ID: 932416514

View in Genome Browser
Species Human (GRCh38)
Location 2:71576669-71576691
Sequence CAGGGCAGGAAGGCTGGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1133
Summary {0: 1, 1: 0, 2: 2, 3: 92, 4: 1038}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932416506_932416514 -9 Left 932416506 2:71576655-71576677 CCTGCCAGGCGGCCCAGGGCAGG 0: 1
1: 0
2: 5
3: 64
4: 503
Right 932416514 2:71576669-71576691 CAGGGCAGGAAGGCTGGAGCGGG 0: 1
1: 0
2: 2
3: 92
4: 1038

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932416514 Original CRISPR CAGGGCAGGAAGGCTGGAGC GGG Intronic
900079066 1:842149-842171 CAGGGCACTGAGGCTGGAGTTGG - Intergenic
900182603 1:1318923-1318945 CCGGGCAGGGAGGCAGGGGCTGG - Intronic
900490968 1:2948993-2949015 GAGGGCAAGAAGGCAGGTGCCGG + Intergenic
900550857 1:3254307-3254329 CAGGGCAGTTAGGCAGGAGAAGG + Intronic
900773171 1:4562031-4562053 GCTGGCAGGAAGGCTGGGGCGGG + Intergenic
900833251 1:4980146-4980168 CTTGGCAGAAAGGCTGGGGCAGG + Intergenic
901324128 1:8356874-8356896 CAGGGCAGCATGGCTGGAGGTGG - Intronic
901420882 1:9150366-9150388 CCAGGCAGGGAGGCGGGAGCAGG + Intergenic
901523773 1:9806214-9806236 CAGGGCAGGGGGGGTGGAGGGGG + Intronic
901650825 1:10742234-10742256 AGGGGCAGGAAGGCGGGAGGGGG + Intronic
901760124 1:11465615-11465637 CAGGGCAGCAGGGCGGGGGCGGG - Intergenic
901798696 1:11694734-11694756 CTGAGAAGGAAGGCTGGAGTAGG - Intronic
902471168 1:16648228-16648250 CGGGGCTGGAAGCCTGGAACCGG + Intergenic
902487635 1:16759217-16759239 CGGGGCTGGAAGCCTGGAACCGG - Intronic
902547246 1:17197779-17197801 GAGGGCAGGAAGGTTGGTGATGG + Intergenic
902610201 1:17592657-17592679 CAGGTCAGCAAGGCCGGAGTGGG + Intronic
902612161 1:17603630-17603652 CAGGGGAGGGAGGCTGGGACTGG + Intronic
902743576 1:18457793-18457815 CTGGGCATGACTGCTGGAGCTGG + Intergenic
902786886 1:18738614-18738636 CAGGGCAGCAGGGGTGGAGCTGG - Intronic
903186745 1:21633504-21633526 CAAGGCAAGAAGGCTGGGACCGG + Intronic
903334224 1:22614188-22614210 CAGGGACTGGAGGCTGGAGCTGG - Intergenic
903480929 1:23652728-23652750 CAGGGTGGGAAGGGTGGAGAGGG - Intergenic
903582967 1:24386088-24386110 CTGGGCAGGTAGGATGGAGCCGG - Intronic
903655127 1:24944268-24944290 GAAGGCAGGGTGGCTGGAGCAGG - Intronic
903826370 1:26148446-26148468 CAGGGCAGAAGGAGTGGAGCAGG + Intergenic
903986914 1:27235041-27235063 CAGGCCGGCAGGGCTGGAGCCGG - Intronic
904166759 1:28561586-28561608 CAGGGTAGGAAGCCAGGGGCAGG - Intronic
904260690 1:29285955-29285977 CAGGTGGGGAAGGGTGGAGCTGG - Intronic
904411882 1:30329541-30329563 CATAGCAGGCAGGCTGGAGGGGG + Intergenic
904679804 1:32221475-32221497 CAGAGGAGGAAGGCTGGAGCTGG - Intronic
904773766 1:32894719-32894741 CAGGCCAGGATTCCTGGAGCTGG - Exonic
904808946 1:33150994-33151016 CAGGGCAGAAGGACTGGTGCGGG + Intronic
904909130 1:33921069-33921091 CTGGACAGGAAGGCAAGAGCTGG + Intronic
905057056 1:35104993-35105015 AAAGGCAGGCAGGCTGGAGCCGG + Intronic
905231566 1:36517691-36517713 CCTGGCGGGGAGGCTGGAGCTGG + Intergenic
905334991 1:37239011-37239033 CAGGGGAGGAGGAGTGGAGCTGG - Intergenic
905421051 1:37844732-37844754 CAGGGCAGGGAGACAGGAGGGGG - Intronic
905630443 1:39515333-39515355 CCTGGCAGGAGAGCTGGAGCTGG + Intronic
905667318 1:39770856-39770878 CCTGGCAGGAGAGCTGGAGCTGG - Exonic
905995282 1:42376008-42376030 CAGCGCAGGGAGGGTGGGGCAGG + Intergenic
906140837 1:43532403-43532425 CAGGGCCGGGAGGCTGGATTAGG + Intronic
906195860 1:43930488-43930510 CTGGGCAGCAAGGCTGCTGCCGG + Exonic
906291448 1:44622218-44622240 CGCGGCAGGCAGGCGGGAGCTGG - Intronic
906314575 1:44777949-44777971 CAGGGAAGGAAGGCAGGCCCTGG - Intronic
906680545 1:47723090-47723112 CTGGGCAGGGAGCCAGGAGCTGG + Intergenic
906684620 1:47755533-47755555 CAAGGCAGGAAAGTGGGAGCTGG - Intergenic
906710637 1:47927250-47927272 CAGAGCAGGAAGGCTGCACCCGG - Intronic
906745942 1:48222316-48222338 CAGGGAAGTAAAGGTGGAGCCGG - Intergenic
906792833 1:48673927-48673949 CAGGGGAGGAAGGAAGCAGCAGG - Intronic
907394144 1:54177930-54177952 GAGGGCAGGAAGGCAGCACCTGG - Intronic
908545727 1:65160371-65160393 CATGGCAGAAAGGATGGAGGAGG + Intronic
908895525 1:68894195-68894217 CAGGGCAATCAGGCTGGAGAAGG + Intergenic
909090500 1:71219315-71219337 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
909152006 1:72018759-72018781 CAGGGCAGGAGGGGAGGAGAAGG + Intronic
910186221 1:84543489-84543511 AGGGGGAGCAAGGCTGGAGCAGG + Intergenic
910237184 1:85048232-85048254 GAGGGCAGGCGGGCTGGAGCTGG - Intronic
911859532 1:102930085-102930107 CAGGGCAGTTAGGCAGGAGAAGG - Intronic
912266597 1:108163785-108163807 CAGGGCAGTTAGGCAGGAGAAGG - Intronic
912491345 1:110064444-110064466 CAGGAGGGGAAGGCTGGTGCAGG + Intronic
912624657 1:111197241-111197263 CAGGGCCGGCAGGCTGGGGAGGG + Exonic
912899748 1:113635220-113635242 CAGGGCAGTTAGGCAGGAGAAGG - Intronic
914218609 1:145656692-145656714 CAGTGCAATAAGGCTGGAGAAGG - Intronic
914346713 1:146806306-146806328 AGGGTCAGGAAGGCTAGAGCAGG - Intergenic
914427024 1:147586904-147586926 CCAGGCAGGAAGGCAGGAGATGG - Intronic
914471166 1:147979383-147979405 CAGTGCAATAAGGCTGGAGAAGG - Intronic
914684629 1:149967469-149967491 CAGGGAAACAATGCTGGAGCTGG + Exonic
914873172 1:151492401-151492423 CAGAGAAGGAAGACTGAAGCAGG - Intergenic
914876259 1:151514427-151514449 TAGGGCAGCAAGTCTGGACCAGG + Intronic
915334074 1:155130391-155130413 GTGGGCAGTCAGGCTGGAGCCGG + Intronic
915724481 1:158007852-158007874 CAGGGAAGGACAGCAGGAGCGGG - Intronic
915753996 1:158240642-158240664 CAGGGCAATAAGGCAGGAGAAGG + Intergenic
915858083 1:159411834-159411856 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
916289305 1:163147124-163147146 CAGGGCAGGAAGAATTGAGTGGG + Exonic
916299307 1:163256108-163256130 CAGGGCAGTTAGGCAGGAGAAGG + Intronic
916449952 1:164911196-164911218 GATGGCAAGCAGGCTGGAGCAGG + Intergenic
917046652 1:170867993-170868015 CAGGGCAGGAACAGTGGTGCTGG + Intergenic
917244719 1:172987809-172987831 CAGGGCAGTTAGGCAGGAGAAGG - Intergenic
917399631 1:174633030-174633052 CAGGGCAGTCAGGCAGGAGAAGG + Intronic
919724154 1:200871345-200871367 CAGGGTAGGAAGGTGGGGGCAGG - Intergenic
920333489 1:205228601-205228623 CAGGGCGAGGAGGATGGAGCTGG + Exonic
920401433 1:205679162-205679184 CAGGGCAGCAAGACAGCAGCTGG + Intronic
921103792 1:211955387-211955409 CAGGGCAGTCAGGCAGGAGAAGG - Intronic
921152272 1:212412181-212412203 AAGGGCAGGGAGGCTGGTGAAGG + Intronic
921351929 1:214244746-214244768 GTGGGCAGGAGGGCAGGAGCCGG - Intergenic
922166783 1:223122326-223122348 CACGCCAGGAACCCTGGAGCTGG - Intronic
922558174 1:226548860-226548882 CCGGGCAGCACGGCCGGAGCTGG - Exonic
922998634 1:229987241-229987263 CAGGGCAGAAAGAAAGGAGCTGG + Intergenic
923361029 1:233211246-233211268 CAGGGAATGAAGCCTGGAGCTGG - Intronic
923522968 1:234750346-234750368 CAGGCCTGGAAGGATGAAGCAGG - Intergenic
923630306 1:235645255-235645277 CAGGGCAGGGAGGCTGCTGAGGG - Intronic
924696928 1:246410164-246410186 CAGGGCAGTCAGGCAGGAGAAGG - Intronic
924934861 1:248759073-248759095 CAGGTCAGGGAAGCTGGGGCAGG + Intergenic
1062968952 10:1631208-1631230 CAGGGTAGAAAGGGTGGAGGTGG - Intronic
1063135639 10:3213949-3213971 CTGGGCAGGAGCTCTGGAGCTGG - Intergenic
1063433055 10:6007859-6007881 AAGGGCAGAGAGGCTAGAGCTGG + Intergenic
1063458765 10:6202734-6202756 CGGGGCAGGGCGGCGGGAGCTGG + Intronic
1063679292 10:8171905-8171927 CAGGGCAGGAAGGCAGAGGCAGG - Intergenic
1064192785 10:13222181-13222203 CAGAGCAGGAAGAGAGGAGCCGG - Exonic
1064956865 10:20921294-20921316 CAGGGGAGGAATAATGGAGCTGG - Intronic
1065022310 10:21510344-21510366 CTGGGAAGGAAGGCAGGGGCCGG - Intergenic
1065320242 10:24502586-24502608 CAGGGCAGGGAGGTGGGAGAAGG - Intronic
1065450532 10:25851979-25852001 CAGTTCAGGCAGGATGGAGCAGG + Intergenic
1065494604 10:26315573-26315595 TAGGGCAAGAAGGCTGGGCCCGG + Intergenic
1065595156 10:27303372-27303394 CAGGGCAGTCAGGCAGGAGAAGG + Intergenic
1066479908 10:35785801-35785823 CAGGGGAAGGAGGCTGCAGCTGG - Intergenic
1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG + Intergenic
1067474289 10:46556131-46556153 AAGGGCAGCAAGGCTGGGGGCGG + Intergenic
1067693456 10:48519277-48519299 CTGGGCAGGAATGCTGTTGCTGG - Intronic
1067990918 10:51211463-51211485 CAGGGCAGTCAGGCAGGAGAAGG + Intronic
1068245218 10:54357158-54357180 CAGGGCAGTTAGGCAGGAGAAGG + Intronic
1068977279 10:63023429-63023451 CAGGTCAGCAAGCCTGCAGCTGG - Intergenic
1069400156 10:68035815-68035837 CAGGGAAGGAAGGCTCCTGCTGG - Intronic
1069606140 10:69739960-69739982 CAGGGCAGGAAGAACGGGGCAGG - Intergenic
1069611483 10:69775515-69775537 CGGGGCCGGTAGGATGGAGCCGG + Intergenic
1069635703 10:69923578-69923600 CAGGGAAGGAAAGCAGGAGTGGG + Intronic
1069663656 10:70140180-70140202 GGGGGCAGAAAGGCTGGAGAAGG + Intronic
1069702354 10:70435876-70435898 CAGGGCTGGACAGCTGCAGCCGG + Exonic
1069778567 10:70940972-70940994 CAGGGCTGGGAGGAGGGAGCAGG - Intergenic
1069911965 10:71765372-71765394 CAGGGCAGGCAGAGTAGAGCTGG + Intronic
1069917371 10:71795919-71795941 CAGGACAGGAAGGGTGGTGGGGG - Exonic
1069933696 10:71900729-71900751 CTGTGCAGGTAGCCTGGAGCAGG + Intergenic
1069938620 10:71937641-71937663 CAAGGCAGGAGGCCAGGAGCAGG - Intergenic
1070570792 10:77638194-77638216 CGGGGGAGGAGGGCTGGCGCAGG - Intronic
1070642545 10:78180116-78180138 CAGGGCAGGGAGGCAGGCGGAGG - Intergenic
1070782354 10:79145078-79145100 GAGGGCAGGAAGGAGGGAGGAGG - Intronic
1070799227 10:79235298-79235320 GAAGGCAGGAAGGCTGCACCGGG + Intronic
1070809672 10:79291257-79291279 CAGGGCAGAAAGCGTGGAGCTGG - Intronic
1071739101 10:88336780-88336802 CAGGGTAGGAAGGCAAGAGCTGG + Intronic
1072574375 10:96686877-96686899 AAGGGCAGGATGGATGGAGGTGG + Intronic
1072679659 10:97498182-97498204 CCGGGCGGGAAGGGAGGAGCGGG - Intronic
1073122887 10:101132891-101132913 CAGCAGAGGAAGGCGGGAGCGGG - Intronic
1073498110 10:103912435-103912457 CAGTGCAGGCAGGCAGGGGCAGG - Intronic
1073725209 10:106222386-106222408 CAGGGCAGTCAGGCAGGAGAAGG + Intergenic
1074048170 10:109858228-109858250 CAAGGCAGACAGGCTGGAGATGG + Intergenic
1074702992 10:116108739-116108761 GTGGGCAGCAAGGCTGAAGCTGG - Intronic
1074825932 10:117215968-117215990 CTGGGCAGGGATGCTGAAGCGGG + Intergenic
