ID: 932416018

View in Genome Browser
Species Human (GRCh38)
Location 2:71574355-71574377
Sequence ACATACCAGGGCCCCCTCAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 93}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932416018_932416029 7 Left 932416018 2:71574355-71574377 CCCTTGAGGGGGCCCTGGTATGT 0: 1
1: 0
2: 1
3: 7
4: 93
Right 932416029 2:71574385-71574407 CACTTGTCCTGGCTTGGGTAGGG 0: 1
1: 0
2: 1
3: 14
4: 136
932416018_932416028 6 Left 932416018 2:71574355-71574377 CCCTTGAGGGGGCCCTGGTATGT 0: 1
1: 0
2: 1
3: 7
4: 93
Right 932416028 2:71574384-71574406 GCACTTGTCCTGGCTTGGGTAGG 0: 1
1: 0
2: 1
3: 15
4: 163
932416018_932416026 1 Left 932416018 2:71574355-71574377 CCCTTGAGGGGGCCCTGGTATGT 0: 1
1: 0
2: 1
3: 7
4: 93
Right 932416026 2:71574379-71574401 GGGCTGCACTTGTCCTGGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 173
932416018_932416033 27 Left 932416018 2:71574355-71574377 CCCTTGAGGGGGCCCTGGTATGT 0: 1
1: 0
2: 1
3: 7
4: 93
Right 932416033 2:71574405-71574427 GGGTATATCTTGGTTTCCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 125
932416018_932416027 2 Left 932416018 2:71574355-71574377 CCCTTGAGGGGGCCCTGGTATGT 0: 1
1: 0
2: 1
3: 7
4: 93
Right 932416027 2:71574380-71574402 GGCTGCACTTGTCCTGGCTTGGG 0: 1
1: 0
2: 1
3: 17
4: 158
932416018_932416025 -4 Left 932416018 2:71574355-71574377 CCCTTGAGGGGGCCCTGGTATGT 0: 1
1: 0
2: 1
3: 7
4: 93
Right 932416025 2:71574374-71574396 ATGTGGGGCTGCACTTGTCCTGG 0: 1
1: 0
2: 4
3: 9
4: 140
932416018_932416032 26 Left 932416018 2:71574355-71574377 CCCTTGAGGGGGCCCTGGTATGT 0: 1
1: 0
2: 1
3: 7
4: 93
Right 932416032 2:71574404-71574426 AGGGTATATCTTGGTTTCCCAGG 0: 1
1: 0
2: 0
3: 24
4: 547
932416018_932416031 17 Left 932416018 2:71574355-71574377 CCCTTGAGGGGGCCCTGGTATGT 0: 1
1: 0
2: 1
3: 7
4: 93
Right 932416031 2:71574395-71574417 GGCTTGGGTAGGGTATATCTTGG 0: 1
1: 0
2: 0
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932416018 Original CRISPR ACATACCAGGGCCCCCTCAA GGG (reversed) Exonic
903583829 1:24393005-24393027 AGACAACAGGGACCCCTCAAGGG + Intronic
904212819 1:28897130-28897152 ACCTACCAGGGTCACCACAAGGG - Intronic
907110756 1:51924238-51924260 ACACACTAGGGGCTCCTCAAAGG - Intronic
907400731 1:54223339-54223361 ACATACCTGGGGTCCCTCAGAGG - Intronic
907514725 1:54986356-54986378 GCATCCCAGGGCCACCTCGATGG + Exonic
912967990 1:114253087-114253109 TCTCACCATGGCCCCCTCAAAGG + Intergenic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
918099961 1:181364765-181364787 ACACCCCATGGCACCCTCAAGGG - Intergenic
922219113 1:223544260-223544282 ACATCCCAGGGGCCCCTCTGTGG + Intronic
1063736288 10:8758929-8758951 ATAAATCAGGGCCCTCTCAATGG + Intergenic
1066594498 10:37035177-37035199 AAACACCAGGGCCCCCTTAAGGG + Intergenic
1069876368 10:71565612-71565634 ACAGACAAGGGCACCTTCAAGGG - Intronic
1072469452 10:95698654-95698676 ACTGCCCAGGGCCACCTCAAGGG + Intergenic
1076860242 10:133136618-133136640 AGAGACCAGGACCCCCCCAAAGG - Intergenic
1077372947 11:2192232-2192254 ACCTAGCAGGGGCCCCTCCAGGG - Intergenic
