Sequence CAGGCCCCTGCACCTAGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 272}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932414260_932414269 -1 Left 932414260 2:71564371-71564393 CCTCGGTTACCCCCGAAGTCCCC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 932414269 2:71564393-71564415 CAGGCCCCTGCACCTAGTCTAGG 0: 1
1: 0
2: 1
3: 28
4: 272
932414258_932414269 6 Left 932414258 2:71564364-71564386 CCCTTTTCCTCGGTTACCCCCGA 0: 1
1: 0
2: 0
3: 3
4: 50
Right 932414269 2:71564393-71564415 CAGGCCCCTGCACCTAGTCTAGG 0: 1
1: 0
2: 1
3: 28
4: 272
932414262_932414269 -10 Left 932414262 2:71564380-71564402 CCCCCGAAGTCCCCAGGCCCCTG 0: 1
1: 0
2: 0
3: 30
4: 307
Right 932414269 2:71564393-71564415 CAGGCCCCTGCACCTAGTCTAGG 0: 1
1: 0
2: 1
3: 28
4: 272
932414259_932414269 5 Left 932414259 2:71564365-71564387 CCTTTTCCTCGGTTACCCCCGAA 0: 1
1: 0
2: 0
3: 7
4: 49
Right 932414269 2:71564393-71564415 CAGGCCCCTGCACCTAGTCTAGG 0: 1
1: 0
2: 1
3: 28
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932414269 Original CRISPR CAGGCCCCTGCACCTAGTCT AGG Intronic
900428391 1:2590844-2590866 CAGGCCTCTGCGCCTGGCCTAGG - Exonic
900476083 1:2877010-2877032 CAGGCCCCTGGACCAAGTGCTGG - Intergenic
901761092 1:11472078-11472100 CTGGCCCCTGCATCTTGTCCTGG + Intergenic
902447339 1:16475746-16475768 CAGCCCCCTGCATCCAGTCCTGG - Intergenic
902507393 1:16947049-16947071 CAGCCCCCTGCATCCAGTCCTGG + Intronic
903460345 1:23516449-23516471 CCGGCTCCTGCACCTCCTCTGGG + Exonic
905172110 1:36115429-36115451 CAGGCCACTGCACCCAGGCTGGG + Intronic
907553227 1:55322296-55322318 CAGGCCCCTGCCCCTACACTTGG + Intergenic
914242049 1:145858878-145858900 CGAGCCCCGGCACCCAGTCTCGG + Intronic
914317744 1:146530255-146530277 CAGGCCCCTCCCCCAACTCTAGG + Intergenic
914496613 1:148203103-148203125 CAGGCCCCTCCCCCAACTCTAGG - Intergenic
916893493 1:169137184-169137206 CAGGCCCATGCAGCCAGCCTTGG - Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
919674532 1:200368037-200368059 CTGGCCCCTGTAGCTAGCCTGGG - Intergenic
920253578 1:204638895-204638917 CAGGCTCCTGCTCCCAGGCTGGG + Intronic
921026541 1:211288166-211288188 CATGCCACTGCACTTAGCCTGGG + Intronic
1062768944 10:84911-84933 CTGGCCTCTGCAGCTAGACTAGG + Intergenic
1065116914 10:22492234-22492256 CAGGCCCCTGCAACCTGTTTTGG + Intergenic
1065142478 10:22732451-22732473 CATGCCACTGCATCTAGCCTGGG - Intergenic
1065347227 10:24760137-24760159 CAGGCCCCTCCACCAACACTGGG - Intergenic
1066347397 10:34601298-34601320 CAGGCCCCTGCCACTATACTTGG - Intronic
1067062834 10:43086796-43086818 CAGGCCGCTGCAGCTGGTCTGGG + Intronic
1067357973 10:45548850-45548872 CAGGCGCCTGCCACTACTCTCGG - Intronic
1067704985 10:48599822-48599844 TTGGCCCCTGCACCTAGTGATGG + Intronic
1068093674 10:52464097-52464119 GAGTCCCCTGCATCTAGGCTTGG + Intergenic