1075210365 10:120485831-120485853 CAGGGCAGCCAGGGTGGGGCAGG - Intronic
1075318330 10:121469645-121469667 CTGGGCAGGAGGGAGGGAGCAGG - Intergenic
1075645043 10:124091859-124091881 TAGAGGAGGAAGGCTGGGGCTGG - Intronic
1075739009 10:124681994-124682016 CCGGGAAGGGAGGCTGAAGCTGG + Exonic
1075779258 10:125006286-125006308 CCGGGCACGACGGCTGGAGGTGG + Intronic
1076032711 10:127173121-127173143 CTGGCCAGCAATGCTGGAGCAGG - Intronic
1076343335 10:129764798-129764820 CAGGGCAGGATGCTGGGAGCAGG + Intronic
1076440426 10:130477486-130477508 CATGGCAGGAAGACAGGAGAAGG - Intergenic
1076637380 10:131891357-131891379 GTGGGCAGGAGGGCTGGAGAGGG - Intergenic
1076696405 10:132249403-132249425 CAGGGCAGGAATCCTGGATGTGG + Intronic
1076914776 10:133417525-133417547 CAGGGCAGTTAGGCAGGAGAAGG + Intronic
1076946722 10:133656625-133656647 GAGGGCAGGAAGGCCAGGGCTGG + Intergenic
1077076353 11:704159-704181 CAGGGCAGGAGAACTGGAGATGG - Intronic
1077151438 11:1074804-1074826 GAGGGCAGGAAGGCAGGGGAGGG - Intergenic
1077210133 11:1367047-1367069 CACGGAGGGGAGGCTGGAGCGGG + Intergenic
1077234337 11:1472674-1472696 CAGGGCACGATGCTTGGAGCTGG - Intronic
1077258518 11:1601993-1602015 CAGGTCAGCAAGGGAGGAGCTGG - Intergenic
1077585226 11:3446400-3446422 CAGCTGAGGAAGGATGGAGCCGG + Intergenic
1077830886 11:5868839-5868861 CAGGGCAGTGAGGCAGGAGAAGG - Intronic
1078339520 11:10488869-10488891 GGGGTCAGGGAGGCTGGAGCTGG - Intronic
1078479466 11:11663462-11663484 CTAGGCAGGAAGGCTGAGGCAGG + Intergenic
1078545890 11:12246710-12246732 CAGGGGTGGAAGGCTGAGGCAGG - Intronic
1078594008 11:12671346-12671368 AAGGGCATGAAATCTGGAGCTGG + Intergenic
1078943227 11:16032853-16032875 AAGGACAGGCAGGCTGGAGTAGG - Intronic
1079138988 11:17795180-17795202 CATGTCAGGAAGGATGGGGCGGG + Intronic
1079583512 11:22096159-22096181 GAGGGAAAGAGGGCTGGAGCAGG - Intergenic
1080199131 11:29648165-29648187 CAGGGCAAGTAGGCAGGAGAAGG + Intergenic
1080246284 11:30182590-30182612 CAGGGCAATAAGGCAGGAGAAGG + Intergenic
1080390437 11:31841120-31841142 GGTGGCAGGAAGGCTTGAGCCGG - Intronic
1080478988 11:32625977-32625999 CAGGGCAGTCAGGCAGGAGAAGG + Intronic
1080902715 11:36510655-36510677 CTGGGCAAGGAGGGTGGAGCTGG - Intergenic
1081568429 11:44275066-44275088 AGGGGCAGGAAGGCTGCTGCTGG - Intronic
1081936142 11:46905178-46905200 CAGGCCAGAAAGGATGGAGTGGG - Intronic
1082028113 11:47587259-47587281 CAGGGCAGGGAGGACAGAGCAGG - Intronic
1082579328 11:54847099-54847121 CAGGGCAGTTAGGCAGGAGAAGG - Intergenic
1082587130 11:54954865-54954887 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
1082667330 11:55990016-55990038 CAGGGCAATCAGGCTGGAGAAGG + Intergenic
1082784476 11:57309378-57309400 CAGGGCAGCAGGACTGGAGCCGG - Exonic
1082896959 11:58201962-58201984 CAGGGCAGGTAGGTCGGAGTTGG + Intergenic
1083005919 11:59346167-59346189 CAGGGCAGTTAGGCAGGAGAAGG - Intergenic
1083144635 11:60749191-60749213 CAGAGCTGGGAGGCTGGACCCGG - Intergenic
1083168246 11:60905286-60905308 CATGCCAGGAAGGATGGTGCTGG + Intronic
1083223534 11:61269060-61269082 CAGGGCGGGGAGGCAGGGGCCGG - Intronic
1083424938 11:62578691-62578713 GGGGGCAGCAATGCTGGAGCTGG - Exonic
1083457035 11:62786400-62786422 CAGGGAAGGGAGGCTGGAAGGGG - Intronic
1083587465 11:63870695-63870717 TAGTGCAGGAAGGCCCGAGCTGG + Intronic
1083638634 11:64133620-64133642 CTGGGAAGGGAGGCTGGGGCGGG - Intronic
1083737077 11:64687502-64687524 CAGGGCAGCAAGGCTGGTGGGGG + Intronic
1083795870 11:65016354-65016376 GAGGGCAGTATGGCTGGAGTGGG + Intronic
1083857706 11:65401324-65401346 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083857729 11:65401376-65401398 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083903682 11:65656217-65656239 CAGTGCAGGAAGGTGTGAGCTGG - Intronic
1083935962 11:65870281-65870303 GAGGGCAGGTGGGCTCGAGCCGG + Intronic
1084032042 11:66486926-66486948 AAGGAGAGGAAGGCTGGAGGTGG + Intronic
1084152779 11:67298964-67298986 CCGGGCAGGCTGGCTGGAGGGGG + Intronic
1084188216 11:67486540-67486562 CAGGGCAAGAGGGTTGGGGCTGG - Intronic
1084204566 11:67584188-67584210 CAGGGAAGGGAGGCAGGGGCTGG + Intronic
1084242130 11:67828963-67828985 CAGCTGAGGAAGGATGGAGCTGG + Intergenic
1084669104 11:70594978-70595000 CAGGGCCGGGAGCCGGGAGCCGG + Intronic
1084803007 11:71557994-71558016 CAGGTCAGCAAGGGAGGAGCTGG + Intronic
1084916699 11:72434157-72434179 CAGGACAGGACAGCTGGAACGGG - Exonic
1085014710 11:73166183-73166205 GAGGGCAGGAAAGGTGGAGGTGG + Intergenic
1085071951 11:73554971-73554993 CATGGAAGGAAGGCAGCAGCAGG + Intronic
1085187368 11:74587906-74587928 AAGGGCAGGAGAGCTGGAGGGGG - Intronic
1085336594 11:75701369-75701391 CAGGGCTGGGTGGCTGGGGCGGG - Intergenic
1085463844 11:76710989-76711011 CTGGGGAGGAAGGCAGGGGCGGG + Intergenic
1085697248 11:78715448-78715470 CAGTGCAGGGAGACAGGAGCTGG - Intronic
1085777951 11:79383061-79383083 CAGGGCAGAAAGGCAGAAGATGG - Intronic
1085823929 11:79822758-79822780 CACAGCAGGAAAGATGGAGCTGG - Intergenic
1086840865 11:91682656-91682678 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
1086923828 11:92618191-92618213 CAAGGCAGCAAGGCTGGGGGAGG - Intronic
1087545568 11:99579824-99579846 CAGGGCAGTCAGGCAGGAGAAGG - Intronic
1087667265 11:101065146-101065168 CAGGGCAGCAAGCCTGGTGGAGG - Intronic
1087832008 11:102829684-102829706 CAGGGGAGGAAAGCAGAAGCTGG - Intergenic
1088480465 11:110291911-110291933 CAAGGCAGGAAGTCTGAGGCAGG + Intronic
1088560170 11:111106687-111106709 CAGAGCATGAATGCTGCAGCTGG - Intergenic
1089169654 11:116503122-116503144 GAGGGCAGGAGGTCTGGAGGTGG - Intergenic
1089318882 11:117611588-117611610 CAGGGCAAGAAGTTTGGAGGAGG - Intronic
1089493326 11:118896740-118896762 CAGGCCAGGAAGGCTAGGGACGG + Exonic
1089665356 11:120014470-120014492 CAGGGGAGGTAGGCGGGAGATGG - Intergenic
1089677034 11:120097041-120097063 CAGAGCGGGAAGGTGGGAGCTGG + Intergenic
1090202732 11:124867770-124867792 CAGGGTAGGAAGGGGGGAACAGG + Intronic
1090400841 11:126447356-126447378 CAGGTCATGAAGGCTGAGGCTGG - Intronic
1090715473 11:129426726-129426748 CAGGCAAGGAAGGATGGAGTTGG - Intronic
1091667673 12:2430989-2431011 CAGGGCAGGAAGTGCAGAGCGGG - Intronic
1091831667 12:3554620-3554642 AAAGGTGGGAAGGCTGGAGCTGG + Intronic
1092286027 12:7129789-7129811 CAGGACAGGTAGGCAGGAGGAGG + Intronic
1092329598 12:7571528-7571550 CAGGGAAGGAGGGCTGGGGAAGG - Intergenic
1092412378 12:8263662-8263684 CAGCTGAGGAAGGATGGAGCCGG + Intergenic
1094137038 12:27138802-27138824 CAGGGCAATAAGGCAGGAGAAGG - Intergenic
1094288719 12:28821738-28821760 CAGGGAGGAAAGGCTGGAGCAGG - Intergenic
1094844516 12:34355611-34355633 AAGGGCAGGAAGGCTTGAAAGGG - Intergenic
1095533698 12:43221469-43221491 CATGGCAGGAAACCTGGGGCTGG - Intergenic
1095657110 12:44683413-44683435 CAGGGCAGTTAGGCAGGAGAAGG - Intronic
1095661833 12:44745448-44745470 CAGGGCAGTCAGGCAGGAGAAGG + Intronic
1096098983 12:48957425-48957447 GAGGGAAGGAAGGAGGGAGCCGG - Exonic
1096780097 12:53986574-53986596 TTGGGCAGCGAGGCTGGAGCCGG + Intronic
1096843285 12:54391600-54391622 GAGGGCGGGAAGTCTGGTGCTGG + Intergenic
1097029886 12:56082600-56082622 CAGGGAAGGGTGGCTGGAACAGG + Intronic
1097174778 12:57136229-57136251 CAGGGGAGGGAGGCTGAAGGGGG + Intronic
1097431936 12:59519742-59519764 AAGGGCAGGAAGCATGCAGCGGG + Intergenic
1097525349 12:60727355-60727377 CAGGGCAGTCAGGCAGGAGAAGG + Intergenic
1098290512 12:68953055-68953077 CAGGCCAGGAAGGCAGGTACTGG + Intronic
1098304640 12:69090330-69090352 CAAGGCAGGAAGGCTGCTGAGGG - Intergenic
1098486677 12:71029482-71029504 CAGGGCTGGCATGCTGGTGCTGG - Intergenic
1098974302 12:76886556-76886578 CAGGGGAGGAGGGCTGGGGTTGG + Intergenic
1099695989 12:86020185-86020207 CAGGGCAGTCAGGCAGGAGAAGG - Intronic
1100125236 12:91416786-91416808 CAGGCCAGGAAGGCAAAAGCAGG + Intergenic
1101377998 12:104187650-104187672 GAGGGAATGAAGGCTGGAACTGG + Intergenic
1101812946 12:108123341-108123363 CACGGCAGGATGGCAGGAGGTGG + Intergenic
1101929419 12:109000959-109000981 CAGGGCAATTAGGCTGGAGAAGG + Intronic
1102068652 12:109999605-109999627 CAGGGCAGGCAGGCGGGCGCGGG + Exonic
1102216062 12:111162221-111162243 CAGTGGAGGAAGGCAGGGGCTGG - Intronic
1102477037 12:113195509-113195531 CAGGCCAGGAAGGCCCGAGATGG - Exonic
1102643288 12:114385371-114385393 ACGGGCAGGAAGGCTGGTGGAGG + Intronic
1102750491 12:115289134-115289156 CAGGGCAGTCAGGCAGGAGAAGG + Intergenic
1103395527 12:120604035-120604057 CATGGCTGGCAGGCTGGTGCTGG + Intergenic
1103780961 12:123398682-123398704 CAGGGCAGGGAGGCCATAGCTGG + Intronic
1103843759 12:123887087-123887109 CAGGGAAGGGAGGCTGGTGGTGG + Intronic
1103851165 12:123934462-123934484 CAGGACAGAAATGCTGGAGAAGG + Exonic
1104885027 12:132102156-132102178 CATGGTAGGAAGGTGGGAGCTGG + Intronic
1104955979 12:132466057-132466079 CAGGGGAGGGAGGGAGGAGCGGG - Intergenic
1105236175 13:18555457-18555479 CTGTACAGGAAGGGTGGAGCAGG + Intergenic
1105566442 13:21553425-21553447 CAGGGCAGTCAGGCAGGAGAAGG - Intronic
1106251676 13:27986811-27986833 CAGGGCAGGCCGGAAGGAGCAGG - Intronic
1106366911 13:29090511-29090533 CAGTGAAGGAAGGCTGTAGCTGG + Intronic
1107489411 13:40866568-40866590 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
1107733062 13:43367769-43367791 CAGGGAAGGAATCCTGGAGGGGG + Intronic
1107763901 13:43712906-43712928 CAGGGCAGTTAGGCAGGAGAAGG - Intronic
1108101585 13:46962500-46962522 GAGAGAAGGAAGGCGGGAGCTGG + Intergenic
1108825081 13:54403564-54403586 GAGGGCAGGAAGAATGCAGCAGG - Intergenic
1109078190 13:57864896-57864918 CTGCACAGGAAGGATGGAGCAGG - Intergenic
1110239791 13:73254378-73254400 CAGTCCCAGAAGGCTGGAGCTGG + Intergenic
1110276214 13:73644532-73644554 CAGGGCAAGCAGGCAGGAGAAGG + Intergenic
1110425503 13:75362239-75362261 CAGGGCAGGCTGGCTGGCCCCGG + Exonic
1110835885 13:80082414-80082436 CAGGAGAGGAAGGTTGGAGGTGG + Intergenic
1111169158 13:84502558-84502580 CAGGGCAGTTAGGCAGGAGAAGG - Intergenic
1112443619 13:99444067-99444089 CAGGTCAGGAAGGCAGGAGAAGG - Intergenic
1112492382 13:99879082-99879104 CAGGGCAGGAAAGGTCGAGGCGG - Intronic
1112774102 13:102825573-102825595 CAGGGGAGGTAGGCTGAAGCAGG - Intronic
1113185663 13:107683555-107683577 CATGGCAGGAAGCCTGCAGTGGG + Intronic
1113339145 13:109404775-109404797 GAGGGCCTGAAGGCTGGAGTGGG + Intergenic