1079305351 11:19316828-19316850 ACATAACAGGGTCCGTTCAAAGG - Intergenic
1079910010 11:26298258-26298280 AGATCCCAGGGCACCCACAAAGG + Intergenic
1084572659 11:69968892-69968914 TCCTGCCAGGGCTCCCTCAAGGG - Intergenic
1086763556 11:90665327-90665349 ACATACCAGGGCCCACTGGGGGG - Intergenic
1087232806 11:95684986-95685008 ACATTCCTGGGCCTCATCAAAGG + Intergenic
1110331350 13:74276995-74277017 ACATACCAGAGGCCCATCAAGGG - Intergenic
1113064632 13:106360557-106360579 AGATACCAGTGCCCCCTCTGTGG + Intergenic
1113281571 13:108794156-108794178 AGACACCAGGGCCCACTTAAGGG + Intronic
1113663124 13:112120477-112120499 AAATGCCACGGCACCCTCAATGG + Intergenic
1119510626 14:75208270-75208292 ACATAACAGGGACCCTTCATGGG + Intergenic
1119756122 14:77120949-77120971 ACCTGCCAGGGCCCTCACAAGGG - Intronic
1125200139 15:37095804-37095826 TCGTACCAGGTCCCCCTTAATGG - Intronic
1126398599 15:48245880-48245902 GCTTTCCAGGGCCACCTCAAAGG - Intronic
1127477998 15:59352770-59352792 GCATACCCAGCCCCCCTCAAAGG + Intronic
1130662094 15:85838757-85838779 ACATTCCAGGGCTCCCTCAGAGG + Intergenic
1131905749 15:97140296-97140318 ACCCGCCAGGGTCCCCTCAAGGG - Intergenic
1135888322 16:26333922-26333944 ACATGCCTGGGGCCCATCAAAGG + Intergenic
1143514036 17:7410565-7410587 ACACCCCAGGGCCCCCTCATGGG + Intronic
1145712341 17:26989332-26989354 ACATCCCAGGGCCACCGCTAAGG - Intergenic
1147566422 17:41539034-41539056 AGATACCAGGCCCCTCTCATGGG - Intergenic
1148760790 17:49998908-49998930 ACAGACCAGGCCCCTCTCGATGG + Intergenic
1152930057 17:83104826-83104848 CCATCCCAGACCCCCCTCAAGGG - Intergenic
1155499629 18:26473748-26473770 AGTTCCCAAGGCCCCCTCAATGG - Intronic
1160148745 18:76384244-76384266 ACACACCCGTGCCCCCTCCACGG + Intronic
1160831426 19:1106443-1106465 ACCTACCAGGGGCTCCTCCATGG - Exonic
1163420299 19:17210364-17210386 ACATACCAGGACCCCCTCATAGG - Exonic
1165488097 19:36107535-36107557 ACAGAGCAGGGCACCCTCTAGGG + Intergenic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
926344255 2:11930928-11930950 CCATGCCAAGGCCTCCTCAAGGG + Intergenic
928078457 2:28286843-28286865 ACATACCATGGCCGGCTCTAGGG - Intronic
930086918 2:47504211-47504233 ACACTCCAAGGCCCCCTCAAGGG - Intronic
932416018 2:71574355-71574377 ACATACCAGGGCCCCCTCAAGGG - Exonic
938473718 2:131589403-131589425 GCATCCCAGGGCACCCTCAGTGG - Intergenic
942688882 2:178564007-178564029 ACAGGCCAGGGCCTCCTGAAGGG - Exonic
947932153 2:233973107-233973129 ACATAGCAGGGCCCCGTCCTGGG - Intronic
948899478 2:240949140-240949162 CCATTCCAGGGGCCCCTCCATGG - Intronic
949036249 2:241816876-241816898 AAAAACCAGGCCCCCCTCAGGGG - Exonic
1170908634 20:20541252-20541274 ACATTCCAAGACCCCCTCAGTGG + Intronic
1179401946 21:41092236-41092258 TCACACCAGGCCTCCCTCAAGGG + Intergenic
1184889691 22:47372155-47372177 TCACAGCAGGGCCCCGTCAATGG - Intergenic
949741925 3:7245187-7245209 ACATACCCGGACTCCCTAAAGGG + Intronic
953714137 3:45301656-45301678 CAATATCTGGGCCCCCTCAAAGG - Intergenic
954222308 3:49162277-49162299 ACAAACCAGAGCAGCCTCAAAGG + Intergenic