1070080050 10:73176981-73177003 CACGCCACTGCACTCAGTCTGGG + Intronic
1070521804 10:77260262-77260284 CAGGCCCCTCCCCCTATTCAGGG - Intronic
1070688831 10:78509800-78509822 CAGGCCCCTGCACTTGCTCCTGG - Intergenic
1070752509 10:78972597-78972619 CAGGCCCCTGCTGCTTGGCTGGG - Intergenic
1070796629 10:79220523-79220545 CAAGCCCCTTCAGCCAGTCTGGG + Intronic
1070814091 10:79312443-79312465 CCGGCCACTGCACCGAGTGTGGG - Intronic
1071859177 10:89655204-89655226 CAGGCCCCTCCACCAACACTGGG - Intergenic
1073316279 10:102583058-102583080 CAGGCCCCTGCGCCCACCCTGGG - Intronic
1073753428 10:106555752-106555774 CAGGCCCCTGCACTTCTTCCTGG - Intergenic
1074070990 10:110069032-110069054 CATGCCGCTGCACCCAGCCTGGG + Intronic
1074784006 10:116822829-116822851 CAGGCCATTGCTTCTAGTCTAGG - Intergenic
1075744279 10:124715720-124715742 CAGGGCCCTGCAGCTCCTCTGGG - Intronic
1076648384 10:131970133-131970155 CACGCCCCTGCACTCAGCCTGGG + Intronic
1077507290 11:2936098-2936120 CACGCCACTGCACTCAGTCTGGG - Intergenic
1077520928 11:3034063-3034085 CGAGCCACTGCACCTGGTCTGGG + Intronic
1080816482 11:35762517-35762539 CAAGCCCAAGCACCTAGTCAAGG - Intronic
1081385380 11:42466075-42466097 CAAGACCCTGCAACTAATCTGGG + Intergenic
1081711946 11:45222857-45222879 AGGGCCCCTGCACCTGGTCTAGG + Intronic
1082783237 11:57302644-57302666 CAGGCTCCAGCACCTCCTCTTGG + Exonic
1083304439 11:61755215-61755237 CAGGACCCAGCACCTATGCTTGG - Intronic
1083337291 11:61930732-61930754 CATGCCACTGCACTCAGTCTGGG + Intergenic
1083893557 11:65608891-65608913 CAGGCCACTGCACCTGGCCGAGG + Intronic
1084175876 11:67421929-67421951 CACGCCACTGCACCCAGCCTGGG - Intronic
1084410119 11:69002003-69002025 CAGGCCACTGCACCAACTCCTGG + Intergenic
1085604043 11:77881386-77881408 CAGGCCCCATCACCTAGATTAGG + Intronic
1086108548 11:83173409-83173431 CAGGCCACTGCACTTAGGCCTGG + Intronic
1086110676 11:83194690-83194712 CAGGCCCCTCCACTTCCTCTAGG + Exonic
1086673846 11:89580226-89580248 CATGCCACTGCACTCAGTCTGGG - Intergenic
1088571437 11:111227611-111227633 CATGCCACTGCACCCAGCCTGGG - Intergenic
1088638863 11:111851432-111851454 CATGCCACTGCATCCAGTCTGGG + Intronic
1088677124 11:112205496-112205518 CATGCCACTGCACCCAGCCTGGG - Intronic
1089297886 11:117480872-117480894 CAGGCCCCTGCAGCAGGTGTGGG - Intronic
1095969502 12:47892028-47892050 CATGCCCCTTCACCTAGACATGG + Intronic
1096849966 12:54429091-54429113 CAGGCCCCAGGCCCTAGTCCTGG - Intergenic
1097750390 12:63346066-63346088 CAGGCCCCTGCTCCAATACTGGG + Intergenic
1097955231 12:65478603-65478625 CATGCCACTGCACTTAGCCTGGG - Intronic
1099034237 12:77565306-77565328 CAGGCCACTTCACCTTGCCTGGG + Intergenic
1099435728 12:82642913-82642935 CAGGCCCCTGCACTTCAGCTTGG + Intergenic
1099822150 12:87725908-87725930 CACGCCACTGCACCCAGCCTGGG + Intergenic