1113424986 13:110200369-110200391 CAGGGAGGCAAGGCTGGGGCTGG + Intronic
1113539522 13:111095313-111095335 CAGGGCAGCAAGCCTGGACGAGG + Intergenic
1113843029 13:113371202-113371224 CAGGGCAGGAAGCTTGGTGGGGG + Intergenic
1113852629 13:113426478-113426500 CAGAGCTGGAGGGCTGCAGCGGG + Intronic
1113897723 13:113776468-113776490 CAGCCCAGACAGGCTGGAGCCGG + Intronic
1113961885 13:114130819-114130841 GGGGGCAGGAGGGCTGGAGGTGG - Intronic
1114364781 14:22014258-22014280 CAGGGATGGAAGGTTGGAGCAGG + Intergenic
1114441316 14:22750650-22750672 CAGGGCTAGAAGGCTGGACGTGG - Intergenic
1114483494 14:23049240-23049262 CAGGGCGGGAGGGCAGCAGCAGG + Exonic
1114749533 14:25187550-25187572 CAGGGCAATAAGGCAGGAGAAGG + Intergenic
1114978223 14:28128193-28128215 CTGTACAGGAAGCCTGGAGCTGG + Intergenic
1115641045 14:35335799-35335821 CCGGGAAGGCCGGCTGGAGCAGG - Intergenic
1115964583 14:38873372-38873394 CACGGCACGAAGCCTGGTGCAGG - Intergenic
1116521661 14:45855602-45855624 ATGGGCTGGCAGGCTGGAGCTGG - Intergenic
1116736771 14:48701284-48701306 CAGGGCAGTCAGGCAGGAGAAGG + Intergenic
1116936762 14:50748469-50748491 CAGGGCAGTCAGGCAGGAGAAGG + Intronic
1117348153 14:54854373-54854395 GAGGGCAGGAAGGCAGGAAGTGG + Intronic
1117441204 14:55761010-55761032 TGGGGCAGGAAGGCAGCAGCTGG + Intergenic
1117529311 14:56643657-56643679 CAGGGCAGTCAGGCAGGAGAAGG + Intronic
1117948501 14:61057113-61057135 CAGGGCAGTCAGGCAGGAGAAGG - Intronic
1118165265 14:63329867-63329889 CAGGACACTAAGGCTGGAGGTGG - Intergenic
1118910789 14:70060361-70060383 CAGGGGAGGAAGGCAGGAAGGGG + Intronic
1118955984 14:70480833-70480855 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
1119262166 14:73244405-73244427 CAGGCCTGGAGGGCGGGAGCAGG - Intronic
1119319487 14:73721247-73721269 CAGGGCAAGCAGGGTGGAGCTGG - Intronic
1119326833 14:73764836-73764858 CAGGGCAGGGAGGCTGGGGAGGG - Intronic
1119332121 14:73802660-73802682 TAGGGCAGGAAGGCAGGACCAGG + Intergenic
1119408603 14:74414007-74414029 AAGGGCAGGAAGGCTGTGTCTGG - Intronic
1119681683 14:76597032-76597054 CTGGGGAGGATGGCTGGTGCTGG + Intergenic
1119709042 14:76808079-76808101 CAGGGCCTGAAGGCAGGAGATGG - Exonic
1119857402 14:77910771-77910793 GGGGGCAGCTAGGCTGGAGCTGG + Intronic
1119869930 14:78008329-78008351 GAGGGCAGAAAGGCAGGGGCTGG + Intergenic
1120996946 14:90424291-90424313 CATCTCAGGAAGGCTGGGGCAGG + Intergenic
1121151582 14:91640160-91640182 AAGGTGAGGAAGGCTGGGGCTGG - Intronic
1121428852 14:93873012-93873034 CAGGGCAAGAAGGATGGGACAGG + Intergenic
1122101093 14:99410110-99410132 CAGGGCAGCCACGCTGGAGGAGG + Intronic
1122118124 14:99537665-99537687 CAGGGCGGGGAGGCTGGGCCTGG - Intronic
1122287023 14:100658323-100658345 CAGGACAGGAGTCCTGGAGCTGG + Intergenic
1122288237 14:100665545-100665567 CAGGGCAGGGTGGCAGGAGCTGG - Intergenic
1122355348 14:101119873-101119895 CAGGACAGGAAAGCAGGAGGTGG - Intergenic
1122389648 14:101371405-101371427 AAAGGAAGGAGGGCTGGAGCTGG + Intergenic
1122540195 14:102493727-102493749 CACAGCAGGGAGGCTGGGGCGGG - Intronic
1122632019 14:103111550-103111572 CAGGGCTGGAGGTCAGGAGCAGG + Intergenic
1122693508 14:103542286-103542308 GAAGGCAGGGAGGCTGGGGCAGG + Intergenic
1122870173 14:104634857-104634879 CGGGGCAGGGCTGCTGGAGCTGG - Intergenic
1122919686 14:104874884-104874906 CAGGGCAGGGAAGCTGCAGCTGG - Intronic
1123034831 14:105467656-105467678 CAGGAAAGGAGGGCTGGGGCTGG - Intronic
1202920806 14_KI270723v1_random:29179-29201 GAGGGCAGGAAGGCCAGGGCTGG + Intergenic
1124408588 15:29415647-29415669 CAGGGCAGTCAGGCAGGAGAAGG + Intronic
1124532755 15:30521322-30521344 CATGGCGGGGAGGCTGGAGGAGG - Intergenic
1124650249 15:31469080-31469102 GAGGGCCTGAAGGCTGGGGCCGG - Intergenic
1124729889 15:32187561-32187583 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
1124765899 15:32486322-32486344 CATGGCGGGGAGGCTGGAGGAGG + Intergenic
1124940436 15:34212632-34212654 CAGGGGAGGGATGGTGGAGCTGG + Intergenic
1125494481 15:40179166-40179188 CAGGGAGGGAAGGGTGGAACAGG + Intronic
1125577963 15:40767915-40767937 GAGGGGTGGATGGCTGGAGCTGG + Exonic
1125758817 15:42083620-42083642 CAGGGCAGGAGGCCAGCAGCAGG - Intronic
1127017300 15:54702955-54702977 CAGGGCAATAAGGCAGGAGAAGG + Intergenic
1127090950 15:55466327-55466349 TAAGGCAGGATGGCTTGAGCTGG + Intronic
1127156818 15:56136610-56136632 CAGGGCAGTCAGGCAGGAGAAGG - Intronic
1127335727 15:57981160-57981182 CAGTGCAGGAACCCAGGAGCTGG - Intronic
1128345763 15:66851444-66851466 CCGGGCAGGGAGCGTGGAGCTGG + Intergenic
1128747787 15:70126632-70126654 CAGGGCAGGCTTGCTGGAGGAGG - Intergenic
1128792976 15:70446749-70446771 AGGGGCAGGAAGGTTTGAGCTGG - Intergenic
1129457795 15:75684945-75684967 CAGGGCATGAAGGGTGCTGCTGG - Intronic
1129573213 15:76712932-76712954 CAGGGCAGTCAGACTGGAGAAGG - Intronic
1129738047 15:77976622-77976644 CCGGGGAGGAAGGTGGGAGCAGG + Intergenic
1129798751 15:78397471-78397493 CAGGGCAGGAAGTCTGGGGTTGG + Intergenic
1129848029 15:78776987-78777009 CCGGGGAGGAAGGTGGGAGCAGG - Intronic
1130038469 15:80383001-80383023 GAGGCTAGGAAGGGTGGAGCAGG + Intronic
1130258172 15:82335407-82335429 CAGGGGCGGGAGGCTGGAGAAGG + Intergenic
1130596757 15:85254553-85254575 CAGGGGCGGGAGGCTGGAGAAGG - Intergenic
1130888372 15:88112469-88112491 AAGGTCAGGAAGGCTGGGGTGGG + Intronic
1130902212 15:88215547-88215569 CAGGGGAGCCAGGCTGGGGCTGG + Intronic
1130968145 15:88712115-88712137 CAGGGAAGGCTGGCTGGAGGTGG + Intergenic
1131259903 15:90882855-90882877 CAGGGCAGCCAGGGAGGAGCAGG - Exonic
1131382385 15:91974602-91974624 CAGGGCAGGGAGGCGGGAGGTGG + Intronic
1131444609 15:92487150-92487172 CAGGGCAGTCAGGCAGGAGAAGG + Intronic
1131646611 15:94351853-94351875 GAGGGCATGAAGTCAGGAGCTGG - Intronic
1131947691 15:97644654-97644676 CAGGGGTGGAAGGCTGGGGGAGG + Intergenic
1132113343 15:99118062-99118084 CAGGGCTGGGAGTCTGCAGCGGG - Intronic
1132217085 15:100071903-100071925 CAGGGCAGTCAGGCAGGAGAAGG + Intronic
1132218678 15:100087986-100088008 CAGGGCAGTCAGGCAGGAGAAGG + Intronic
1132390256 15:101433571-101433593 CAGGGCAGGCTGCCTGGAGGAGG + Intronic
1132567225 16:629058-629080 CAGGACAGGGAAGCTGGAGCAGG - Exonic
1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG + Intronic
1132682996 16:1151522-1151544 CCGTGGAGGGAGGCTGGAGCAGG - Intergenic
1132708707 16:1257174-1257196 GAGGCCAGGATGGATGGAGCAGG + Intronic
1132877992 16:2148738-2148760 CAGGGCACGGCGGCTGCAGCGGG + Exonic
1132883558 16:2172682-2172704 CCGGGGAGGTAGGCCGGAGCTGG + Intronic
1132971743 16:2692668-2692690 GAGGGCATGAAGGCTGGGGCCGG - Intronic
1133171215 16:3983554-3983576 CAGGGCAGGAAGGCTCTCGGAGG + Intronic
1133353642 16:5119898-5119920 CAGCTGAGGAAGGATGGAGCCGG + Intergenic
1134017804 16:10901564-10901586 CAGGGCAGGTGGGCTGGGGTTGG + Intronic
1134090362 16:11388323-11388345 GACCGCAGGAAGGCAGGAGCAGG + Intronic
1134242018 16:12513277-12513299 CAAGGCAGGAGGGCTGGGGAGGG - Intronic
1134344759 16:13379466-13379488 CAGGAAAGGCAGGCTGGAGCAGG - Intergenic
1134675951 16:16090694-16090716 CAGGGCATGAGGGTGGGAGCTGG + Intronic
1135110525 16:19687346-19687368 CAGGGCAGCAAAACTGCAGCTGG - Intronic
1135193255 16:20372591-20372613 CTGGGCAGGAAGAATGGAGAAGG + Intronic
1135620798 16:23953652-23953674 CAGGAAAGGAAGGCTGCAACAGG + Intronic
1136466148 16:30445383-30445405 CAGGGCTGGAAAGGTGGGGCTGG + Exonic
1136705530 16:32185057-32185079 TGGGTCTGGAAGGCTGGAGCAGG + Intergenic
1136718391 16:32302222-32302244 CAGGGCCGGAAGGCAGGGCCAGG + Intergenic
1136762383 16:32744350-32744372 TGGGTCTGGAAGGCTGGAGCAGG - Intergenic
1136805716 16:33126036-33126058 TGGGTCTGGAAGGCTGGAGCAGG + Intergenic
1136836766 16:33508492-33508514 CAGGGCCGGAAGGCAGGGCCAGG + Intergenic
1137000689 16:35227742-35227764 CAGGGCAATTAGGCAGGAGCAGG - Intergenic
1137228623 16:46539494-46539516 CAGGGCAATTAGGCAGGAGCAGG + Intergenic
1137476234 16:48811761-48811783 CGGGGCAAGAAGGATGGGGCTGG - Intergenic
1137634384 16:49973344-49973366 ATGGGCAGGTAGGCTGGTGCTGG - Intergenic
1137828734 16:51523857-51523879 CAGGTCATGGAGGCTGGATCAGG + Intergenic
1138383303 16:56618367-56618389 CAGAGCAGAAAGCCTGGAGAGGG - Intergenic
1138384462 16:56626656-56626678 TAGGGCAGAAAGCCTGGAGAGGG - Intronic
1138385561 16:56633530-56633552 TAGGGCAGAAAGCCTGGAGAGGG - Intronic
1138388421 16:56652326-56652348 CAGTCCAGGAAGACTGGGGCTGG - Intronic
1138388497 16:56652760-56652782 CAGAGCAGAAAGCCTGGAGAGGG - Intronic
1138720755 16:59076387-59076409 CAGGGCAGTCAGGCAGGAGAAGG + Intergenic
1139549036 16:67663389-67663411 CTGGGCAGGGAGGCTGGAGGGGG - Intronic
1139908801 16:70383891-70383913 TAGGGGAGGAAGGTTGGGGCTGG - Intronic
1139987268 16:70908964-70908986 AGGGTCAGGAAGGCTAGAGCAGG + Intronic
1140551802 16:75874264-75874286 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
1140599977 16:76464066-76464088 CAGGGCTGGAAGCAAGGAGCCGG + Intronic
1140834674 16:78782143-78782165 CAAGGCGAGAAGGCTGGAGGGGG - Intronic
1140991125 16:80212623-80212645 CAAAGCAGGAAGACTGGAGGTGG + Intergenic
1141605673 16:85152027-85152049 CAGGGCAGCCAGGCCTGAGCTGG + Intergenic
1141828395 16:86496464-86496486 CAGGGCAGCCAGGCTGATGCGGG - Intergenic
1141920128 16:87130059-87130081 CAAGGCAGGAAGAGGGGAGCTGG - Intronic
1141985152 16:87575170-87575192 CAGTGCAGGGAGGAGGGAGCAGG - Intergenic
1142158137 16:88542306-88542328 CAGGCCAGGCAGGCTGGTGGGGG - Intergenic
1142178873 16:88657634-88657656 CCGGGCAGGTGGGCAGGAGCAGG - Intronic
1203008037 16_KI270728v1_random:215543-215565 CAGGGCCGGAAGGCAGGGCCAGG - Intergenic
1203064539 16_KI270728v1_random:1004669-1004691 TGGGTCTGGAAGGCTGGAGCAGG - Intergenic
1142558644 17:796672-796694 CAGGGAAGGGAGGCTGAGGCCGG - Intergenic
1142594749 17:1024075-1024097 CCGGGCAGGGAGGGTGAAGCTGG - Intronic
1143178886 17:4972301-4972323 GAGGGCAGGAAGGGAGGAGAGGG + Exonic
1143183729 17:4998680-4998702 CAGGACAGGAAGGGAGTAGCTGG - Intronic
1144091675 17:11863014-11863036 CAGGGCAGTTAGGCAGGAGAAGG - Intronic
1144515801 17:15917078-15917100 CATGGGAGGATGGCTTGAGCAGG + Intergenic
1144848616 17:18232904-18232926 CAGGGCGGGATGCCTTGAGCTGG + Intronic
1145105166 17:20109359-20109381 CAGTGCCGGAAGACTGGAGAAGG - Intronic
1145249425 17:21289269-21289291 CAGGGCAGGCCTGCAGGAGCAGG - Intronic
