ID: 932417242

View in Genome Browser
Species Human (GRCh38)
Location 2:71580772-71580794
Sequence CCCAAATTGTCCCCTACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932417242_932417245 -6 Left 932417242 2:71580772-71580794 CCCTCAGTAGGGGACAATTTGGG 0: 1
1: 0
2: 0
3: 5
4: 95
Right 932417245 2:71580789-71580811 TTTGGGTAACTCTAAATGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932417242 Original CRISPR CCCAAATTGTCCCCTACTGA GGG (reversed) Intronic
900929526 1:5727632-5727654 CCCAAACTGTCTCCTCCTGCAGG + Intergenic
905042837 1:34974464-34974486 CTCAATTGGTCCCCTACTGATGG - Intergenic
906849116 1:49228866-49228888 GCAAAATTGTCTCCTCCTGAAGG + Intronic
914360443 1:146931414-146931436 CCCAAATTGTGCCCTGCTGTGGG + Intergenic
914493304 1:148168484-148168506 CCCAGATTGTGCCCTGCTGTGGG - Intergenic
920736045 1:208533856-208533878 CCCCAATTTCCCCCTAGTGAAGG - Intergenic
920823744 1:209404901-209404923 CCCCAATAATCCCCTACTTAGGG - Intergenic
922196805 1:223365467-223365489 CCCAAAATCTCACATACTGATGG + Intergenic
922317324 1:224454155-224454177 CCCAAAATGTCCCTTACTCATGG + Intronic
1063511912 10:6653981-6654003 CCCAAATTTTCCCTTGCTGTGGG + Intergenic
1072639224 10:97198805-97198827 CCCAAAATGTCCCCTTGTGCCGG - Intronic
1073447791 10:103591600-103591622 CCCAATTTGGCCCCTCCTTATGG - Exonic
1075700291 10:124464934-124464956 CCCTAATACTCCCCTACTGATGG - Intronic
1075700460 10:124466134-124466156 CCCTAAAACTCCCCTACTGATGG - Intronic
1078082256 11:8212558-8212580 CCCTAAATGTCCACTACAGAGGG + Intergenic
1078595314 11:12681548-12681570 ACTAAAATCTCCCCTACTGATGG + Intronic
1079527345 11:21406356-21406378 ACCAAATTATCCCCAATTGAGGG + Intronic
1084543526 11:69801799-69801821 CCCAAATTGTCCCCAAGGGTGGG + Intergenic
1090206238 11:124885886-124885908 CCCAAATTGTCCAGTTCTAAAGG - Intronic
1092958196 12:13569785-13569807 GCCCATTTGTCCTCTACTGATGG - Intronic
1097866021 12:64559744-64559766 CCAAAATTGTCCTCTAGTCAAGG + Intergenic
1100279091 12:93101076-93101098 CCCAAATTGTCCTCATCTCAAGG - Intergenic
1102675877 12:114658446-114658468 CACAAAATGTCCCCTCCTCAGGG - Intergenic
1103310349 12:120001746-120001768 CCCAAATTGTACCCTTTTAAAGG - Intronic
1104578484 12:129990629-129990651 CCCCAATTCTCCTCTAGTGAAGG + Intergenic
1107789168 13:43983468-43983490 CCCAAATGGTACCCTGCTCATGG - Intergenic
1108521497 13:51250813-51250835 CCCACAGTGTCCCCTATTGTGGG - Intronic
1110077818 13:71271535-71271557 CCCAGATTGTCCCAAACTGCTGG - Intergenic
1114340632 14:21739312-21739334 CCCAACATCTCCCCTTCTGAGGG - Intergenic
1114514150 14:23286469-23286491 CCCAATTTGTTTCCTTCTGAAGG + Intronic
1119766526 14:77193303-77193325 GCCAAATTGTCCTCCAATGAGGG - Intronic
1121099234 14:91238637-91238659 CCCAAATGGTCCCCTATCCAGGG + Intronic
1121977610 14:98420063-98420085 CCCAAATTGTGCACCACTTACGG - Intergenic
1124851822 15:33347169-33347191 CCCATAATGTCCCCTTCAGAGGG + Intronic
1125484995 15:40105584-40105606 GGCAAATTGTCCCCTCCTGGAGG - Intronic
1137663806 16:50235790-50235812 ACCAAATCCTCCCCTGCTGAGGG - Intergenic
1143573979 17:7779051-7779073 CCCAGATTGGCCCCATCTGATGG + Intronic
1143592743 17:7895332-7895354 CCCAAAGTGCCCCGTGCTGAAGG + Exonic
1145051450 17:19665146-19665168 CCCTGATTGTCCTCTCCTGAGGG + Intronic
1146828461 17:36045662-36045684 ACCAAATTTTCAGCTACTGAAGG - Intergenic
1149758741 17:59210118-59210140 CCCGGAGGGTCCCCTACTGAGGG + Exonic
1149786388 17:59438964-59438986 CCCAAATAGTCCCCACCTCAAGG - Intergenic
1150825469 17:68471160-68471182 ACCACCCTGTCCCCTACTGATGG - Intergenic
1151757055 17:76081081-76081103 CCCAAATTGTCTCCAGTTGAAGG - Intronic
1151838335 17:76599127-76599149 CCAGAACTGTCTCCTACTGAAGG + Intergenic
1160322334 18:77907838-77907860 CCCAAAGTGTGCTCTGCTGATGG - Intergenic
1164771713 19:30814895-30814917 CCTAACATTTCCCCTACTGATGG + Intergenic
