ID: 932414436

View in Genome Browser
Species Human (GRCh38)
Location 2:71565121-71565143
Sequence ACACCACTACACTCCAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548042
Summary {0: 877, 1: 25252, 2: 107026, 3: 199119, 4: 215768}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932414436_932414441 18 Left 932414436 2:71565121-71565143 CCCAGGCTGGAGTGTAGTGGTGT 0: 877
1: 25252
2: 107026
3: 199119
4: 215768
Right 932414441 2:71565162-71565184 CCTCCGCCTCACAAGTTCAAGGG 0: 1
1: 24
2: 562
3: 1937
4: 3223
932414436_932414439 17 Left 932414436 2:71565121-71565143 CCCAGGCTGGAGTGTAGTGGTGT 0: 877
1: 25252
2: 107026
3: 199119
4: 215768
Right 932414439 2:71565161-71565183 GCCTCCGCCTCACAAGTTCAAGG 0: 1
1: 0
2: 63
3: 939
4: 7273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932414436 Original CRISPR ACACCACTACACTCCAGCCT GGG (reversed) Intronic
Too many off-targets to display for this crispr