1145813792 17:27781253-27781275 CAGAGCAGGTAGGGTGGAGAGGG - Intronic
1145964070 17:28904379-28904401 GATGGCAGGAAGGGTGGGGCTGG + Intergenic
1145976298 17:28986234-28986256 GCGGGCAGGGAGGCGGGAGCGGG - Intronic
1146279595 17:31536677-31536699 CAGGGCAGGAAGTGAGGACCTGG - Exonic
1146554380 17:33811204-33811226 CAGAGAAGGAGGGCTGGAGCAGG - Intronic
1146891746 17:36510819-36510841 CAGGGCAGGCAGACAGCAGCAGG - Exonic
1147440662 17:40445438-40445460 CAGGACAGGAAGCTTGGGGCTGG - Intronic
1147669371 17:42167912-42167934 CAGGGCAGGAAGGCACGACATGG - Intronic
1147725182 17:42562508-42562530 CAGAGAAGGAGGCCTGGAGCAGG - Intronic
1147784787 17:42971722-42971744 CAGGCCAGGAGGGCAGGAGCAGG + Intronic
1147955792 17:44133661-44133683 TAGGCCAGGAAGGCAGGAGGTGG - Intergenic
1148152113 17:45403077-45403099 GAGGGCAGGGAGGCTGGGGGTGG - Intronic
1148177135 17:45576482-45576504 CAGAGAAGGCAGGCTGGAGAGGG + Intergenic
1148227193 17:45907167-45907189 CAGGGCAGGCTGGCAGGAGGCGG - Intronic
1148237038 17:45975959-45975981 CAGGGGAGGATAGCTGGAGATGG - Intronic
1148689703 17:49520185-49520207 CAGGGCAGGAAGACTGTGGAGGG - Intergenic
1149004402 17:51790006-51790028 CAGCAGAGCAAGGCTGGAGCTGG - Intronic
1149077594 17:52615222-52615244 CAGGGCAGTTAGGCAGGAGAAGG - Intergenic
1149081044 17:52657590-52657612 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
1149363060 17:55914072-55914094 CAGTGCAGGAAGGCTGTGGGTGG + Intergenic
1149578023 17:57727671-57727693 CAGGGAAGGAAGGAGGGAGGAGG + Intergenic
1149991490 17:61385977-61385999 CTGGGGAGGGAGGCTGGAGAGGG + Intronic
1150129489 17:62659602-62659624 CATGGCAGGAGGGAAGGAGCAGG + Intronic
1150209566 17:63434695-63434717 CAGGGCAGGGAGGCAGGGGCTGG - Intronic
1150589363 17:66548739-66548761 CAAGGCAGGGCGGCTGGAGGAGG + Intronic
1150748224 17:67834089-67834111 CAGAGAAGGCAGGCTGGAGAAGG - Intronic
1150839728 17:68596583-68596605 CAGGGCAGGCAGGCTTTACCTGG - Intronic
1151356239 17:73560269-73560291 CTGGGCTGCAGGGCTGGAGCTGG + Intronic
1151363729 17:73604093-73604115 CTGGCCAGGAAGGCTGACGCTGG - Intronic
1151705100 17:75763278-75763300 CAGGGAAGGAGGGCTGGGTCAGG + Intronic
1151852366 17:76698418-76698440 CAGGGAGGGCAGGCTGGGGCAGG + Intronic
1151911492 17:77086419-77086441 CTGGGCAGAATGGCTGGAGCAGG + Intergenic
1152321290 17:79610036-79610058 CACGATAGGAAGGCTGGAACGGG - Intergenic
1152589356 17:81203796-81203818 CAGGACAGGAAAGCTGGACCAGG + Intronic
1152635978 17:81430695-81430717 CATCACAGGAAGGATGGAGCTGG - Intronic
1152852844 17:82648047-82648069 AAGGCCAGGAAGGTGGGAGCCGG + Intronic
1152862309 17:82703483-82703505 CAGGGCTGGAAGGCGGACGCAGG - Intergenic
1152876497 17:82789539-82789561 CAGGTCAGGACGACTGGGGCAGG - Intronic
1152896490 17:82914320-82914342 CAGGGTGGGAAAGCTGGAGTTGG - Intronic
1153446024 18:5174035-5174057 CAGGGCAGGAAGCAAAGAGCAGG - Intronic
1153690602 18:7589459-7589481 CATGGTAGGAATGCTGGAGCTGG + Intronic
1154204759 18:12327199-12327221 CAGAGCAGGAGGGCTGGCACTGG - Intronic
1154394834 18:13977855-13977877 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
1154513365 18:15134541-15134563 CTGTACAGGAAGGGTGGAGCAGG - Intergenic
1154519751 18:15214290-15214312 CAGGGCAATAAGGCAGGAGAAGG - Intergenic
1155450801 18:25960683-25960705 CAGGGCAGTAATGCTGTACCTGG - Intergenic
1156349140 18:36287924-36287946 TAGGGAAGGATGGCAGGAGCAGG + Intergenic
1157117396 18:44874938-44874960 CAGAAAAGGAAGGCTGAAGCAGG + Intronic
1157289231 18:46398310-46398332 CAGGGCAGGAAGAAGGAAGCAGG + Intronic
1157676573 18:49573025-49573047 CAGGGCAGGCAGGCTCTGGCTGG + Intronic
1158271098 18:55717493-55717515 CAGGGCAATTAGGCTGGAGAAGG - Intergenic
1159884436 18:73890894-73890916 AAGGGCAGGGAGGCAGGACCCGG + Intergenic
1160171921 18:76562377-76562399 CGGTGCAGAAGGGCTGGAGCTGG - Intergenic
1160433071 18:78825532-78825554 CAGGGCAGGAGGTGGGGAGCAGG + Intergenic
1160541247 18:79624427-79624449 CAGGGCACAAAGCTTGGAGCGGG - Intergenic
1160620510 18:80167414-80167436 CAGGGCAGCAAGCTTGGAGCAGG + Intronic
1160799193 19:959991-960013 CAGGTCAGGAGGACAGGAGCAGG - Intronic
1160845342 19:1163803-1163825 CCCGGCAGGAGGGCAGGAGCCGG + Intronic
1160863724 19:1248453-1248475 CAGGGCCGGCAGGCAGGGGCGGG + Intergenic
1161135105 19:2615035-2615057 CAGGGAAGGAGGGCTTGGGCAGG - Intronic
1161179128 19:2867580-2867602 CAGGGAATGAAGACTGGGGCAGG - Intronic
1161329598 19:3679984-3680006 CAGGGCCAGAGGGCAGGAGCTGG - Intronic
1161428652 19:4217953-4217975 CCGGGCAGCCAGTCTGGAGCAGG + Exonic
1162154096 19:8664815-8664837 CTGGGCAGGAGGGGTGGAGAAGG + Intergenic
1162339937 19:10086290-10086312 CCGGGGAGGAAGGGCGGAGCCGG + Exonic
1162362520 19:10228588-10228610 CAGGGCACTGAGGTTGGAGCTGG + Intronic
1162527047 19:11212161-11212183 CAGGGGCGGGAGGGTGGAGCCGG + Intronic
1163005293 19:14393649-14393671 CAGGGCAGGAGGGGTGGGGCTGG - Intronic
1163054195 19:14706105-14706127 CTGGGCAGGATGGCAGCAGCAGG - Intronic
1163872096 19:19830651-19830673 CAGAGCAGGTAGCTTGGAGCAGG + Intergenic
1164229657 19:23276156-23276178 GAGGGCAGGAAGGCCAGGGCTGG - Intergenic
1164245138 19:23421898-23421920 GAGGGCAGGAAGGCCAGGGCTGG - Intergenic
1164308922 19:24029627-24029649 GAGGGCAGGAAGGCCAGGGCTGG + Intergenic
1164723618 19:30450855-30450877 TGGGGAAGGAAGGCTGGAGTTGG - Intronic
1164966312 19:32487661-32487683 GAGAGAAGGAAGGCTGGAACAGG - Intergenic
1165106044 19:33470184-33470206 CAGGCCAGAGAGGCTGGGGCTGG - Intronic
1165117565 19:33538124-33538146 CAGGGCAGGGAGACTAGGGCTGG - Intergenic
1165166851 19:33863177-33863199 GAGGCCAGGCAGGCTGGAGCAGG + Intergenic
1165751857 19:38265006-38265028 CCGGGCGGGTAGGCTGGAGGCGG + Intronic
1166068653 19:40375204-40375226 GAGGGCAGGAAGCCTGAGGCAGG + Intronic
1166103240 19:40583573-40583595 GTGGGCAGGGAGGGTGGAGCGGG - Intronic
1166130885 19:40744835-40744857 CAGGGCTGGAGGGCTGGGGGTGG + Intronic
1166214669 19:41327508-41327530 GGGGGCAGGAAGGCCTGAGCTGG + Intronic
1166318137 19:42000049-42000071 CAGGTCAGCATGGCTGGAGGGGG + Intronic
1166678493 19:44753809-44753831 GGGGGCAGGAAGGCGGGGGCGGG + Intronic
1166714527 19:44958254-44958276 AAGGGCGAGGAGGCTGGAGCGGG + Intronic
1166747196 19:45146939-45146961 CCGGGCAGGCAGCCTGGTGCCGG + Exonic
1166781404 19:45345394-45345416 CTGGCCAGGATGGGTGGAGCAGG + Intronic
1166785622 19:45364988-45365010 CAGGACAGGTAGCCTGGGGCAGG - Intronic
1166827874 19:45620798-45620820 GAGGCCAGGAAGGGAGGAGCAGG + Intronic
1166970326 19:46562844-46562866 AATGGAAGGAAGGCTGGGGCTGG + Intronic
1167249513 19:48392748-48392770 CAGGGCAGAAACTCTGGAGCAGG - Intergenic
1167299855 19:48672171-48672193 AGAGGCAGGAAGGCAGGAGCTGG + Intronic
1167309485 19:48728868-48728890 TAGGGAAGGGAGGCTGGAGAAGG + Intronic
1167321393 19:48799201-48799223 CAGGGCAGGAAGGAGACAGCTGG - Intronic
1167328747 19:48841124-48841146 GAGGGGAGGAGGGCTGGGGCTGG - Intronic
1167608288 19:50493325-50493347 CAGGGCAGGAAGGCCTGCGGAGG + Intergenic
1167921561 19:52786802-52786824 CGGGGCAGGTTGGCTGGACCTGG + Intronic
1168344450 19:55643600-55643622 TAGGGAAGGAAGGTTGGGGCGGG - Intronic
1202703563 1_KI270713v1_random:5023-5045 CGGGGCTGGAAGCCTGGAACCGG + Intergenic
924960011 2:26342-26364 CAGGGCAGGCAGGCTTAGGCTGG + Intergenic
925051583 2:819674-819696 CCCGGCTGGTAGGCTGGAGCGGG + Intergenic
925100309 2:1238706-1238728 AAGGGCAGCAAGGCTGGTCCAGG - Intronic
925159761 2:1675900-1675922 CAGCGCAGGAGTGCTGGGGCTGG + Intronic
925850904 2:8081244-8081266 CTGGGAAGGAAGGCTAGGGCAGG - Intergenic
925880106 2:8345363-8345385 CAGGTCTGGAAGGCTGGGTCAGG + Intergenic
926101812 2:10122745-10122767 CAGGACAGGACGGCTGGGACAGG - Exonic
926108254 2:10165922-10165944 CAGGGAAGGAAGCCTGGACTGGG + Intronic
926143944 2:10385424-10385446 CAGGGAAGCAAGCCTGGAGCAGG - Intronic
926228179 2:10983247-10983269 CAGGGCAGGGAGGTGGGAGAGGG - Intergenic
926269792 2:11356655-11356677 CAGGTGAGCAAGACTGGAGCAGG + Intergenic
926317555 2:11722238-11722260 AAGGCTAGGAAGGATGGAGCTGG - Intronic
926568399 2:14503447-14503469 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
926752840 2:16212041-16212063 CAGGGGAGAAAGGCTGGAGAAGG + Intergenic
927194433 2:20538055-20538077 CAGAGAAAGAAGGCTGGAGGCGG - Intergenic
927458189 2:23275436-23275458 TAGGGCAGTATGGCTGGAGTAGG + Intergenic
927525948 2:23740699-23740721 CAGGGCAGTCAGGCAGGAGAAGG + Intergenic
927863871 2:26576649-26576671 CAGGGCAGGGAGGGGTGAGCAGG - Intronic
927875258 2:26650995-26651017 GAGGGCAGCCAGGCTGGAGAGGG + Intergenic
927963811 2:27257115-27257137 GTGGGGAGGAAGGCTGGGGCAGG + Intronic
928105913 2:28470514-28470536 CAGGGTCGGAAGGCAGGTGCTGG + Intronic
928200727 2:29246199-29246221 GAAGGCAGGCAGGCTGGAGGGGG + Intronic
928249458 2:29662250-29662272 AAGGGCAGGGAGGCTGGCCCCGG - Intronic
928865877 2:35917273-35917295 CTGTGCAGGAAGGCAGGAGATGG - Intergenic
929608922 2:43255430-43255452 CAGGGAAAGAAGGCAGGAACAGG - Intronic
929672129 2:43884480-43884502 AAGGGCAGGAAGACTGAAGCTGG + Intergenic
930037336 2:47094928-47094950 CAGGGCTGGGAGGCTGGGACTGG + Intronic
930164786 2:48194393-48194415 GAGGCCAGCATGGCTGGAGCAGG + Intergenic
932416514 2:71576669-71576691 CAGGGCAGGAAGGCTGGAGCGGG + Intronic
932642635 2:73464593-73464615 CAGGGCAGTTAGGCAGGAGAAGG + Intronic
932734308 2:74243584-74243606 CCGGGCAGGAAGGCTGGCTCAGG + Intronic
932776643 2:74531805-74531827 CAGGGAAGGAAGGATGTAGCTGG + Intronic
933640610 2:84755275-84755297 CAGGGCAGAAAGGCAAGAGAGGG - Intronic
933709667 2:85315973-85315995 GAGGGCAGAAAGGGTGGGGCAGG - Intergenic
933713401 2:85343801-85343823 GAGGGCAGAAAGGGTGGGGCAGG + Intronic
934115903 2:88793172-88793194 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
934474018 2:94580805-94580827 GAAGGCAGGAAGGAAGGAGCAGG - Intergenic
935555277 2:104503069-104503091 CAGAGCAGGAACTCAGGAGCTGG - Intergenic
936059067 2:109282809-109282831 CAGGGCTGGCAGGCAGGAGGAGG + Intronic
936456606 2:112679754-112679776 CACGGCTGGCAGGCTGGGGCTGG - Intergenic
936997718 2:118432929-118432951 CAGGGCTGGAAGGGTGGAGGAGG + Intergenic
937140476 2:119595908-119595930 CAGGGCTGCAAGGCTGGAACAGG + Intronic
937346687 2:121130416-121130438 CAGGGGAGCAAGGCTGAGGCAGG - Intergenic
937435758 2:121879772-121879794 TAAGACAGGAAGGCTGGAGGGGG + Intergenic