961321390 3:126078748-126078770 CCCTACCAGGGTCCTCTCAAGGG + Intronic
961321933 3:126082772-126082794 ACAGACCAGGGCTCGCCCAAAGG + Intronic
961329136 3:126128652-126128674 ACAGACCAGGGCTCGCCCAAAGG - Intronic
961657089 3:128448986-128449008 AAATACCATGTCCCACTCAAAGG + Intergenic
965580119 3:170258809-170258831 ACATGACAGAGCCTCCTCAAAGG - Intronic
967367069 3:188699320-188699342 AGAGACCAGGGCCCCCTGACTGG + Intronic
968513294 4:1004600-1004622 ACATTCCAGGGCAGCCTCCAAGG + Intergenic
969518666 4:7662857-7662879 ACAGACCAGGGCCACCTCTCAGG - Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
971653672 4:29312477-29312499 ACACACCAGGACCCCACCAAAGG - Intergenic
974579237 4:63773794-63773816 AGATGCCAGGGCCTACTCAATGG - Intergenic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
983785551 4:171725700-171725722 AGATACCAGGGCCTCCTTGAGGG + Intergenic
986264065 5:6177564-6177586 ACACACCAGGGCCCACTGGAGGG + Intergenic
986332013 5:6724214-6724236 ACATACCAGTGCCCTCTCTGTGG - Intronic
988143245 5:27269604-27269626 ACATCCCAGTGACCACTCAATGG + Intergenic
993194395 5:84722458-84722480 GAATACCAGGGCTCCCACAAAGG - Intergenic
997247894 5:132366729-132366751 ACATCACATGGACCCCTCAAAGG + Intergenic
1001027123 5:168233618-168233640 ACCTAACAGGGCCACCACAAGGG + Intronic
1002097301 5:176839127-176839149 ACCTTCCAGGCCCCTCTCAAAGG + Intronic
1006281341 6:33056055-33056077 ATATTCCAGGGCAGCCTCAAGGG - Intergenic
1010289196 6:74115783-74115805 AAATACCAACGCCTCCTCAAAGG - Intergenic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1013339831 6:109202889-109202911 ACATACTAGGGCCTCAACAAAGG - Intergenic
1013423895 6:109993120-109993142 ACCTACCAGGGCTCACTCACTGG + Intergenic
1014014961 6:116519330-116519352 ACATTCCAGAGCCCCCCCATAGG - Exonic
1022659018 7:32348826-32348848 ACAGAACAGGGCCCACTCAATGG - Intergenic
1025752071 7:64302495-64302517 ACATAACAGGGACCCTTCATGGG - Intergenic
1030090103 7:105850810-105850832 ACACACCAGGGCCCCCACTGAGG - Intronic
1035735077 8:1881825-1881847 CCATCCCAGGGACCTCTCAAAGG - Intronic
1037540038 8:19862233-19862255 ACAGACCAGGGTACCCTCCATGG + Intergenic
1039000546 8:32974796-32974818 ACAGAACAGGGACCCCTCTAAGG - Intergenic
1045928931 8:107601283-107601305 CCATACCAGGGGCCCTTCCATGG + Intergenic
1047807422 8:128374910-128374932 CAATACCTGGGCCCCTTCAAAGG - Intergenic
1048931052 8:139315598-139315620 AGATGTCAGGGCCCCCTTAAAGG + Intergenic
1053415405 9:37944193-37944215 ACATCTCAGAGCCCCCTCCATGG - Intronic
1061292012 9:129655711-129655733 ACATAGCAGGGCTCCCTACACGG - Intergenic
1062335096 9:136061458-136061480 AAATGCCATGGGCCCCTCAATGG - Intronic
1062471641 9:136708510-136708532 ATCCACCAGGGCCCCCTAAACGG + Intergenic
1185546260 X:947956-947978 AGATACCACGGGTCCCTCAAGGG + Intergenic
1189027169 X:37407856-37407878 TCCTACCAGGGCCCACACAAGGG - Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1192150799 X:68711130-68711152 ACTTTCCAGGGACCCCTCAGAGG + Intronic
1197810488 X:130437537-130437559 AGACACCAGGGCCTACTCAAGGG - Intergenic