1100902117 12:99253181-99253203 CATGCCACTGCACTTAGTCTGGG + Intronic
1104626558 12:130360676-130360698 CATGCCCCTGCCCCAATTCTGGG - Intronic
1104966940 12:132512614-132512636 CAGGCCCCTGCCCCTACCCCCGG + Intronic
1105517759 13:21105372-21105394 GCGGCCACTGCACCTAGCCTGGG + Intergenic
1107964957 13:45589714-45589736 CAGGCCCCTTCACTGTGTCTGGG + Intronic
1109788631 13:67217366-67217388 CAGGCCCCTGTGCCTACTGTGGG + Intronic
1110798700 13:79670125-79670147 CAAGCCACTGCACTTAGCCTGGG + Intergenic
1110999482 13:82160613-82160635 CATGCCACTGCACTCAGTCTGGG + Intergenic
1112236206 13:97639900-97639922 CTGGCCTGTGCACCTAGTATTGG - Intergenic
1116388398 14:44360837-44360859 CAGGGCCCTGCATATAGTCCTGG - Intergenic
1118397655 14:65351204-65351226 CGCGCCACTGCACCTAGCCTGGG - Intergenic
1118557299 14:67039508-67039530 CAAGCCACTGCACCTGGCCTGGG - Intronic
1119231884 14:72986602-72986624 CACGCCACTGCACCCAGCCTGGG - Intronic
1119451156 14:74712146-74712168 CAGACCCCTGAACAAAGTCTGGG + Intronic
1119513178 14:75227658-75227680 CGTGCCACTGCACCTAGCCTGGG + Intergenic
1119719569 14:76882002-76882024 TAGAGCCCTGCACCCAGTCTAGG - Intergenic
1120012722 14:79435676-79435698 CATGCCACTGCACTTAGCCTGGG - Intronic
1121736591 14:96222207-96222229 CAGGCCCCTGCCCCACGTGTGGG - Intronic
1124125515 15:26935533-26935555 CAGGCACGTGCCCCTGGTCTCGG + Intronic
1124364766 15:29063778-29063800 CAAGTCCCTGCACCCAGTTTGGG + Intronic
1124372325 15:29110803-29110825 CAGAACCCTGCACCTGGGCTTGG - Intronic
1125124375 15:36202394-36202416 CACGCCACTGCACCCAGCCTGGG - Intergenic
1125794684 15:42395488-42395510 GGGGCCTCTGCACCTAGTTTGGG + Intronic
1125812104 15:42550236-42550258 CGGGCCACTGCACTTAGCCTGGG + Intronic
1126034310 15:44533012-44533034 CATGCCACTGCACCCAGCCTGGG - Intergenic
1126063221 15:44804100-44804122 CAGGCCTTTGCACATAGGCTAGG - Intergenic
1126290519 15:47071129-47071151 CACACCACTGCACCCAGTCTGGG + Intergenic
1126579823 15:50232576-50232598 CAGGCCTCTGCCCCAACTCTCGG - Intronic
1127042971 15:54997565-54997587 CAGGGCCCTGCATCTAGACCTGG + Intergenic
1127578391 15:60314475-60314497 CAGGCCCCTGCTCCAACACTGGG + Intergenic
1127722009 15:61712186-61712208 CAGGCCAGTGCCCCTAGTCAGGG + Intergenic
1127757500 15:62106915-62106937 CAGGCCCCTGCCCCAATGCTTGG - Intergenic
1127892991 15:63271286-63271308 CATGCCACTGCACCCAGCCTGGG + Intergenic
1127961415 15:63893648-63893670 CATGCCACTGCACTTAGCCTGGG - Intergenic
1128349061 15:66877009-66877031 CACGCCCCTGCTCCTAGCCCCGG - Intergenic
1128533595 15:68472368-68472390 CAGGCCGCTGCACTCAGGCTGGG + Intergenic
1128838262 15:70828879-70828901 CATGCCACTGCACCCAGGCTGGG - Intergenic
1129020086 15:72509032-72509054 CAGGCCACTGCACCCAGCCTGGG - Intronic
1129666592 15:77582737-77582759 CAGCCCCCTGCAACTGGCCTAGG - Intergenic