926766319 2:16325548-16325570 CCCAATTTTTCCCCAACTGTGGG - Intergenic
928455114 2:31413689-31413711 CCCAAAGTGTCCCCCAAAGAAGG - Intronic
928456220 2:31425073-31425095 CCAATATTGTCTTCTACTGATGG + Intergenic
932417242 2:71580772-71580794 CCCAAATTGTCCCCTACTGAGGG - Intronic
934093664 2:88577824-88577846 CCCCACCTGTCTCCTACTGAGGG + Intronic
938092485 2:128442422-128442444 CCCAAATTGGCAACTACTTAAGG + Intergenic
938267159 2:129936226-129936248 TCCAAACAGTCCCCTATTGACGG + Intergenic
1168817935 20:753641-753663 CACAAATTTTCCCCTCTTGATGG - Intergenic
1173328397 20:42054095-42054117 CCCAAGATGTCCCATACTCAAGG - Intergenic
1173647872 20:44644799-44644821 CCCACAGTGTCTCCTGCTGACGG + Intronic
1179473350 21:41626944-41626966 TCTAAATTGTCCCCATCTGAGGG + Intergenic
1181071925 22:20349187-20349209 CCCAAAATGTCCCTTTCTGGAGG - Intergenic
1181079033 22:20401593-20401615 ACCAAATGGTCACCTGCTGATGG + Intronic
1183224502 22:36540233-36540255 TCCTAAATGTCCCCTACTGAGGG - Intergenic
953557389 3:43957201-43957223 CCAACAGTGTCCACTACTGAAGG + Intergenic
955978725 3:64503032-64503054 CCCAAAATGTCTCTTACAGATGG - Intergenic
961405419 3:126676268-126676290 ACCTAATTGTCCCATACTGTGGG - Intergenic
963077604 3:141361764-141361786 CCCAAATACTTCACTACTGATGG + Intronic
963686683 3:148444189-148444211 CCCATATTGTCCCTTACGTATGG - Intergenic
975964256 4:79950945-79950967 CTCAGATTGTCCCATTCTGATGG + Intronic
976225849 4:82795376-82795398 CACAAATTTCCCCCCACTGAAGG - Intronic
997431549 5:133844404-133844426 CCCAAAGTGTTCCCAGCTGAGGG - Intergenic
999365588 5:151021387-151021409 CCCAAACTCTCCCCTGCAGATGG - Intronic
1000921050 5:167137535-167137557 CCCAGATGTTCCTCTACTGATGG + Intergenic
1001706198 5:173742886-173742908 CCAGGATAGTCCCCTACTGATGG + Intergenic
1002842096 6:914794-914816 CCCACAGAGTCCCCTACAGAGGG - Intergenic
1008648448 6:53540347-53540369 TCTAAATTGTCCCATACTGTAGG - Intronic
1011182924 6:84641762-84641784 CCCAAATTGTCTACTCCTTATGG - Intergenic
1019767744 7:2863965-2863987 CTCATCTTGTCCCCCACTGAAGG + Intergenic
1020152439 7:5693431-5693453 CTGAAATTGTTCCCTGCTGATGG + Intronic
1020557136 7:9684404-9684426 CCCAAATTATCCTCTCCTGGGGG + Intergenic
1022517427 7:30984768-30984790 CCCAAATGTTCCCCTACACAAGG + Intronic
1024555647 7:50600987-50601009 TTTAAAATGTCCCCTACTGAGGG - Intronic
1027718500 7:81707050-81707072 GCAAAATTTTCCCCAACTGAGGG + Intronic
1029532082 7:101132140-101132162 CCCAAAATGTCACCCTCTGAGGG + Intronic
1029592877 7:101518910-101518932 CCCAATCTGTCCCCAACGGAGGG + Intronic
1033057661 7:138074525-138074547 GCCAAATTGTCCCATATTTATGG - Intronic
1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG + Exonic
1034985279 7:155509583-155509605 CCCAACTTCTCCCCGACTAAGGG - Intronic
1037829787 8:22180549-22180571 CCCATATTGACCCCCACTGTGGG - Intronic
1041040787 8:53843861-53843883 CCCAAATTTTCCCCTAGTCCAGG + Intergenic
1043496644 8:80808249-80808271 CCCAAATTATCTGCAACTGAAGG + Intronic
1044795442 8:95892370-95892392 CCCACATGGTCCCTTACTCAAGG - Intergenic
1046966482 8:120172577-120172599 ACCAAAATGTGCCCTTCTGAAGG - Intronic
1050122768 9:2324945-2324967 CCCATCTTGTTCCCTGCTGATGG - Intergenic
1058234507 9:102472795-102472817 CCCAAATTGGCTCCCACTAATGG + Intergenic
1061925503 9:133804286-133804308 CCCAAACAGACCCCGACTGACGG + Intronic
1186455072 X:9704213-9704235 CCCTAATTATCCCCTAGTCAAGG + Intronic
1189352743 X:40288975-40288997 CCCAAATTGTTCTGGACTGAGGG + Intergenic
1191977971 X:66894714-66894736 CCCACATTGTGACCTCCTGAAGG + Intergenic
1192413161 X:70953020-70953042 GCCAAATTGCCCTCTATTGATGG - Intergenic
1192880417 X:75277127-75277149 CCCAAATGTTCACCAACTGATGG - Intronic
1196780548 X:119379873-119379895 CCCCAATTGTGCACTGCTGAAGG - Intergenic
1201548911 Y:15198169-15198191 CTAACATTCTCCCCTACTGAAGG - Intergenic