ID: 932414437

View in Genome Browser
Species Human (GRCh38)
Location 2:71565122-71565144
Sequence CACACCACTACACTCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486749
Summary {0: 836, 1: 24272, 2: 81479, 3: 175220, 4: 204942}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932414437_932414439 16 Left 932414437 2:71565122-71565144 CCAGGCTGGAGTGTAGTGGTGTG 0: 836
1: 24272
2: 81479
3: 175220
4: 204942
Right 932414439 2:71565161-71565183 GCCTCCGCCTCACAAGTTCAAGG 0: 1
1: 0
2: 63
3: 939
4: 7273
932414437_932414441 17 Left 932414437 2:71565122-71565144 CCAGGCTGGAGTGTAGTGGTGTG 0: 836
1: 24272
2: 81479
3: 175220
4: 204942
Right 932414441 2:71565162-71565184 CCTCCGCCTCACAAGTTCAAGGG 0: 1
1: 24
2: 562
3: 1937
4: 3223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932414437 Original CRISPR CACACCACTACACTCCAGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr