ID: 932417591

View in Genome Browser
Species Human (GRCh38)
Location 2:71583266-71583288
Sequence CCCCCATCTCTTATGTAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932417591_932417602 21 Left 932417591 2:71583266-71583288 CCCTTTTACATAAGAGATGGGGG 0: 1
1: 0
2: 0
3: 25
4: 214
Right 932417602 2:71583310-71583332 CCTTCCAACAGCCCTGCCACAGG 0: 1
1: 0
2: 1
3: 26
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932417591 Original CRISPR CCCCCATCTCTTATGTAAAA GGG (reversed) Intronic
900241288 1:1618730-1618752 CCCCCACCTCTCATGAACAATGG + Intronic
903314342 1:22489587-22489609 CTCCAATCTCATCTGTAAAATGG + Intronic
904302005 1:29560247-29560269 CCTCCATCTCTTAAATAACATGG + Intergenic
904763910 1:32827166-32827188 CCCACATTTCTTATCTAAATTGG + Intronic
904905850 1:33896755-33896777 CCCCAATCACCTATTTAAAATGG - Intronic
906634624 1:47400745-47400767 ACCCCATCTCTTTTAAAAAATGG - Intergenic
907086647 1:51681755-51681777 CCCACACCCCTTATATAAAATGG + Intronic
907158160 1:52353123-52353145 GCAGCATCTCTTATGTACAAAGG + Exonic
907843474 1:58180077-58180099 CCCAAATCCCTTATATAAAATGG - Intronic
908219149 1:61986015-61986037 CCCAGATTTCTTATGTAAAATGG - Intronic
913667983 1:121067763-121067785 CCCTCATCGCCTATGTAGAAGGG + Intergenic
914019673 1:143854893-143854915 CCCTCATCGCCTATGTAGAAGGG + Intergenic
914678281 1:149920588-149920610 CTCAAATCTCTTATATAAAATGG - Intergenic
915737145 1:158092286-158092308 TCTCCATCTCCTATGTCAAATGG - Intronic
917565647 1:176209223-176209245 GCCCCATCTCTTAAACAAAAGGG - Intergenic
917565659 1:176209254-176209276 GCCCCATCTCTTAAACAAAAGGG - Intergenic
917565671 1:176209285-176209307 GCCCCATCTCTTAAACAAAAGGG - Intergenic
917565684 1:176209317-176209339 GCCCCATCTCTTAAACAAAAGGG - Intergenic
917565696 1:176209348-176209370 GCCCCATCTCTTAAACAAAAGGG - Intergenic
917565708 1:176209379-176209401 GCCCCATCTCTTAAACAAAAGGG - Intergenic
918327503 1:183424257-183424279 ACCCCATCTCTTAAAAAAAATGG - Intergenic
919244543 1:194963777-194963799 GCTCAATCTCTTATATAAAATGG - Intergenic
919699297 1:200614912-200614934 TCCCCATCTCTTAAGAAAAAAGG - Intronic
921573882 1:216811130-216811152 CCATCATCTCTTATTTAAAAAGG - Intronic
922070146 1:222184126-222184148 ACCCCATCTCATATGAAGAAAGG + Intergenic
924042937 1:240001585-240001607 TCCCCATCCCTTACGCAAAAGGG + Intergenic
924333538 1:242964562-242964584 ACCCCATCTCCTATGTCAGAAGG + Intergenic
1065513799 10:26505515-26505537 CCCTTGTCTCTTAAGTAAAATGG - Intronic
1065590613 10:27258305-27258327 CCCCCATCTCTTTTTTTAAATGG - Intergenic
1065633721 10:27709365-27709387 CTCAAGTCTCTTATGTAAAATGG - Intronic
1065660386 10:27999544-27999566 CCCCCATCTCTTTTTTTAAATGG + Intergenic
1066385914 10:34941056-34941078 TCCCCATCTATGATGTGAAAGGG - Intergenic
1067656225 10:48193842-48193864 CCCCCCTCTCTTCTCTACAATGG + Intronic
1069657074 10:70097935-70097957 CCCTCATCTCTTATAAAAAAGGG + Intronic
1071203448 10:83247311-83247333 CCACCTTCTCCTCTGTAAAATGG - Intergenic
