ID: 932414441

View in Genome Browser
Species Human (GRCh38)
Location 2:71565162-71565184
Sequence CCTCCGCCTCACAAGTTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5747
Summary {0: 1, 1: 24, 2: 562, 3: 1937, 4: 3223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932414436_932414441 18 Left 932414436 2:71565121-71565143 CCCAGGCTGGAGTGTAGTGGTGT 0: 877
1: 25252
2: 107026
3: 199119
4: 215768
Right 932414441 2:71565162-71565184 CCTCCGCCTCACAAGTTCAAGGG 0: 1
1: 24
2: 562
3: 1937
4: 3223
932414437_932414441 17 Left 932414437 2:71565122-71565144 CCAGGCTGGAGTGTAGTGGTGTG 0: 836
1: 24272
2: 81479
3: 175220
4: 204942
Right 932414441 2:71565162-71565184 CCTCCGCCTCACAAGTTCAAGGG 0: 1
1: 24
2: 562
3: 1937
4: 3223
932414438_932414441 -10 Left 932414438 2:71565149-71565171 CCACTCACTGCAGCCTCCGCCTC 0: 66
1: 1270
2: 5263
3: 5630
4: 3505
Right 932414441 2:71565162-71565184 CCTCCGCCTCACAAGTTCAAGGG 0: 1
1: 24
2: 562
3: 1937
4: 3223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932414441 Original CRISPR CCTCCGCCTCACAAGTTCAA GGG Intronic
Too many off-targets to display for this crispr