ID: 932414438

View in Genome Browser
Species Human (GRCh38)
Location 2:71565149-71565171
Sequence GAGGCGGAGGCTGCAGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15734
Summary {0: 66, 1: 1270, 2: 5263, 3: 5630, 4: 3505}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932414438_932414448 22 Left 932414438 2:71565149-71565171 CCACTCACTGCAGCCTCCGCCTC 0: 66
1: 1270
2: 5263
3: 5630
4: 3505
Right 932414448 2:71565194-71565216 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
932414438_932414450 30 Left 932414438 2:71565149-71565171 CCACTCACTGCAGCCTCCGCCTC 0: 66
1: 1270
2: 5263
3: 5630
4: 3505
Right 932414450 2:71565202-71565224 TCCTGAGTAGCTGGGATTATAGG 0: 4909
1: 66666
2: 155807
3: 234511
4: 197419
932414438_932414446 21 Left 932414438 2:71565149-71565171 CCACTCACTGCAGCCTCCGCCTC 0: 66
1: 1270
2: 5263
3: 5630
4: 3505
Right 932414446 2:71565193-71565215 CCCTCAGCCTCCTGAGTAGCTGG 0: 1034
1: 101354
2: 208048
3: 241971
4: 153021
932414438_932414441 -10 Left 932414438 2:71565149-71565171 CCACTCACTGCAGCCTCCGCCTC 0: 66
1: 1270
2: 5263
3: 5630
4: 3505
Right 932414441 2:71565162-71565184 CCTCCGCCTCACAAGTTCAAGGG 0: 1
1: 24
2: 562
3: 1937
4: 3223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932414438 Original CRISPR GAGGCGGAGGCTGCAGTGAG TGG (reversed) Intronic
Too many off-targets to display for this crispr