1130611973 15:85369671-85369693 CATGCCACTGCACCCAGTCTGGG + Intergenic
1131152689 15:90056931-90056953 CCAGCCCCTGCCCCTAGCCTGGG - Intronic
1131229800 15:90651568-90651590 CAGGCCCTTGCACCTTGACATGG + Intergenic
1132456264 16:24859-24881 CAGGCCACTGCATTTAGCCTGGG + Intergenic
1132458044 16:35177-35199 CTGGCCTCTGCAGCTAGACTAGG + Intergenic
1132670737 16:1101366-1101388 CAGGCTCCTGCACGTACTCCAGG + Intergenic
1133235181 16:4384355-4384377 AAGCCCCCTGCACCCAGTCCAGG - Intronic
1134488761 16:14679805-14679827 CATGCCACTGCACCCAGCCTGGG + Intronic
1134768722 16:16785353-16785375 TAAGCCACTGCACCTAGCCTGGG + Intergenic
1135244575 16:20844619-20844641 CAGGCCTCTGCACCTAACCAAGG - Exonic
1136245661 16:28974569-28974591 CAGGCGACTCCACCTAGTCACGG + Intronic
1136448745 16:30340202-30340224 CATGCCCCTGCACCTGGGCCAGG + Intergenic
1137537919 16:49341577-49341599 CATGCCACTGCACTTAGCCTGGG + Intergenic
1138092852 16:54190870-54190892 CAGCCCCCAGCACATAGTGTGGG - Intergenic
1138126269 16:54441296-54441318 CACGCCACTGCACCCAGCCTGGG - Intergenic
1138701394 16:58867143-58867165 CAGGAACCTGCAGGTAGTCTAGG + Intergenic
1139962832 16:70727828-70727850 CAGGCCCAGCCACCCAGTCTGGG - Intronic
1141543355 16:84744737-84744759 CAGGCCCCTGAATTTATTCTCGG + Exonic
1141665155 16:85462136-85462158 CTGTCCCCAGCACCCAGTCTCGG + Intergenic
1141895949 16:86958902-86958924 CAGTTCCCTGCCCCTAGCCTTGG + Intergenic
1143931970 17:10438518-10438540 CAGGGCCCTGGACCCAGTCCAGG + Intergenic
1143944174 17:10575137-10575159 CAGGCCCCAGTACCCAGTTTTGG - Intergenic
1144390072 17:14784955-14784977 CAGGCACCTGCATCTGGACTTGG - Intergenic
1145073558 17:19832309-19832331 CATGCCACTGCACCCAGCCTGGG - Intronic
1147118104 17:38317712-38317734 CAGGCGCCTGCTACTACTCTCGG + Intronic
1147291393 17:39446305-39446327 CAGGCCCCTGCCACTATTCCCGG - Intronic
1147392479 17:40118901-40118923 CAGGCCCCTGCCACCAGGCTCGG + Intergenic
1150078761 17:62217466-62217488 CAAGCCACTGCACCCAGCCTGGG - Intergenic
1150078878 17:62218447-62218469 CATGCCGCTGCATCTAGCCTGGG - Intergenic
1150231852 17:63557937-63557959 CATGCCTCTGCACCCAGCCTGGG - Intronic
1151468928 17:74305713-74305735 CACGCCACTGCACTCAGTCTGGG - Intronic
1151983549 17:77528288-77528310 CAGGCCGCTGCACATACCCTGGG + Intergenic
1152574608 17:81134548-81134570 CAGGCCCCTGCCCCTGCTCTGGG + Intronic
1152741428 17:82020118-82020140 CAGGGCCCTGCACAGGGTCTGGG + Intronic
1153279530 18:3401258-3401280 CAGGGCTCTGCACCTAGTGTAGG + Intergenic
1156238942 18:35232918-35232940 CAGGCCACTGCACATAGCCTGGG + Intergenic
1157195946 18:45620141-45620163 CAGGGCCTTGCACCTCCTCTAGG - Intronic
1157248893 18:46076616-46076638 CACGCCACTGCACTCAGTCTGGG + Intergenic
1159344296 18:67179352-67179374 CATGCCACTGCACCCAGCCTGGG - Intergenic
1159653438 18:71004179-71004201 CAGGCCCCTGCTCCAACACTGGG - Intergenic
1160195497 18:76751788-76751810 CAGGCCGCTGCACCCAGACTGGG + Intergenic
1160425818 18:78778373-78778395 CAGGCCCCTGGACCCAGTCTTGG + Intergenic
1161519836 19:4717747-4717769 CAGGCTCCAGCACCAAGCCTCGG - Intronic
1162230384 19:9261076-9261098 GAGGCCACTGCACCTTTTCTGGG + Intergenic
1163384845 19:16993335-16993357 CAGGTGCCTGCACCCAGCCTGGG + Intronic
1163659889 19:18570553-18570575 CACGCCACTGCACCCAGCCTGGG - Intergenic
1163703911 19:18801301-18801323 CAGGCCCCAGCCCCTTGTCCTGG + Intergenic
1163714765 19:18867361-18867383 CGGGGCCCTGCGCCGAGTCTAGG - Exonic
1163925168 19:20334278-20334300 CAGACGCCTGCACCTAGCCTTGG + Intergenic
1165051449 19:33144157-33144179 CAGGCCCCTGCACGCACTCTGGG - Intronic
1165741346 19:38206993-38207015 GAGGCCACTGCACCTGGGCTAGG + Exonic
1165919614 19:39287227-39287249 CATGCCACTGCACCCAGCCTGGG + Intergenic
1168214794 19:54917596-54917618 CAGGCCCCCGCACCCAGCCTAGG + Intergenic
925017920 2:545845-545867 AAGGCCCCAGCACATCGTCTAGG + Intergenic
925150723 2:1612903-1612925 CAGGGCCCAGCACCTTGCCTGGG - Intergenic
925314022 2:2907679-2907701 CAGGCCCCGCCAACCAGTCTTGG + Intergenic
926059863 2:9798476-9798498 TGGGCCTCTGCACCTACTCTGGG + Intergenic
926957553 2:18318015-18318037 CATGCCACTGCACCCAGCCTTGG + Intronic
927929562 2:27035477-27035499 AAGGCCCCTGCACTGAGGCTGGG - Intronic
927987141 2:27419985-27420007 CACGCCACTGCACTCAGTCTGGG - Intergenic
928023811 2:27723659-27723681 CAGGGCGCTGCACATACTCTGGG + Intergenic
929866261 2:45719879-45719901 CTAGCCACTGCACCTAGTCTGGG + Intronic
931345239 2:61440011-61440033 CAGGGCCTTGCAGCTTGTCTTGG - Intronic
931730691 2:65150584-65150606 TGGGCCACTGCACCCAGTCTGGG + Intergenic
932414269 2:71564393-71564415 CAGGCCCCTGCACCTAGTCTAGG + Intronic
932761297 2:74440621-74440643 CAGGCCCCTCCCCCTGGTCCCGG + Intronic
933399728 2:81779734-81779756 CAGGCCCCTGCCACTAGGCCCGG - Intergenic
934073106 2:88403483-88403505 CATGCCACTGCACTTAGCCTGGG + Intergenic
937323143 2:120972894-120972916 CAGGCCCCTGCTCCCAGAGTGGG - Intronic
939501241 2:142987788-142987810 CAGGCCCCTGCTCCAACACTGGG - Intronic
940890279 2:159028808-159028830 CAAGCCACTGCATCTAGACTGGG - Intronic
944486612 2:200213526-200213548 CAGGGCCCAGCACCCAGGCTAGG + Intergenic
944806041 2:203282178-203282200 CAGGCGCCTGCAACTATGCTTGG + Intronic
944982239 2:205134479-205134501 CATGCCACTGCATCTAGCCTGGG + Intronic
945122746 2:206474616-206474638 CATGCCACTGCACTCAGTCTGGG - Intronic
948200598 2:236127377-236127399 CAGGACACTGCACCTGGTTTTGG - Exonic
948794210 2:240393870-240393892 CAGGCCCCTGCACCGCACCTTGG + Intergenic
1168766660 20:386145-386167 TGGGCCACTGCACCTAGCCTTGG + Intronic
1171196775 20:23206053-23206075 CAGGCTCCTGCACCTGGTCAGGG - Intergenic
1171232671 20:23500189-23500211 CAGGCCCCACCACCAACTCTAGG + Intergenic