937991229 2:127663631-127663653 CTGGGCAGAAGGGCTGGGGCGGG - Intronic
938291880 2:130154904-130154926 CAGGGCAGGCAGGATCCAGCCGG + Intronic
938382846 2:130846404-130846426 CGGGGCAGGGAGGCTGGCGTAGG - Intronic
938513611 2:131979152-131979174 CTGTACAGGAAGGGTGGAGCAGG - Intergenic
938720955 2:134066050-134066072 CAGGGCAATAAGGCAGGAGAAGG + Intergenic
938765888 2:134460263-134460285 GAGGGCAGGATGGCTGTTGCAGG - Intronic
938790327 2:134670460-134670482 CAGGGCAAGATTGCTGGAGAGGG - Intronic
939470022 2:142609776-142609798 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
939973482 2:148688965-148688987 CAGGGAAGGAATGCTAGAGGAGG + Intronic
940307708 2:152244286-152244308 AAGGACAGGAAGGCAGGAGCAGG + Intergenic
940638542 2:156326163-156326185 CAGGGCAGCAATGCAGGAGAAGG + Exonic
940863279 2:158791678-158791700 CAGGGCAGGAAGGCTGTGCTGGG + Intergenic
941362489 2:164569264-164569286 TAGGGGAGGGAGGCTGGAGGAGG + Intronic
941559280 2:167024447-167024469 CAGGGCAGTTAGGCAGGAGAAGG - Intronic
942066583 2:172277293-172277315 GTGGTCAGGAAGGCTGGAGAGGG + Intergenic
942121259 2:172779799-172779821 CAGGGCAGGAAGTCTTGAAGTGG + Intronic
942164445 2:173228397-173228419 GAGGGCAGCACGGCTTGAGCTGG - Intronic
942594630 2:177581147-177581169 CAGGGCAGATAAGCTGGAGGAGG + Intergenic
942640622 2:178057652-178057674 CAAGGTTGGAAGGATGGAGCAGG - Intronic
943211735 2:184975772-184975794 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
943773013 2:191739445-191739467 TAGAACAGGAAGGCTGGAGGAGG - Intergenic
944634048 2:201657183-201657205 CAGGGTAGAAAGAGTGGAGCAGG + Intronic
945124885 2:206497650-206497672 CAGGGCAGTCAGGCAGGAGAAGG + Intronic
946362636 2:219228585-219228607 TGGGGCAGGAAGGCTGCAGTGGG + Intronic
946433217 2:219636468-219636490 TGGGGCAGGATGGATGGAGCAGG - Intronic
947692384 2:232151192-232151214 CAGGGCAGTCAGGCAGGAGAAGG - Intronic
947695039 2:232178803-232178825 CAGGGCAGTCAGGCAGGAGAAGG - Intronic
947736749 2:232459175-232459197 CAGGGCAGGACGCCCGGAGGTGG - Exonic
948028839 2:234800144-234800166 CAGAGCAAGGAGGATGGAGCTGG + Intergenic
948055530 2:235007189-235007211 CCCTGCAGGAAGGCAGGAGCAGG + Intronic
948202189 2:236137228-236137250 CCGGGCAAGAAGGCTGCTGCTGG - Intergenic
948641643 2:239379132-239379154 CACTCCAGGAAGGCAGGAGCTGG + Intronic
948671305 2:239570495-239570517 CAGGGGAGGAAGGCTGACCCAGG + Intergenic
948764353 2:240211929-240211951 CAGGGCAGTAAGGCCAGGGCTGG + Intergenic
948805655 2:240452651-240452673 GCGGGCAGGAAGGCGGGCGCAGG + Intronic
948888651 2:240896474-240896496 CCTGGCAGGGAGGCTGGGGCAGG - Intronic
1168811383 20:706779-706801 CAGGGAAGGATGGCTGGAAAAGG - Intergenic
1168961231 20:1871436-1871458 CGGGGCTGGAAGGTGGGAGCAGG - Intergenic
1169125068 20:3121624-3121646 CAGGGATGGAGTGCTGGAGCAGG + Exonic
1169171800 20:3471215-3471237 CAGGGCTGGGAGGCCGGGGCTGG + Exonic
1169520630 20:6368980-6369002 ATGGGCTGGCAGGCTGGAGCTGG - Intergenic
1169746351 20:8946889-8946911 CAGGGGAGGAAAGCTGCAGCAGG - Intronic
1170140487 20:13121255-13121277 CAGGGCTGGAATTCTGGAGAAGG + Intronic
1170397041 20:15937404-15937426 CAGGGCAGGAAAGCCACAGCTGG + Intronic
1170502854 20:16992733-16992755 CAGGGCAATTAGGCTGGAGAAGG - Intergenic
1170827514 20:19809284-19809306 CAGGCAAAGAAGGCTGAAGCAGG + Intergenic
1171421571 20:25021135-25021157 GAGGGCAGGAGTGCAGGAGCAGG + Intronic
1171472093 20:25380466-25380488 CAGGGAGGGATGGCTGGAGGGGG - Intronic
1171488273 20:25499076-25499098 CATGGCAGGGCGGCTGAAGCAGG + Intronic
1171958772 20:31478500-31478522 CAGGGCAGGAAGACAGCAGTAGG + Intronic
1171972456 20:31572968-31572990 CAGGGCGGGGAGGCAGGGGCAGG - Intronic
1172097321 20:32466813-32466835 CAGCCCAGGGAGGCTGGTGCAGG + Intronic
1172292227 20:33784388-33784410 CAGGGGAGGGAGGCTGGAGGGGG - Intronic
1172460737 20:35116453-35116475 CAGGACAGAAAGGCAGCAGCTGG - Intronic
1172635192 20:36405600-36405622 TGGGGCAGGGAGGCTGGAGCGGG + Intronic
1172731208 20:37089802-37089824 CATGCCTGGGAGGCTGGAGCGGG + Intronic
1173059687 20:39649930-39649952 CAGGTCCTGAAGGCTGGGGCTGG + Intergenic
1173086178 20:39920750-39920772 CAGGGCAATCAGGCTGGAGAAGG + Intergenic
1173225994 20:41162791-41162813 CAGGGCAGCAGGGCTGAGGCAGG - Intronic
1173367588 20:42401042-42401064 CAGGACAGGAACACAGGAGCAGG + Intronic
1173564150 20:44027404-44027426 CAAGGCAGGAAGCCTGGTGGTGG - Intronic
1173849695 20:46210211-46210233 GAGGGGAGGAGGGCTGGGGCGGG - Intronic
1173858229 20:46265007-46265029 CAGGGCAGGGAGACAGGTGCAGG - Intronic
1174072048 20:47906153-47906175 CAGGGCAGGAAGGTTGGGGGTGG - Intergenic
1174151993 20:48492516-48492538 CAGGGCAGGAAGATTGGGGGTGG + Intergenic
1174548352 20:51343409-51343431 GAGGCCAGTATGGCTGGAGCAGG + Intergenic
1174623443 20:51894824-51894846 CAGGGCAGGAAGGGAGTGGCAGG - Intergenic
1175017625 20:55808908-55808930 CAGGGCAGTTAGGCAGGAGAAGG - Intergenic
1175141963 20:56867353-56867375 CAAGGCAGACAGGCTGGGGCTGG + Intergenic
1175224821 20:57439097-57439119 CAGGGCAGGGGGGCGGGAGGTGG - Intergenic
1175258208 20:57659416-57659438 CAGGGCAGGAAGACAGGGGCTGG - Intronic
1175594497 20:60220059-60220081 CAGGCCAGGAACGCTGGCTCAGG + Intergenic
1175601343 20:60276267-60276289 CAGGGTAGGGAGGAGGGAGCTGG - Intergenic
1175645227 20:60665066-60665088 CAAGGCAGGAAGGTTGAAGGAGG - Intergenic
1175924323 20:62464634-62464656 CAGAGCAAGAAGGCTGGTGAGGG - Exonic
1175949851 20:62577614-62577636 GAGGGCAGCAGGGCTGGGGCTGG + Intergenic
1175977501 20:62718509-62718531 CAGGGCTGGAGGGCGGGGGCCGG - Intronic
1175998155 20:62820521-62820543 GAGGGCAGGAAGGCTGGGCTGGG + Intronic
1176115162 20:63429038-63429060 CAGGGCAGGAAGACAGGGGTGGG - Intronic
1176122566 20:63460676-63460698 CTGGCCAGGAAGGCTGGTGAGGG - Intronic
1176148244 20:63574825-63574847 GATGGCAGTAAGGCTGGGGCTGG - Intergenic
1176780173 21:13183742-13183764 CTGTACAGGAAGGGTGGAGCAGG + Intergenic
1176881640 21:14201833-14201855 CAGGGCAATCAGGCTGGAGAAGG + Intronic
1177731900 21:25037781-25037803 CAGAGCAGGAAGTGAGGAGCAGG + Intergenic
1177743740 21:25185608-25185630 CAGAGAAGGAAGGCAAGAGCAGG + Intergenic
1177977826 21:27872760-27872782 CTGTACAGGAAGGGTGGAGCAGG + Intergenic
1178441272 21:32600453-32600475 CAAGGCAGGAAGGCCAGGGCAGG + Intronic
1178710464 21:34912194-34912216 CAGGGTACGTAGGCTGGAGGAGG - Intronic
1178903564 21:36616953-36616975 CACGGCAGCGAGGCTGGAGTGGG + Intergenic
1179008037 21:37531664-37531686 CAGGACAGGGTGGCTGGAGAGGG - Intergenic
1179008529 21:37534992-37535014 CAGAGGAGGAAGGCAGGAGAGGG + Intergenic
1179097118 21:38325748-38325770 CAGGGAAGGATGGTTGGATCAGG + Intergenic
1179272225 21:39860418-39860440 CAAGGCAGGAAGGCACTAGCAGG - Intergenic
1179419828 21:41226686-41226708 CAGTGGAGGTGGGCTGGAGCAGG + Intronic
1179422792 21:41249652-41249674 CAAGGAAGAAAGGCGGGAGCTGG - Intronic
1179979170 21:44887599-44887621 CAGGTCAGGATGGCAGGAGGGGG - Intronic
1180067672 21:45420737-45420759 CAGGGAAGGCAGCCTGGAGAAGG + Intronic
1180234274 21:46447939-46447961 CAGGTCAGGGAGGCGGCAGCAGG - Intergenic
1180368631 22:11963517-11963539 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
1180620439 22:17158614-17158636 GGGAGCAGGAGGGCTGGAGCCGG - Intronic
1180754328 22:18149945-18149967 GAGGGCTGGAAGTCTGGAGCAGG + Exonic
1180848445 22:18997463-18997485 CAGGGCAGGGATGCCTGAGCAGG - Intergenic
1180859336 22:19068305-19068327 CAGGGCTGCAAGGCCGGAGGGGG + Intronic
1180982501 22:19885461-19885483 CAGAGCACAGAGGCTGGAGCCGG - Intronic
1181040682 22:20191209-20191231 CAGGGCAGAAAATCTGGAGGAGG - Intergenic
1181046549 22:20217321-20217343 CGGGGCAGGAAGGCTGGATGGGG + Intergenic
1181111513 22:20605534-20605556 CAGGGCAGGCAGGGTCCAGCCGG + Intergenic
1181353437 22:22278786-22278808 CAGGGCAGTTAGGCAGGAGAAGG - Intergenic
1181419922 22:22790576-22790598 CAGGGCATGGAGGGTGGAGGTGG - Intronic
1181591746 22:23889661-23889683 CTGGGGAGGTGGGCTGGAGCTGG - Intronic
1181669647 22:24420230-24420252 AAGGGCCGGAATCCTGGAGCTGG + Intronic
1181672334 22:24431543-24431565 CAGGACATGAGGGATGGAGCAGG - Intronic
1181951077 22:26554328-26554350 CTGGGCAGGAAGTCCTGAGCAGG - Intronic
1182009270 22:26986702-26986724 CATGGAAGGGAGGCTGGAGTGGG + Intergenic
1182272701 22:29165499-29165521 CAGGGCATGAAGCCAGGAGGTGG + Intronic
1182300905 22:29336382-29336404 CAGGGCAGGTTGCCTGGAGGAGG - Intronic
1182428730 22:30288259-30288281 GAGGGAAGGAATGCAGGAGCAGG - Intronic
1182810511 22:33112141-33112163 CAGGGGGTCAAGGCTGGAGCTGG + Intergenic
1182998285 22:34834474-34834496 CAGAGCTGGGAGGCAGGAGCAGG + Intergenic
1183121877 22:35736388-35736410 CCCAGCAGGAAGGCAGGAGCAGG + Intergenic
1183316334 22:37139021-37139043 CCGGGGAGAAAGGCTGGAGCAGG + Intronic
1183407965 22:37639708-37639730 CAGGAGAGGCAGGCTGGACCGGG + Exonic
1183468079 22:37990144-37990166 AAGACCAGGGAGGCTGGAGCGGG + Intronic
1183780505 22:39995803-39995825 CTGGGGAGGAAGGCTGGACAGGG - Intronic
1183936303 22:41264401-41264423 CAGAGCCAGCAGGCTGGAGCAGG + Intronic
1184021928 22:41826745-41826767 CAGGGCAGGGAAGCTGCAGAGGG + Intergenic
1184116453 22:42425544-42425566 CAGGGAGGGAAGGAGGGAGCTGG - Intronic
1184147643 22:42620615-42620637 CAGGCCAGGAGGGCTGGCACTGG + Intronic
1184212220 22:43042850-43042872 CAGGAGAGGACGGCTGGATCAGG + Intronic
1184254064 22:43277048-43277070 CAGGGCAGGGAGGCTGAGGGTGG + Intronic
1184740493 22:46426115-46426137 CAGAGCAGCAAGGCTGGGGAGGG + Intronic
1184799355 22:46750543-46750565 GGGGGCTGGAAGTCTGGAGCTGG + Intergenic
1184877304 22:47283848-47283870 CGGGGCAGGGAGCCTGGAGAAGG + Intergenic
1185038066 22:48489921-48489943 CAGGGAAGGGAGGCTCGGGCCGG - Intronic
1185341029 22:50291194-50291216 CAGGGCAGGGGGCCTGGAGGTGG - Intronic
949247220 3:1939483-1939505 CAGGGTATGATGGCTGGGGCTGG - Intergenic
949864083 3:8532934-8532956 CAGGGAAGGATGGCTGCAGAGGG + Intronic
949927759 3:9055554-9055576 CAGGGGAGGGAGGCTGGGCCTGG + Intronic
949943607 3:9173179-9173201 CAGGGCAGGAAAGCTTCAGCAGG + Intronic
950110503 3:10415577-10415599 CATGACAGGTAGGCTGGACCAGG - Intronic
950138986 3:10602123-10602145 CAGGGCAGGAAGTGGGGAGGGGG - Intronic
950360398 3:12445578-12445600 GAGGGCAGGAGGGATGGAGGTGG - Intergenic
950448975 3:13055048-13055070 CAGGACAGGAAGGCCGGCGGTGG - Intronic
950649111 3:14396298-14396320 CAGGGCAGGCAGGAGGCAGCCGG + Intergenic
950682447 3:14594441-14594463 CAGGGAAGGAAGGCTGCCACTGG - Intergenic
950890522 3:16400305-16400327 CAGGGGAGGGAGGGTGGAGGTGG - Intronic
951498168 3:23353383-23353405 CAGGGCAGTTAGGCAGGAGAAGG + Intronic
953145625 3:40271797-40271819 GATGGCAGCAAGGCTGGGGCAGG + Intergenic
953692790 3:45133998-45134020 CAGGGCAGCAAGAAAGGAGCAGG - Intronic
953718543 3:45336017-45336039 CAGGGCAGGAGGGGAGGACCCGG + Intergenic
954298265 3:49686011-49686033 CCGGGCTGGAAGCCTGGAACCGG - Intronic
954384478 3:50237047-50237069 GAGGGCAGGAAGCAGGGAGCAGG - Intronic
955412882 3:58667273-58667295 CAGGACAGGAAAGATGGAGGAGG + Intergenic
955735353 3:62033088-62033110 CTGGGCTGGGAGGCAGGAGCCGG - Intronic
956243097 3:67151784-67151806 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
956254210 3:67266511-67266533 CAGGGCAGTTAGGCGGGAGAAGG - Intergenic
956716928 3:72087411-72087433 GATGGCAGACAGGCTGGAGCAGG + Intergenic
957080732 3:75633785-75633807 GAGGGCAGGAAGGCCAGGGCTGG - Intergenic
958829383 3:99068739-99068761 GAGGGCAGGAAGCCTCCAGCAGG - Intergenic
959487985 3:106950731-106950753 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
960259898 3:115555364-115555386 CTAGGCAGGAAGACTGGGGCAGG - Intergenic
960281337 3:115784321-115784343 CAGGGCAGGAGGGAGGGCGCAGG + Intergenic
960506372 3:118499795-118499817 CTGGGGAGGAAGGCTGGGGAAGG - Intergenic
961023026 3:123525638-123525660 CAGGGCAGAGGGGGTGGAGCAGG + Intronic
961067072 3:123884489-123884511 CAGTGCATGGGGGCTGGAGCGGG - Intergenic
961503517 3:127354967-127354989 CAGGGAAGGTAGCCTGGAGGAGG - Intergenic
961525772 3:127496478-127496500 CATGGCAGGGAGGCTGAGGCAGG + Intergenic
961638881 3:128352408-128352430 CAGTCCTGGAAGGCAGGAGCTGG - Intronic
961889941 3:130122322-130122344 CAGCTGAGGAAGGATGGAGCCGG + Intergenic
962007374 3:131361936-131361958 CAGGGCCCGCAGGCTGGAGCTGG + Intergenic
962807381 3:138937192-138937214 CAGGGCGGGAAGTCGGGAGCTGG - Intergenic
964358300 3:155870404-155870426 GAGGGCAGGAGGGGCGGAGCCGG + Intergenic
964464076 3:156970269-156970291 CAGGGCAATCAGGCTGGAGAAGG + Intronic
964620673 3:158717519-158717541 CAGGGCAGAAAGACTGGAGCTGG + Intronic
964680893 3:159337344-159337366 CAGGGCAGTCAGGCAGGAGAAGG + Intronic
965088693 3:164135048-164135070 CAGGGCAATAAGGCAGGAGAAGG + Intergenic
965992080 3:174831101-174831123 CAGGGCAGTTAGGCAGGAGAAGG - Intronic
966926052 3:184645324-184645346 CAGAGCAGGCAGGTTGGGGCAGG - Intronic
966949886 3:184806783-184806805 CAGGGCTGGGTGGCTGGTGCTGG + Intergenic
967104196 3:186242259-186242281 CAGGGCTGGAGGGCAGGAGGTGG - Intronic
967355738 3:188568880-188568902 CAGGGCCTGAAGGGTGGAGAGGG + Intronic
967361692 3:188638512-188638534 CAGGGCAGTTAGGCAGGAGAAGG + Intronic
967821850 3:193845997-193846019 CAGGGCAGCAAGGATGGTGGTGG - Intergenic
967840911 3:194003790-194003812 CAGGGCAGGGAGGCCGCAGTGGG + Intergenic
968458151 4:708842-708864 CAAGTCAGGAAAGTTGGAGCAGG + Intronic
968625319 4:1624264-1624286 CACGGCAGGCAGGGTGGGGCTGG + Intronic
968637024 4:1685687-1685709 GAGGGGAGAAGGGCTGGAGCAGG + Intergenic
968658326 4:1788058-1788080 CTTGGCAGGAAGGCTGGTGCTGG + Intergenic
968691065 4:1990454-1990476 GCGGGCAGGAAGGCTGAGGCCGG - Intronic
968733125 4:2281077-2281099 CAGGGCAGGGAGGCAGGAGAGGG - Intronic
968805109 4:2767174-2767196 TGGGGCAGGAAGGCTGAGGCTGG + Intergenic
968969972 4:3788644-3788666 CAGGGAAGGAGGCCTGCAGCGGG + Intergenic
969000421 4:3976300-3976322 CAGCTGAGGAAGGATGGAGCCGG + Intergenic
969053680 4:4388815-4388837 CTGGGGAGGGAGGCAGGAGCCGG + Intronic
969082165 4:4627229-4627251 CAGAGGAGAAAGGCTGCAGCAGG + Intergenic
969144925 4:5114249-5114271 AAGGGCAGGAGGGGTGGAACTGG - Intronic
969254915 4:5995129-5995151 CTGCACAGGAAGGGTGGAGCTGG - Intergenic
969275237 4:6130198-6130220 CAGGGGAAGAAGGAGGGAGCGGG + Intronic
969691638 4:8707144-8707166 CAGAGGAGAAAGCCTGGAGCGGG + Intergenic
969864879 4:10068673-10068695 CAGGGCAGGCTTCCTGGAGCAGG - Intergenic
970503164 4:16699363-16699385 CAGGGAATGAAGTCTGTAGCAGG - Intronic
971370624 4:26015983-26016005 AAGGGCAGGGAGTCTGCAGCAGG - Intergenic
972203812 4:36747605-36747627 CAGAGCAGGCAGGCAGGAGCTGG + Intergenic
972290400 4:37685970-37685992 CAGGGAGGGAAGGCGGGAGCGGG + Intronic
972686602 4:41359349-41359371 CGGGCCAGCAAGACTGGAGCTGG - Intergenic
972904022 4:43722605-43722627 CAGGGCAATAAGGCAGGAGAAGG - Intergenic
973832024 4:54771336-54771358 CAGGCCAGTAAGTCTGGAGGAGG + Intergenic
974758890 4:66249729-66249751 CAGGGCAGTCAGGCAGGAGAAGG + Intergenic
974954660 4:68622653-68622675 CACGGAAGGCAGGCTGAAGCTGG - Intronic
975499142 4:75065932-75065954 CATGTAAGGAATGCTGGAGCAGG - Intergenic
975819091 4:78251764-78251786 CAAGGCAGGAAGGGCTGAGCTGG + Intronic
976996642 4:91441618-91441640 CAGGGCAGTTAGGCAGGAGAAGG + Intronic
977045565 4:92064807-92064829 GAGGAGAGCAAGGCTGGAGCCGG - Intergenic
977390462 4:96402562-96402584 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
977404444 4:96577887-96577909 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
977479683 4:97559935-97559957 CAGTTGAGGAAGGCTGGAGAAGG - Intronic
977967304 4:103168095-103168117 GAGAGCAGGGAGGCTGCAGCAGG - Intronic
979432181 4:120645191-120645213 CAGGGCAGTTAGGCAGGAGAAGG - Intergenic
979440543 4:120745429-120745451 CAGGGCAGTTAGGCAGGAGAAGG + Intronic
979599775 4:122574889-122574911 CATGGCAGCAAGGCTGGGACAGG - Intergenic
979739108 4:124127806-124127828 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
979796969 4:124858007-124858029 GAGGGGAGGAAAGCTGGAGTGGG - Intergenic
981212450 4:142124103-142124125 CAGGGCAGTAAGGCTCGAATAGG - Intronic
981338177 4:143590231-143590253 CAGGGCAGTCAGGCAGGAGAAGG - Intronic
981676668 4:147350819-147350841 AAGGGCAGGAAGGCAGGAGGAGG + Intergenic
982237118 4:153261956-153261978 GAGGGAAGAAACGCTGGAGCTGG + Intronic
982274730 4:153627640-153627662 CCCGGCAGGAAGGCTGGGACAGG - Exonic
982289061 4:153761418-153761440 AAGGGCCGGAATGCTGGAGAAGG + Intergenic
982604451 4:157496558-157496580 CAGGGCAATAAGGCAGGAGAAGG + Intergenic
982676586 4:158382920-158382942 AAGATCAGTAAGGCTGGAGCAGG + Intronic
983651448 4:170040490-170040512 GAGGGCCGGAAGGCTGCAGGAGG + Intergenic
983683027 4:170374511-170374533 CAGGTCAGGAATGTGGGAGCTGG + Intergenic
983693162 4:170497293-170497315 GAGGGTAGGGAAGCTGGAGCGGG - Intergenic
984193145 4:176628146-176628168 CAGGTCAGGAAGGCTGCAGAGGG + Intergenic
984702328 4:182826170-182826192 CAGGGGAGGGAGGCCGGAGCAGG + Intergenic
984947627 4:184982471-184982493 CAGGGCAGGAGCTCTGGAGCAGG - Intergenic
985450178 4:190057424-190057446 GAGGGCAGGAAGGCCAGGGCTGG + Intergenic
985469693 5:32369-32391 CAGGGCAGGCAGGCTTAGGCTGG + Intergenic
985636258 5:1037278-1037300 AGGGGCAGGAGGGGTGGAGCTGG + Intronic
985926490 5:3023413-3023435 AGGGGCAGGAAGGCAGGAGGAGG + Intergenic
986042610 5:4008205-4008227 CAGGGCAGGAGGGCAGGCCCCGG + Intergenic
986044344 5:4022918-4022940 CAAGGTAGGAAGGCTGGTGAGGG + Intergenic
986349875 5:6867419-6867441 CAGGGCATGAATACAGGAGCAGG + Intergenic
987482458 5:18475824-18475846 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
987708687 5:21483999-21484021 CAGGGCAGGGATGCCTGAGCAGG - Intergenic
988750922 5:34190146-34190168 CAGGGCAGGGATGCCTGAGCAGG + Intergenic
990356280 5:54969371-54969393 CAGGGCAGCATGGGTGGTGCAGG - Intergenic
990691904 5:58373574-58373596 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
991815518 5:70508186-70508208 CAGGGCAGGGATGCCTGAGCAGG + Intergenic
992576852 5:78122344-78122366 CAGGGCAGTTAGGCAGGAGAAGG + Intronic
992837486 5:80654926-80654948 TGGGGCGGGAAGGCGGGAGCTGG - Exonic
992855928 5:80861748-80861770 CAGGGTAGGAAAACTGGAACTGG - Intronic
993082428 5:83318352-83318374 CAGGGCAATAAGGCAGGAGAAGG + Intronic
993351508 5:86855731-86855753 CAGGGCAGGCAGGCTGCAGATGG - Intergenic
993818463 5:92583294-92583316 CAGGGCAGTCAGGCAGGAGAAGG + Intergenic
994235900 5:97361698-97361720 CAGGGGTGGAAGGCTGGGGGAGG + Intergenic
994662975 5:102675236-102675258 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
995363708 5:111329375-111329397 CAGGGCAATCAGGCTGGAGAAGG + Intronic
995569824 5:113468175-113468197 CAGGGCAGTCAGGCAGGAGAAGG - Intronic
995644193 5:114293185-114293207 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
996550133 5:124721828-124721850 CTCGGAAGGAAGGCTGTAGCAGG + Intronic
997232481 5:132254757-132254779 CAGGGCTGGCAGGCTCCAGCAGG - Intronic
997408654 5:133673016-133673038 AAAGGCAGGAAGGCTGGAGGTGG + Intergenic
997444684 5:133932666-133932688 CAGAGGAAGAAGGCTGGAGCTGG - Intergenic
997590829 5:135071197-135071219 CAGGGAAGGAAAGCTGGGCCTGG - Intronic
997691529 5:135830714-135830736 CAGTGCAGGAATGATGCAGCTGG + Intergenic
998011593 5:138699695-138699717 GAGGGCAGTGTGGCTGGAGCTGG + Intronic
998399568 5:141841583-141841605 CAGGGCAGCAGGGCAGGGGCAGG - Intergenic
998529485 5:142871656-142871678 GTGGGCAGGAAGGCAGGAGGAGG - Intronic
998877859 5:146618653-146618675 CAGGGAAGGCAGGCCAGAGCGGG + Intronic
999204643 5:149839421-149839443 CAGGCAAGGAAGGCTGCAGGTGG + Intronic
999349816 5:150858920-150858942 CAGGGCAGTCAGGCAGGAGAAGG - Intronic
999382654 5:151132306-151132328 CAGGGCAGCATGGCTGAGGCTGG - Intronic
999485675 5:151993034-151993056 CAGGGCAGTCAGGCAGGAGAAGG + Intergenic
999629897 5:153560135-153560157 CAGGGCAGGAAGTCAGGAGTTGG - Intronic
1000406333 5:160892283-160892305 CAAGTCAGCATGGCTGGAGCAGG - Intergenic
1001042492 5:168346960-168346982 CAGGGCAGGAAGAGCTGAGCAGG + Intronic
1001276187 5:170353519-170353541 CAGAGCAGGGAGGGAGGAGCTGG - Intronic
1001329544 5:170752555-170752577 CAGGGCAGCACTGCTGCAGCGGG - Intergenic
1001563585 5:172685746-172685768 TTGGGAAGGAAGCCTGGAGCTGG - Intronic
1001632680 5:173187593-173187615 CAGAGCAGGCAGCCCGGAGCTGG - Intergenic
1001683747 5:173577353-173577375 CAGGGCAGGAAGAATGGACTTGG - Intergenic
1001803066 5:174560043-174560065 CCGGGGAGGAACTCTGGAGCGGG - Intergenic
1001806511 5:174591355-174591377 AAGGAGAGGAAGGCAGGAGCAGG - Intergenic
1001990700 5:176113547-176113569 GTGGGCAGGAGGGCTGGAGAGGG - Intronic
1002050011 5:176565372-176565394 GAGGGCAGGAAGGAGGAAGCAGG - Exonic