1071510428 10:86258570-86258592 CCCCCATCTCTCATGGCAGAGGG + Intronic
1072448051 10:95516533-95516555 CCTCAATCTCCTCTGTAAAATGG - Intronic
1074757771 10:116638643-116638665 CACTCTTCTCATATGTAAAATGG - Intronic
1076257315 10:129037927-129037949 CACCTACCTCTTCTGTAAAATGG + Intergenic
1078669135 11:13349457-13349479 CCTCAGTCTCTTCTGTAAAACGG + Intronic
1078864442 11:15283578-15283600 CTCAAGTCTCTTATGTAAAATGG + Intergenic
1078967235 11:16360159-16360181 CTCCCTTCTCTTCTGTGAAATGG - Intronic
1079563824 11:21855728-21855750 CCCCCAACTTTAATGTAAACAGG - Intergenic
1081746761 11:45478587-45478609 CCCACCTCTCATCTGTAAAATGG + Intergenic
1081917280 11:46740598-46740620 CTCAAATCTCTTATATAAAATGG + Intergenic
1083291659 11:61693899-61693921 CCCTCTCCTCTTATGTAAAATGG - Intronic
1083622861 11:64057542-64057564 CCCCTCTCTCATCTGTAAAATGG - Intronic
1086323780 11:85677587-85677609 CCCACATATTTTATGTAAATGGG + Intronic
1087789905 11:102394786-102394808 CCTCCATGTCATCTGTAAAATGG - Intergenic
1089037374 11:115408696-115408718 CATCCATTTCTTATGTGAAAGGG + Intronic
1089573756 11:119426690-119426712 CCACCATCTCTTCAGAAAAATGG - Intergenic
1089729194 11:120510221-120510243 ACCCCCTCTCTTGTGCAAAATGG - Intergenic
1090425775 11:126606076-126606098 CCTCCATTTCTTCAGTAAAATGG + Intronic
1092017270 12:5169796-5169818 TCCTCATCTCATCTGTAAAATGG - Intergenic
1092948649 12:13480035-13480057 CCCACTTTTCTTATGGAAAAAGG - Intergenic
1093029056 12:14271510-14271532 CCACCATATCTTAGGGAAAATGG - Intergenic
1094146809 12:27237138-27237160 CCCCACTCACATATGTAAAATGG - Intergenic
1095457802 12:42407657-42407679 CTCAAATCCCTTATGTAAAATGG + Intronic
1096440717 12:51641251-51641273 CTCAAGTCTCTTATGTAAAATGG - Intronic
1096921241 12:55087998-55088020 CCCCCATCTATTCTGGAAATGGG + Intergenic
1097940321 12:65297403-65297425 CCTCCATCTCATATGCAGAATGG - Intronic
1097953756 12:65462231-65462253 GCCCCATCCCTGATGGAAAAGGG + Intronic
1097995431 12:65882633-65882655 CCTCCATCTCATCTGTAAAATGG + Intronic
1098644141 12:72877927-72877949 CCAACATCTCTTATATAAAGTGG - Intergenic
1098972280 12:76869128-76869150 GCCCCATCTCTGCTGCAAAATGG + Intronic
1099571840 12:84331335-84331357 CCCCCATCTCAGATTTCAAAAGG + Intergenic
1105808147 13:23970859-23970881 CTCAAATCTCTTATATAAAATGG - Intergenic
1106156487 13:27162330-27162352 CCCCAATCTCTTGTTTGAAAAGG + Intronic
1111368213 13:87278984-87279006 ACCCCATCTCTTAAAAAAAATGG - Intergenic
1112307181 13:98285604-98285626 CCCCAATGTCAGATGTAAAAAGG - Intronic
1115521388 14:34236160-34236182 CCACTTTCTCATATGTAAAAGGG - Intronic
1115877696 14:37879252-37879274 CCACTTTCTCTTCTGTAAAATGG - Intronic
1118163906 14:63317340-63317362 CCTCCATGTCATCTGTAAAACGG + Intronic
1120222113 14:81746310-81746332 CAGTCTTCTCTTATGTAAAATGG - Intergenic
1120306622 14:82779432-82779454 CCCCCATCTCTAATGTTGAATGG + Intergenic
1122459881 14:101885653-101885675 CCCACATCTCGTTTGTAAAATGG + Intronic
1124873484 15:33567145-33567167 CCCCCATGTGTTATGTAGAAAGG + Intronic