1171413148 20:24959959-24959981 CAGTCCCCTGCACCCAGACCCGG - Intergenic
1172446579 20:34996539-34996561 CCGGCCCCGCCACCCAGTCTCGG - Intronic
1172519280 20:35556790-35556812 CAGACCCCCTCTCCTAGTCTTGG - Intronic
1172834374 20:37863616-37863638 CAGCCTCCTGCACCTCTTCTTGG - Intronic
1174199364 20:48796471-48796493 CAGGCCCCTTCAGATAGTCTGGG - Intronic
1174235934 20:49091676-49091698 CACGCTCCTGCACCCAGCCTAGG + Intronic
1175705949 20:61176711-61176733 CATGCCACTGCACCCAGCCTGGG + Intergenic
1176030783 20:63010152-63010174 CAGGCCCCTGCCCCGACCCTGGG + Intergenic
1176149644 20:63583495-63583517 CAGGCCACTGCGCCCAGCCTTGG - Intergenic
1177142207 21:17369436-17369458 CATGCCACTGCACCCAGTCTGGG + Intergenic
1177698915 21:24611085-24611107 CATGCCACTGCACTTAGCCTGGG - Intergenic
1178937525 21:36875958-36875980 CAGGCACCAGCACCTAGACAAGG - Intronic
1180672252 22:17562204-17562226 CATGCCACTGTACCTAGCCTGGG - Intergenic
1181184275 22:21091228-21091250 CACGCCACTGCACCCAGCCTGGG - Intergenic
1182073877 22:27481671-27481693 CATGCCACTGCATCCAGTCTGGG - Intergenic
1182366916 22:29785309-29785331 CAAGCCCCTGCACTTAGGCTTGG - Intergenic
1183035057 22:35135004-35135026 CAGGCACCTTCCCCAAGTCTGGG - Intergenic
1184736318 22:46399689-46399711 CTGGCACCTGCACCTCCTCTGGG - Intronic
950438076 3:12992625-12992647 CAGACCCCTGCTCCCAGTCTAGG + Intronic
951873803 3:27397297-27397319 CAAGCCACTGCACCTGGCCTGGG + Intronic
952561400 3:34597974-34597996 CAGGCCCCTCCACCAACACTGGG - Intergenic
954639031 3:52087121-52087143 CAGGCCCCACCAGCTAGTCTTGG + Intronic
955360207 3:58267619-58267641 CATGCCACTGCACTTAGCCTGGG + Intronic
956491196 3:69774065-69774087 CATGGGCCTGCACCTAGTCATGG - Intronic
958128846 3:89391461-89391483 CACGCCACTGCACCCAGCCTGGG - Intronic
960252863 3:115475878-115475900 CAGGCCCCTTCACGTAGTATAGG - Intergenic
960281095 3:115782280-115782302 AAGGCCTCTGCATCTACTCTTGG - Intergenic
961444225 3:126971651-126971673 CATGCCACTGCACCTAGCTTTGG + Intergenic
961697539 3:128716174-128716196 CATGCCACTGCACCCAGCCTGGG - Intergenic
967475123 3:189907731-189907753 CAGGCCACTGTACCTACTTTGGG + Intergenic
967906138 3:194501889-194501911 CACGCCACTGCACCCAGCCTGGG + Intergenic
968224375 3:196964399-196964421 CGTGCCACTGCACCTAGCCTAGG - Intronic
968971931 4:3800375-3800397 CTGCCCCCTGCACCTGGACTGGG - Intergenic
969015328 4:4100021-4100043 CAGGGCCCTCCACCAAGGCTGGG + Intergenic
969881503 4:10177981-10178003 GAGGGCCCTGCAGCTAATCTTGG - Intergenic
970142438 4:12996876-12996898 CAGGCCCCTGTTCCAAGCCTCGG - Intergenic
970291794 4:14581110-14581132 CAGGATCCTGCACCAAGTCTGGG - Intergenic
970807741 4:20055867-20055889 CAGGCCCCTCCACCAACACTGGG - Intergenic
971902687 4:32682369-32682391 CACGCCATTGCACCTAGCCTGGG + Intergenic
976578881 4:86710965-86710987 GATGCCACTGCACCTAGCCTAGG - Intronic