1002071671 5:176682195-176682217 CAGGACAAGAAGGCTGGGGCAGG - Intergenic
1002226173 5:177724593-177724615 GTGGGCAGGAGGGCTGGAGAGGG + Intronic
1002267677 5:178046620-178046642 GTGGGCAGGAGGGCTGGAGAGGG - Intronic
1002879923 6:1242273-1242295 CATGGCAGAAAGGGTGGAGAGGG + Intergenic
1002884971 6:1285557-1285579 CAGCGGAGGCAGTCTGGAGCAGG - Intergenic
1002903616 6:1430599-1430621 CAGGGCAATTAGGCTGGAGAAGG - Intergenic
1003016755 6:2474121-2474143 AAGGGCAGGCAGGGAGGAGCTGG + Intergenic
1003431200 6:6039498-6039520 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
1003516189 6:6820960-6820982 TTGGTCAGGAGGGCTGGAGCAGG + Intergenic
1003891314 6:10566088-10566110 CAGGGCAGGAAGGCTGGGAGTGG - Intronic
1004423158 6:15489304-15489326 CAGGGCAGAAAGGCAAGATCTGG - Intronic
1005009376 6:21321592-21321614 CAGGGGAGGAGGGCAGGAGAGGG - Intergenic
1005173219 6:23012251-23012273 CAGGGCAGGAAGCATCCAGCAGG - Intergenic
1005240055 6:23814303-23814325 CAGGGCAGTCAGGCAGGAGGAGG - Intergenic
1005594681 6:27368081-27368103 CATGGGAAGGAGGCTGGAGCCGG + Intergenic
1005781896 6:29201400-29201422 CAAGGGAGGGAGGCTGGAGGGGG + Intergenic
1005885168 6:30092058-30092080 CAGGGCAGGCAGGACAGAGCTGG - Intergenic
1006361178 6:33588256-33588278 CAGGGCAGGCTGGCTGGGGAGGG - Intergenic
1006377581 6:33680149-33680171 CTGGGCAAGACGGCTGGAGATGG + Intronic
1006591389 6:35160621-35160643 CAAGGGAGGAAGGCAGGAGAGGG - Intergenic
1006634423 6:35452145-35452167 CGGGCCAGGGAGCCTGGAGCGGG - Intergenic
1007099998 6:39239635-39239657 CAGGGGAGGCAGGCTGGGGGAGG - Intergenic
1007207884 6:40167366-40167388 CATGGCAGGAGTACTGGAGCTGG + Intergenic
1008350280 6:50481642-50481664 CAGGGCAGTCAGGCAGGAGAAGG + Intergenic
1009019812 6:57937885-57937907 CAGGGCAGGGATGCCTGAGCAGG + Intergenic
1009191179 6:60631781-60631803 CAGGGCAACCAGGCAGGAGCAGG - Intergenic
1009328505 6:62384435-62384457 CAGGGCAATTAGGCTGGAGAAGG - Intergenic
1009752746 6:67893466-67893488 CAGGGCAAGTAGGCAGGAGAAGG + Intergenic
1009874152 6:69484336-69484358 CAGGGCAGTCAGGCAGGAGAAGG + Intergenic
1010312275 6:74401310-74401332 CAGGGCAGTCAGGCAGGAGAAGG + Intergenic
1010379074 6:75205971-75205993 CGCGGCAGGAAGACTGGAGATGG + Exonic
1010513631 6:76747645-76747667 CAGGGCAATAAGGCAGGAGAAGG - Intergenic
1010530583 6:76962981-76963003 CAGGGCAATAAGGCAGGAGAAGG + Intergenic
1010753423 6:79640138-79640160 TAGGGCAGGAGGGGAGGAGCTGG + Intronic
1010772371 6:79846011-79846033 AAGGGAAGGAAGGATGGATCTGG + Intergenic
1011015171 6:82746453-82746475 TAGGGCAAGAAGACTGGAGCAGG - Intergenic
1011597433 6:89029587-89029609 AGGGGCAGGAGGGCTGGAGCAGG - Intergenic
1012422873 6:99084136-99084158 AAGGGGAGGAAGCCTGCAGCGGG + Intergenic
1013608424 6:111772397-111772419 GATGAAAGGAAGGCTGGAGCAGG + Intronic
1013861034 6:114635667-114635689 CATCCCAGGAAGGATGGAGCAGG - Intergenic
1013969767 6:116002826-116002848 CAGGGCAGATGGGTTGGAGCTGG - Intronic
1014650111 6:124025880-124025902 CAGGGGAGAAAGGCAGGAGAAGG - Intronic
1015186778 6:130426229-130426251 CAAGGCCTTAAGGCTGGAGCTGG - Intronic
1015942308 6:138464401-138464423 CAGGGCAGGAAGGCCGAGGATGG + Intronic
1017060005 6:150474217-150474239 CAGGGCAAGTAGGCAGGAGAAGG + Intergenic
1017881895 6:158567864-158567886 GGTGGCAGGAAGGCTGGAGAGGG + Intronic
1018315636 6:162553935-162553957 CATGGCAGGAGGGCTGGGGAAGG + Intronic
1018427466 6:163696306-163696328 CATTGCAAGCAGGCTGGAGCGGG + Intergenic
1018804595 6:167248964-167248986 CAGGGCAGGCAGGGTGGTGCAGG + Intergenic
1018810391 6:167294382-167294404 CAGGGCAGCAAGCCTGTGGCTGG + Intronic
1018838274 6:167501204-167501226 CAGGGCAGGAGGGCTGTGGCCGG - Intergenic
1018926791 6:168212447-168212469 CAGGGCCGGAAGGCGTGAGAGGG + Intergenic
1018946959 6:168354503-168354525 CAGGGGAGGGAGGCTGCATCAGG - Intergenic
1018994858 6:168702960-168702982 CAGGGGAGCAAGGCTAGGGCTGG - Intergenic
1019046957 6:169156714-169156736 TGAGGCAGGCAGGCTGGAGCAGG - Intergenic
1019225761 6:170506677-170506699 GAGGGCGGAAAGGCTGGAACAGG + Intergenic
1019420793 7:949802-949824 CAGGGCAGGCAGGCAGGAAGCGG + Intronic
1019619185 7:1981393-1981415 CTGGTCAGGCAGGCTGGCGCAGG + Intronic
1019924193 7:4181573-4181595 CTGGAAAGGAGGGCTGGAGCAGG - Intronic
1020000552 7:4753364-4753386 AAGGGCAGCAAGGCGGGAGGAGG + Intronic
1020084192 7:5301799-5301821 CAAGGCAAGAAGGCTGGCACTGG + Intronic
1020106129 7:5423193-5423215 CGGGCCAGGAGGGCCGGAGCGGG + Intronic
1020108186 7:5432434-5432456 CAGGTGAGGAAGGCAGGGGCAGG - Intronic
1020112661 7:5456258-5456280 CAGGGCAGGCTGACTGGTGCAGG - Intronic
1020400689 7:7773852-7773874 CAGGGCTGCAAGGCTGGAAATGG - Intronic
1020466118 7:8481819-8481841 CAGGGGAGGAAGGAGGGAGTGGG - Intronic
1020751077 7:12143089-12143111 CAGGGCAATCAGGCTGGAGAAGG + Intergenic
1020949655 7:14659726-14659748 CAGGGCAGTTAGGCAGGAGAAGG - Intronic
1021440734 7:20671465-20671487 CAGGGGAGGAGGGCTGGAGAGGG - Intronic
1021651432 7:22837368-22837390 CCGGGGAGGAAGTCGGGAGCAGG + Intergenic
1021750833 7:23797761-23797783 CAGGGCAGAACTGCAGGAGCTGG + Intronic
1022265209 7:28746908-28746930 TAGGGCAGGAAGGCTGATGAAGG + Intronic
1022449983 7:30505260-30505282 TAGGCCAGGAAGGCAGGACCCGG - Intronic
1023009702 7:35915642-35915664 CAGGACAGGAAGCCAGGACCTGG - Intergenic
1023045999 7:36210652-36210674 GAAGGCAGGACAGCTGGAGCTGG - Intronic
1023252225 7:38277153-38277175 CAGGGGACTTAGGCTGGAGCAGG - Intergenic
1023889018 7:44379764-44379786 CAGGGAAGACAGGCTGGACCTGG + Exonic
1024081130 7:45855939-45855961 CAGGACAGGAAGCCAGGACCTGG + Intergenic
1024359544 7:48454497-48454519 CAGAGCAGGGAAGCGGGAGCAGG + Intronic
1024763346 7:52627711-52627733 AAGGACAAGAAGTCTGGAGCTGG + Intergenic
1025003196 7:55335453-55335475 CAGTGCAGGAAGGCTAGGGAAGG - Intergenic
1025035677 7:55591339-55591361 CAGGGCAGGGAGGCAGCAGTGGG - Intergenic
1025094586 7:56087456-56087478 CAGAGCAGTGAGGGTGGAGCTGG + Intronic
1025121779 7:56310550-56310572 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
1025123366 7:56325831-56325853 CAGGACAGGAAGCCAGGACCTGG - Intergenic
1025210095 7:57015397-57015419 CAAGGCAAGAAGGCTGGCACTGG - Intergenic
1025651027 7:63469248-63469270 CAGGGCAGTTAGGCAGGAGAAGG - Intergenic
1025661856 7:63561454-63561476 CAAGGCAAGAAGGCTGGCACTGG + Intergenic
1026204438 7:68244473-68244495 CAGGACAGGAAGCCAGGACCTGG - Intergenic
1026660368 7:72295857-72295879 CAGGGCAGTTAGGCAGGAGAAGG - Intronic
1026819450 7:73537155-73537177 CCGGGCTGGAAGGCTGGCGTAGG - Exonic
1026905774 7:74061974-74061996 CAGGACAGGAAGGCGGGCGGGGG - Intronic
1027163029 7:75815972-75815994 CAGAGCAGGGAGGTTGGAGAAGG - Intronic
1027897733 7:84066418-84066440 CAGGGCAGTTAGGCAGGAGAAGG + Intronic
1028071711 7:86459028-86459050 CAGGGCAAGTAGGCAGGAGAAGG - Intergenic
1028121431 7:87059747-87059769 CGGGGCGGGGACGCTGGAGCTGG + Intergenic
1028287241 7:89017330-89017352 CAGGGCAGTAAGGCAGGAGAAGG - Intronic
1029202513 7:98848486-98848508 CAGGCCAGGATGCCTGGAGGGGG - Intronic
1029254063 7:99257175-99257197 CAGGGCATGGACGCTGGAGTTGG - Intergenic
1029337735 7:99916657-99916679 CAGGGCAGGGATGATGGAGAGGG - Intronic
1029580449 7:101433645-101433667 AAGGGGAGAAAGGCTGGGGCAGG + Intronic
1029903612 7:104068308-104068330 CAGGGTAGGAAGAATGGAGAGGG + Intergenic
1030365536 7:108641588-108641610 CAGGGAAGGAAGGAAGGAGAGGG - Intergenic
1030494862 7:110286121-110286143 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
1030588684 7:111451990-111452012 AAGGGCAGTAAGGCTGGGGAAGG + Intronic
1031068590 7:117136154-117136176 CAGGCCCTGAAGGCTGGAGATGG + Exonic
1031558632 7:123209626-123209648 AAGGGAAGGAAGGGTGGAACAGG + Intergenic
1031923172 7:127615773-127615795 CAGGGCAGGAAGGGAGGGACTGG + Intronic
1031979754 7:128116882-128116904 CAGGACAGGAGGGCAGCAGCAGG + Intergenic
1032695131 7:134329240-134329262 CAGGGCAGAGACGCTGGGGCAGG - Intergenic
1032803913 7:135337688-135337710 CATGGAAGGAAGGCTGGTCCTGG - Intergenic
1032884705 7:136124914-136124936 CAAGGCAAGGGGGCTGGAGCAGG - Intergenic
1033224336 7:139548691-139548713 CATCCCAGGGAGGCTGGAGCTGG - Intergenic
1033426888 7:141252881-141252903 CAGGGCAAGGAGAATGGAGCTGG - Intronic
1033662177 7:143409505-143409527 CAGGGCAGAAAGGCAGGTGTGGG + Intergenic
1034202410 7:149290743-149290765 AAGGACAGGAACCCTGGAGCTGG + Intronic
1034214722 7:149396503-149396525 GAGGGCATGATGGCTGGAGAAGG + Intergenic
1034317996 7:150152133-150152155 CAGGGCAGTTAGGCAGGAGAAGG - Intergenic
1034584207 7:152074856-152074878 TATGACAGGAAGGCTGGAGGGGG + Intronic
1034711634 7:153197280-153197302 TAGGGCAGGAAGGCAGGAGATGG + Intergenic
1035160475 7:156946490-156946512 CTGGGCAGGATGGCTGAAGTGGG + Intergenic
1035220979 7:157406490-157406512 CTTGGGAGGAAGGCTGGGGCTGG - Intronic
1035300776 7:157896073-157896095 CAGGGGAGGACGGGAGGAGCTGG + Intronic
1035526564 8:317534-317556 CAGGGCACTGAGGCTGGAGTTGG + Intergenic
1035635363 8:1139971-1139993 GAGGGCAGCAAGGCTGGCTCAGG - Intergenic
1035680435 8:1483660-1483682 CAGAGCAGGGAGGCAGGTGCAGG + Intergenic
1036376814 8:8207697-8207719 CAGCTGAGGAAGGATGGAGCCGG - Intergenic
1036852723 8:12215440-12215462 CAGCTGAGGAAGGATGGAGCCGG + Intergenic
1036874094 8:12457962-12457984 CAGCTGAGGAAGGATGGAGCCGG + Intergenic
1037748922 8:21667406-21667428 CAGGGCAGGAAGGCCTGAACAGG - Intergenic
1037898852 8:22675922-22675944 CAGGGCTGGAGGGTTGCAGCCGG - Intergenic
1038324571 8:26562902-26562924 CATGGCAGGAAGGCTGGGCTTGG + Intronic
1038402353 8:27294278-27294300 CATGGCTGGAAGGCCGGATCCGG - Exonic
1039423400 8:37464383-37464405 CAGGGCAATAAGGCAGGAGAAGG + Intergenic
1039614801 8:38946805-38946827 AAGGGTAGGAAGGATGGAGAGGG + Intronic
1039694165 8:39892698-39892720 CAAGGAAGGAAGGGAGGAGCAGG + Intergenic
1040428446 8:47313058-47313080 CAGGGCAGTCAGGCAGGAGAAGG + Intronic
1040458656 8:47625384-47625406 CAGGGCAGTCAGGCAGGAGAAGG + Intronic
1041101289 8:54398656-54398678 GAGGGATGTAAGGCTGGAGCAGG - Intergenic
1042150586 8:65778901-65778923 CAAGGCTGGAAGGTTGGTGCTGG - Intronic
1042222046 8:66483635-66483657 AAGGGCAGCAAGGCTGAAGCAGG - Intronic
1042713297 8:71743504-71743526 CAGGGCAATTAGGCTGGAGAAGG - Intergenic
1042987817 8:74603689-74603711 GAGAGCTGGAAGGCTTGAGCTGG + Intronic