1126546324 15:49878342-49878364 CTCCCTTCTCATATGTAAAAAGG - Intronic
1130566647 15:85001975-85001997 ACCCCATCTCTTAAAAAAAAAGG - Intronic
1130775108 15:86971024-86971046 CACAAATCTCTTATATAAAATGG - Intronic
1135493174 16:22927756-22927778 CCAGCATCTCTTATATAAAGAGG - Intergenic
1138101480 16:54255445-54255467 CTCCCATCCCTTATTTAGAATGG + Intronic
1138849634 16:60611552-60611574 GCCCCATCACTTATGACAAATGG - Intergenic
1140666191 16:77229737-77229759 CCCCCATCTATTAAAAAAAAAGG - Intergenic
1147500042 17:40954301-40954323 CCCCCTTCTCTCATTTAAAGTGG + Intergenic
1148999010 17:51737860-51737882 TCCCCATCTCTGCAGTAAAAGGG - Intronic
1155950686 18:31909577-31909599 CCCCCATCTTTTATCTATAAAGG + Intronic
1156689935 18:39695544-39695566 TCCCCATCCCCTATGAAAAAGGG + Intergenic
1158511212 18:58092278-58092300 CACCCATCTTATACGTAAAATGG - Intronic
1163141728 19:15354020-15354042 ACCCCATCTCTTAAAAAAAAAGG - Exonic
1167462773 19:49635135-49635157 CCCCCATCTCTTAAAAAAAAAGG - Intergenic
925045904 2:772951-772973 CCACCATCTCTGAAGTAACACGG - Intergenic
927412012 2:22837166-22837188 GCCAAATCTCATATGTAAAAAGG - Intergenic
927710728 2:25324297-25324319 CCTCCATGTCTTCTATAAAATGG - Intronic
927759054 2:25734712-25734734 CCTCCATCTGTTAAGTGAAATGG - Intronic
929058854 2:37903076-37903098 TCCCCATCTCCTATGAAGAAGGG - Intergenic
929689434 2:44062168-44062190 CCCCCCTCCCTTATGAAAAAAGG + Intergenic
930758399 2:55003858-55003880 CCCACGTCTCTTATATAAAATGG - Intronic
930804163 2:55473275-55473297 CCTCCATCTCTTAAAAAAAATGG + Intergenic
931032674 2:58198450-58198472 CCCAAATCTCTTATATAAATGGG - Intronic
932417591 2:71583266-71583288 CCCCCATCTCTTATGTAAAAGGG - Intronic
936787999 2:116118641-116118663 CACCCAAATCTCATGTAAAATGG - Intergenic
937460436 2:122080730-122080752 ACCCAATCTCTTTTGTAAAATGG - Intergenic
937796098 2:126022210-126022232 CCTACATCCCTTATATAAAATGG - Intergenic
937928147 2:127183421-127183443 CCCCCATCTCTTAAAAAAAAGGG - Intergenic
938118155 2:128616061-128616083 CACCCATATCTCATGTCAAATGG + Intergenic
939421981 2:141983468-141983490 CCCCTATCTCTTATTGAGAAAGG + Intronic
941026921 2:160466897-160466919 CAGCCTCCTCTTATGTAAAATGG + Intronic
941274616 2:163475295-163475317 CCCCAAACTCTTAGGTAAATAGG - Intergenic
943122788 2:183757937-183757959 CCCGCATCTCCTCTGTTAAATGG - Intergenic
943230505 2:185244794-185244816 CCACCATCTCAGATGTAAATTGG + Intergenic
943693429 2:190894199-190894221 CTCAAGTCTCTTATGTAAAATGG + Intronic
943741151 2:191410474-191410496 CCCTCATCCCTATTGTAAAATGG + Intronic
945144372 2:206721639-206721661 CCCACATCTCTTGTTTCAAAGGG + Intergenic
945208595 2:207358746-207358768 CCCACGTCCCTTATATAAAATGG - Intergenic
945941739 2:215957726-215957748 CCCCCAGCTCTCATCTCAAAAGG + Intronic
947355221 2:229287445-229287467 CCCCCATATCTTCTACAAAATGG - Intergenic
1169063062 20:2675513-2675535 CCCCCATCCCCTTTTTAAAAAGG + Intergenic
1170833658 20:19865028-19865050 CCAGCATCTTTGATGTAAAAGGG - Intergenic