978041083 4:104063100-104063122 CATGCCACTGCACCTGGTTTAGG + Intergenic
980404273 4:132336427-132336449 CATGCCACAGCACCTAGCCTGGG - Intergenic
981081657 4:140643750-140643772 CAGGCCCCTCCGCAAAGTCTGGG + Intronic
981979782 4:150777135-150777157 CATGCCCCTGCACTTTGCCTGGG - Intronic
982197158 4:152928083-152928105 CAGGCCTGTGCACCTACTCTGGG + Intergenic
982304278 4:153913631-153913653 CAGACCCCAGCACCTTGACTTGG - Intergenic
984801745 4:183722780-183722802 CCGGCCCCCGCACCCGGTCTCGG + Intergenic
986528527 5:8708347-8708369 CATGCCACTGCACCCAGCCTGGG - Intergenic
986801122 5:11261292-11261314 CAAGCCCATGCCCCTTGTCTTGG - Intronic
989038133 5:37196879-37196901 CATGCCACTGCACCCAGCCTGGG + Intronic
989054227 5:37351488-37351510 CGGGCCACTGCACCCAGCCTGGG - Intronic
991221968 5:64227319-64227341 CAGGCCCCTGCACCCATGGTGGG - Intronic
993016124 5:82536431-82536453 CAGCCACTTGCACCTACTCTGGG - Intergenic
995591294 5:113702491-113702513 CATGCCACTGCACCCAGCCTGGG + Intergenic
997225492 5:132206416-132206438 CTGGCCCCTGGACCTCATCTTGG - Intronic
997626763 5:135336437-135336459 CAGGCTCCTTCACATAGGCTGGG - Intronic
998626287 5:143850066-143850088 CATGCCCCTGCACCTGACCTAGG - Intergenic
998832570 5:146175496-146175518 CATGCCACTGCACCCAGCCTAGG + Intronic
1001083107 5:168681303-168681325 GTGGCCCCTGCACCTAGCCCAGG + Intronic
1002053371 5:176584513-176584535 CAGCCCCCAGCACCAAGCCTCGG - Exonic
1002104519 5:176873521-176873543 CAAACCCCTGCTCCTGGTCTAGG + Intronic
1002457184 5:179351897-179351919 CATGCCGCTGCACTCAGTCTGGG - Intergenic
1002705823 5:181160458-181160480 CCCGGCCCTGCACCTAGTGTGGG - Intergenic
1005271781 6:24172940-24172962 CATGCCACTGCACCCAGCCTGGG + Exonic
1006812961 6:36832359-36832381 ATGGCCCCTGTCCCTAGTCTAGG + Intronic
1008159456 6:48059593-48059615 CACGCCACTGCACTCAGTCTGGG + Intronic
1010020797 6:71157703-71157725 CTGTCCCCTGCACATGGTCTTGG - Intergenic
1011618478 6:89220196-89220218 CTGGCCCCTGGAGCTAGTCCAGG - Intronic
1012035408 6:94131716-94131738 CATGCCACTGCACTTAGCCTGGG - Intergenic
1016375171 6:143412802-143412824 CAGGACCCTGCACCCAGAATGGG - Intergenic
1019024194 6:168943384-168943406 CAGGCGCCAGCCCCTAGTTTAGG - Intergenic
1019504981 7:1386212-1386234 CCGGCCGCTGCACCTGCTCTCGG - Intergenic
1019916581 7:4136908-4136930 CAGGCCACGGCATCTAGGCTCGG + Intronic
1020492581 7:8806782-8806804 CAGGCCCTTGTTCCTAGTTTTGG + Intergenic
1023801370 7:43838029-43838051 CAGGCACCTGCCCCTACACTCGG + Intergenic
1024184780 7:46939019-46939041 CACACCACTGCACCCAGTCTGGG + Intergenic
1026056001 7:66984289-66984311 CAGGCCACTGCACTCAGCCTAGG - Intergenic
1026497365 7:70914615-70914637 TGAGCCCCTGCACCTAGCCTTGG + Intergenic
1028719070 7:94008454-94008476 CAGGCCCCTGAACCTGGCCCTGG + Intergenic
1029664941 7:101989097-101989119 CAGGCCCCTGAGCCGAGCCTTGG - Intronic