1043296184 8:78666183-78666205 GAGGGCAGGACGGCTAGAGCGGG + Intronic
1043424525 8:80135413-80135435 GGGGGCAGGTAGGCTGGGGCAGG - Intronic
1043512666 8:80965074-80965096 AAGGGCAGGAATGGTGGAGAAGG + Intergenic
1044294074 8:90506789-90506811 CAGGGCAGGAAGCATTCAGCCGG - Intergenic
1044351190 8:91168363-91168385 CAGGAGAGGAGGGCTGGAGATGG - Intronic
1044514337 8:93120960-93120982 AAGTGCAGAAAGGCTGTAGCTGG - Intergenic
1044557451 8:93579100-93579122 CAAGGCAGGAAGGTGAGAGCAGG + Intergenic
1045843621 8:106607526-106607548 CAGTGAAGGAAGGCAGGAGATGG - Intronic
1046122416 8:109862763-109862785 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
1048092322 8:131254471-131254493 CAGGGCAATTAGGCAGGAGCAGG + Intergenic
1048093643 8:131267344-131267366 CAGGGCAATTAGGCAGGAGCAGG + Intergenic
1048235110 8:132682327-132682349 AAGGGCTGAAAGGCTGGGGCTGG - Intergenic
1048424394 8:134309504-134309526 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
1048589063 8:135804135-135804157 CAGGGCAAGTAGCCTGGGGCTGG + Intergenic
1048881646 8:138876996-138877018 CAGGACAGGAAGGATGAAGTGGG - Intronic
1049081540 8:140446975-140446997 AAGGCAAGGAATGCTGGAGCTGG - Intronic
1049156485 8:141070174-141070196 CAGAGCAGGAAGTCAGGAGCTGG + Intergenic
1049193319 8:141301109-141301131 CGGGGCAGGCAGGCTGGAGGTGG - Intronic
1049238593 8:141525239-141525261 CAGGACGGCAAGGCTGGGGCCGG + Intergenic
1049298173 8:141854913-141854935 CAGGGAAGGAGGGAAGGAGCAGG + Intergenic
1049306538 8:141907099-141907121 CAGGGCTGGAGGGGAGGAGCTGG - Intergenic
1049448118 8:142641025-142641047 CAGGGCAGGAAGGCCTGGCCAGG - Intergenic
1049595333 8:143480828-143480850 CATGGCAGGAAGGCTGGGGAAGG + Intronic
1049625409 8:143617556-143617578 CGGGGCCGGGAGGCTGGGGCGGG + Exonic
1049659082 8:143811704-143811726 CTGAGCAGGCAGGCTGGAACTGG - Intronic
1049744352 8:144256910-144256932 CAGGGCTCGAGGCCTGGAGCAGG + Intronic
1049750726 8:144282420-144282442 CAAGGCAGGGAGGCTGGAGATGG + Intronic
1049758841 8:144322775-144322797 CAGGGCGCTCAGGCTGGAGCTGG - Intronic
1050322820 9:4470751-4470773 CAGGGCAATAAGGCAGGAGAAGG + Intergenic
1050329908 9:4535205-4535227 CAGGGCAATCAGGCTGGAGAAGG + Intronic
1050381552 9:5035878-5035900 CAGGGCAGTCAGGCTGGAGAAGG + Intronic
1051693715 9:19745150-19745172 CAGAGCAAGAGGGGTGGAGCAGG - Intronic
1051714011 9:19962852-19962874 CAGGGCAGTTAGGCAGGAGAAGG - Intergenic
1051716543 9:19990747-19990769 CTGGGCAGGATGGATGGAGAGGG - Intergenic
1052448041 9:28589298-28589320 CAGGGCAGTCAGGCAGGAGAAGG + Intronic
1052917156 9:33932132-33932154 CCAGGCAGGAGGGCTGGAGTCGG - Intronic
1053150880 9:35741896-35741918 GAGGGCAGATAGGCTGGAACGGG + Intronic
1053684058 9:40505327-40505349 GAAGGCAGGAAGGAAGGAGCAGG + Intergenic
1053934032 9:43133612-43133634 GAAGGCAGGAAGGAAGGAGCAGG + Intergenic
1054279663 9:63119626-63119648 GAAGGCAGGAAGGAAGGAGCAGG - Intergenic
1054297153 9:63340791-63340813 GAAGGCAGGAAGGAAGGAGCAGG + Intergenic
1054395173 9:64645299-64645321 GAAGGCAGGAAGGAAGGAGCAGG + Intergenic
1054429820 9:65150499-65150521 GAAGGCAGGAAGGAAGGAGCAGG + Intergenic
1054500563 9:65871033-65871055 GAAGGCAGGAAGGAAGGAGCAGG - Intergenic
1054741127 9:68806683-68806705 CAGAGCAGGAGGGAAGGAGCAGG - Intronic
1055442133 9:76346927-76346949 CATGGAAGGAGGGGTGGAGCAGG + Intronic
1056416257 9:86379461-86379483 CAGGGCAGTTAGGCAGGAGAAGG - Intergenic
1056792822 9:89637282-89637304 CAGGGAAGGAAGCCCGCAGCCGG - Intergenic
1057131749 9:92658816-92658838 CAGGGCAGGGAGGCCAGGGCTGG + Intronic
1057288103 9:93777061-93777083 CGGGGCAGGAAGGCAGGTGTAGG + Intergenic
1057337537 9:94166935-94166957 CAGGGCGGGAAGGCGCGGGCGGG + Intergenic
1058916020 9:109566481-109566503 AAGGGGAGGAAGGCAGGAGAAGG - Intergenic
1058975507 9:110122276-110122298 CAGTGCTGGGAGGCTGAAGCGGG - Intronic
1058975873 9:110125290-110125312 CTGAGCAGGGAGGCAGGAGCTGG - Intronic
1059811365 9:117858974-117858996 TAGGGCAGGGATGCTGAAGCAGG + Intergenic
1059818923 9:117950228-117950250 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
1060042028 9:120308226-120308248 CTGGGTATGACGGCTGGAGCAGG + Intergenic
1060289051 9:122283436-122283458 CAGGCCAAGAAGGCTGAAGGGGG + Intronic
1060374740 9:123107936-123107958 AAGAACAGGAACGCTGGAGCAGG + Intergenic
1060670784 9:125467583-125467605 CAGGGAAGGAAGGCAGGTCCAGG + Intronic
1060977002 9:127770754-127770776 CAGGGGAAGAAGGCTTGGGCTGG + Intronic
1061012611 9:127964338-127964360 CTGGGCAGTAATGCTGGATCAGG - Intronic
1061360050 9:130135668-130135690 GAGGGCAGGAATCCTGGGGCAGG - Exonic
1061381738 9:130262921-130262943 CAGGGAAGAGAGGCTTGAGCAGG - Intergenic
1061434025 9:130549324-130549346 CAGAGCATGAAGGATGGTGCAGG - Intergenic
1061485802 9:130919965-130919987 CAGGGCAGGGAGGCTGGGTGGGG + Intronic
1061819376 9:133217647-133217669 CAAGGCAGGTGGGCTGGGGCTGG - Intergenic
1061893990 9:133637442-133637464 GTGGAAAGGAAGGCTGGAGCAGG - Intronic
1061920618 9:133780402-133780424 GGGGGCAGGAGGGCTGGTGCAGG + Intronic
1061958087 9:133973981-133974003 CAGGCCAGGAAGGTGGGGGCTGG + Intronic
1062241309 9:135540542-135540564 CAAGGCAGGTGGGCTGGGGCTGG + Intergenic
1062453483 9:136625158-136625180 CTGGGCAGGAAGGCGGGAACGGG + Intergenic
1062523529 9:136969339-136969361 CAGGGCAGGGAGGCTCCAGGCGG + Exonic
1062595899 9:137299080-137299102 CAGAGCAGGATGGCTGTTGCTGG - Intergenic
1185642581 X:1596832-1596854 CACGGCAGGAGGGATGGAGGAGG - Intronic
1186041541 X:5484453-5484475 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
1186502978 X:10066710-10066732 CCGGGGAGAGAGGCTGGAGCTGG + Intronic
1186526293 X:10251711-10251733 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
1186531995 X:10306312-10306334 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
1186799472 X:13078765-13078787 GAGGGCATGGAGGCTGGAGATGG + Intergenic
1187186913 X:16995784-16995806 CAGGGCACTAAAGCTGGAGAAGG + Intronic
1187257704 X:17656901-17656923 CAGGGCAGGAAAACAGGAGAGGG - Intronic
1187302487 X:18064588-18064610 CAGGGCATGAAGAGTGGAGGAGG - Intergenic
1187500019 X:19832130-19832152 TAGGGCAGAAAGGATGTAGCAGG - Intronic
1187537797 X:20159341-20159363 CAGAGCAAGAAGACTAGAGCTGG - Intronic
1187778706 X:22793222-22793244 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
1188037222 X:25332185-25332207 CAGGGCAAGTAGGCAGGAGAAGG + Intergenic
1188303189 X:28530454-28530476 GATGGCAGTAATGCTGGAGCTGG - Intergenic
1188505989 X:30885582-30885604 CTGGGAAAGAAGGATGGAGCGGG + Intronic
1188935641 X:36172292-36172314 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
1188940440 X:36231606-36231628 CAGGGCAGTCAGGCAGGAGAAGG - Intronic
1189194810 X:39143924-39143946 TAGGGGTGGAAGGCTGGAGTGGG - Intergenic
1190298862 X:49044242-49044264 CAGGCCAGGAAAGCTGAGGCTGG - Intergenic
1190400850 X:50033165-50033187 CAGGGCAGTTAGGCAGGAGAAGG + Intronic
1190427192 X:50345005-50345027 GAGGAGAGGAAGGCAGGAGCTGG - Intronic
1190477219 X:50840128-50840150 CTGGGCAGGAAGGCTGGGGAGGG - Intergenic
1190480242 X:50870217-50870239 CTTGGCAGGAAGGCTGGTGAGGG + Intergenic
1190708834 X:53050877-53050899 CAGGGAAAGAAGACTGGAGTGGG - Intronic
1190746847 X:53328933-53328955 CAGGTCAAGACTGCTGGAGCTGG + Intergenic
1190789646 X:53686683-53686705 GAGGGGAGCAGGGCTGGAGCAGG - Intronic
1190918810 X:54830438-54830460 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
1191002015 X:55670320-55670342 CAGGGCAGTTAGGCAGGAGAAGG - Intergenic
1191060904 X:56295100-56295122 CAGGGCAGTAAGGCAGGAGAAGG + Intergenic
1191187954 X:57633402-57633424 CAGGGCAATCAGGCTGGAGAAGG + Intergenic
1191196327 X:57727471-57727493 CAGGGCAATAAGGCAGGAGAAGG - Intergenic
1192240636 X:69324989-69325011 CAGGGGTGGGAGGCTGGGGCTGG - Intergenic
1192985374 X:76393562-76393584 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
1192987796 X:76418888-76418910 CAGGGCAGTCAGGCAGGAGAAGG + Intergenic
1193452513 X:81688070-81688092 CAGGGCAATAAGGCAGGAGAAGG + Intergenic
1193454334 X:81711847-81711869 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
1194944858 X:100054909-100054931 CAGGGCAAGCAGGCAGGAGAAGG + Intergenic
1195267220 X:103194167-103194189 CAGGGCAGGCAGGGTGGGCCAGG + Intergenic
1195617313 X:106922505-106922527 CATCCCAGGAAGGCTGAAGCAGG + Intronic
1196474395 X:116065882-116065904 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
1197708755 X:129651939-129651961 CAGGGCAGCAAAGCTGGCACTGG - Intronic
1198254580 X:134914358-134914380 AAGGGCAGGAGGGCTGGAGAGGG + Intronic
1198427154 X:136531695-136531717 CAGGGCAGGAGGTTTGGAGGAGG - Intergenic
1198934618 X:141893694-141893716 CAGGGCAGGAGGGCAGGAATTGG + Intronic
1199468718 X:148169821-148169843 CAGGGCAGTCAGGCAGGAGAAGG + Intergenic
1199601436 X:149543676-149543698 TGGGGCAGGAACGCTGTAGCTGG + Intronic
1199616437 X:149659655-149659677 CAGGGCAGTACAGCTGGACCTGG - Intergenic
1199626204 X:149743593-149743615 CAGGGCAGTACAGCTGGACCTGG + Intergenic
1200037734 X:153344320-153344342 GAGGGTAGGAAGGCAGCAGCTGG - Intronic
1200129531 X:153833448-153833470 CACAGCAGTCAGGCTGGAGCGGG + Intergenic
1200234334 X:154460967-154460989 CAGGCCAGAAAGGCTGCAGAGGG - Intronic
1200237533 X:154475489-154475511 CACAGCTGGACGGCTGGAGCTGG - Intergenic
1200259292 X:154603687-154603709 CATGGCTGGATGGCTAGAGCTGG - Intergenic
1200271558 X:154689413-154689435 CAGGGCAGTTAGGCAGGAGAAGG + Intronic
1200684643 Y:6247436-6247458 GAGGCCAGGAAGACTGGGGCTGG + Intronic
1200992834 Y:9359016-9359038 GAGGCCAGGAAGACTGGGGCTGG + Intronic
1200998153 Y:9399640-9399662 GAGGCCAGGAAGACTGGGGCTGG + Intronic
1201144865 Y:11058795-11058817 CATGGCAGGAGGCCTGGAGTGGG + Intergenic
1201363666 Y:13181081-13181103 CAGGGCAATAAGGCAGGAGAAGG - Intergenic
1201476489 Y:14387901-14387923 CAGGGCAGTTAGGCAGGAGAAGG - Intergenic
1201787946 Y:17806301-17806323 CAGGGCAGTTAGGCAGGAGAAGG - Intergenic
1201813607 Y:18099687-18099709 CAGGGCAGTTAGGCAGGAGAAGG + Intergenic
1201975036 Y:19839805-19839827 GATGGCAGGAAGGCTGGGGGAGG - Intergenic
1202241506 Y:22775281-22775303 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
1202394490 Y:24409024-24409046 CAGGGCAGTCAGGCAGGAGAAGG - Intergenic
1202476294 Y:25261068-25261090 CAGGGCAGTCAGGCAGGAGAAGG + Intergenic