1032211758 7:129921653-129921675 CACGCCACTGCATCTAGCCTGGG + Intronic
1033152189 7:138925067-138925089 CAGGCACCTGCACCTCGCCCTGG + Intronic
1034161312 7:148995937-148995959 CAGGCTCCTGCCCCTAGTCATGG - Intergenic
1034918359 7:155059360-155059382 CAGGCCCCTGAAGCTATTGTGGG - Intergenic
1036738366 8:11339776-11339798 CAGGCCCCTGAATCTTTTCTAGG - Intergenic
1037761053 8:21741876-21741898 CATGCCACTGCACCCAGCCTGGG + Intronic
1039566066 8:38553520-38553542 CAGGCCCCTGCACCTGGGGTTGG + Intergenic
1040481796 8:47833499-47833521 CAGGCACCAGGACCTGGTCTTGG - Intronic
1042357748 8:67847697-67847719 CATGCCACTGCACCCAGCCTGGG - Intergenic
1043485537 8:80695438-80695460 GAGGCCCGTGCACCTGGTATAGG + Intronic
1044046910 8:87447617-87447639 CATGCCACTGCACTCAGTCTGGG - Intronic
1047489047 8:125359221-125359243 CATGCCACTGCACCCAGCCTGGG + Intronic
1048540044 8:135334139-135334161 CAGGCCCCTGTCGCAAGTCTGGG - Intergenic
1049557972 8:143292914-143292936 CTGGCCCCTGTACCTAGCCCTGG + Intronic
1052391460 9:27883112-27883134 CAGGCCCCTGCTCCAACACTGGG - Intergenic
1055555376 9:77468090-77468112 CACTCCCCAGCTCCTAGTCTAGG - Intronic
1056263786 9:84875789-84875811 CAGGCCTCTAGACCTAGACTGGG + Intronic
1059508886 9:114825499-114825521 CAGGCCCCTGCTCCTCTGCTTGG + Intergenic
1060761094 9:126249469-126249491 CATGCCACTGCACCCAGCCTGGG - Intergenic
1061259669 9:129472916-129472938 CAACCACCAGCACCTAGTCTTGG + Intergenic
1061307087 9:129738325-129738347 CTGGGCCCAGCACCTCGTCTTGG - Exonic
1062474531 9:136720543-136720565 CAGGCCCCTGGAGCTAGGGTGGG + Intronic
1185461360 X:334084-334106 CAGGCCCCGGAACCCAGGCTGGG + Exonic
1186878662 X:13842152-13842174 CACGCCACAGCACCTATTCTAGG + Intronic
1187968619 X:24637618-24637640 CATGCCACTGCACCCAGCCTGGG + Intronic
1188245087 X:27829611-27829633 CACGCCACTGCACCCAGCCTGGG + Intergenic
1189417970 X:40831711-40831733 CAGTGCCCCGCACCTATTCTAGG + Intergenic
1190069840 X:47270622-47270644 CAGGCCCCTGCAACCACACTCGG - Intergenic
1190602451 X:52106818-52106840 CATGCCACTGCACTCAGTCTGGG - Intergenic
1192413375 X:70954528-70954550 CATGCCCCTGCACACAGCCTGGG + Intergenic
1192778059 X:74265599-74265621 TAAGCCCATGCACCTATTCTGGG - Intergenic
1193049693 X:77086833-77086855 CAGGGCCCTGATCCTTGTCTTGG - Intergenic
1194524926 X:94967090-94967112 CAGGCCACTGCATCCAGCCTGGG + Intergenic
1194903372 X:99542907-99542929 CAGGTCCCTGGGCCTAGCCTGGG - Intergenic
1197740209 X:129885704-129885726 CATGCCACTGCACTTAGCCTTGG + Intergenic
1198506737 X:137308746-137308768 CAGGCCCCTGCTCCAACACTGGG - Intergenic
1198525853 X:137500008-137500030 CAGCCCCATGCACCTAGACTAGG + Intergenic
1200398345 X:156004214-156004236 CTGGCCTCTGCACCTAGACTAGG - Intronic
1200400099 X:156014865-156014887 CAGGCCACTGCATTTAGCCTGGG - Intergenic