1174960076 20:55146395-55146417 CTCCATTCTCTTATATAAAATGG - Intergenic
1178465968 21:32847888-32847910 TCCCCATCCCATCTGTAAAATGG - Intergenic
1180709743 22:17831704-17831726 CCCCCATGTCTTATGTCAGGAGG + Intronic
1182198301 22:28541906-28541928 CCCCCATGTCTTAAAAAAAAAGG + Intronic
1182801590 22:33036034-33036056 TCACCTTATCTTATGTAAAATGG + Intronic
1184044813 22:41966436-41966458 CTCCCCTCTCATCTGTAAAATGG - Intergenic
951252854 3:20414884-20414906 CCCCCCTGTCTTATGCCAAAGGG + Intergenic
952848489 3:37708739-37708761 CCCTCATCTCATGTGTAAAAAGG - Intronic
954076308 3:48183946-48183968 CTCCCATCTCTTGCCTAAAATGG - Intronic
956113673 3:65896988-65897010 CTCACATCTCTGATATAAAATGG + Intronic
956247004 3:67195027-67195049 TCCTCATCTCATCTGTAAAATGG - Intergenic
957875781 3:86144393-86144415 GCCCAATCTCTTGTATAAAATGG + Intergenic
958921907 3:100116519-100116541 CCTCCATCCATTATGGAAAATGG + Intronic
959265545 3:104132838-104132860 CTCCCATATATTAAGTAAAAAGG + Intergenic
959457590 3:106581845-106581867 CCTTCATGTCATATGTAAAATGG - Intergenic
959792737 3:110383718-110383740 CCCCTAGCTCTGATGTAAACTGG + Intergenic
960630033 3:119720778-119720800 CGCAAGTCTCTTATGTAAAATGG + Intronic
961661045 3:128468952-128468974 TCCTCATCTCATCTGTAAAAGGG + Intergenic
962539707 3:136367412-136367434 CCCAAATCTCTTAAATAAAATGG - Intronic
962576182 3:136757036-136757058 CCCCCTTCCCTTATGAAAAAGGG + Intergenic
962844237 3:139261069-139261091 GGCCTTTCTCTTATGTAAAATGG + Intronic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
966742544 3:183247825-183247847 CCCAAGTCTCTTATGTAAAATGG - Intronic
967550147 3:190783798-190783820 CCCAAGTCTTTTATGTAAAATGG - Intergenic
967897636 3:194411360-194411382 CACCCATCTCTAAAGAAAAATGG + Intronic
968243872 3:197121294-197121316 ACCCCAAATCTTATGTAAAAAGG + Intronic
969177275 4:5408229-5408251 CCCCCAAATCTCATGTCAAATGG + Intronic
969456688 4:7304293-7304315 CCCCCGTCGCTAATGAAAAAGGG - Intronic
970596097 4:17601634-17601656 CTCACATCCCTTATGTAAAATGG + Intronic
970956270 4:21815225-21815247 CCCCAACCTCATCTGTAAAAAGG + Intronic
972557297 4:40193995-40194017 CCTCCATCTCCTAAGTAGAAGGG - Intronic
973268739 4:48238058-48238080 CCCAAATTTCTTTTGTAAAAGGG + Intronic
975797236 4:78020244-78020266 CTCCAGTCTCTTATCTAAAATGG - Intergenic
976081442 4:81359516-81359538 CTCCCATCTATTTTTTAAAAAGG + Intergenic
977583703 4:98751847-98751869 TCCTCATCTCATATGTTAAATGG - Intergenic
981999597 4:151010077-151010099 CTCCAGTCTCTTATATAAAATGG - Intronic
982078113 4:151759397-151759419 TCCACGTCTCTTATTTAAAAAGG + Intronic
982336888 4:154250081-154250103 CTCACATTTCTTATATAAAATGG - Intronic
983030263 4:162792299-162792321 CTCACATCTCATCTGTAAAAGGG - Intergenic
983246312 4:165291759-165291781 CTCCAGTCTCTTATATAAAATGG + Intronic
984429273 4:179627308-179627330 CTCCCTTCTATTATCTAAAATGG + Intergenic
985130546 4:186734492-186734514 CCCCCATCTCTTATCCACCAGGG + Intergenic
987754509 5:22083645-22083667 CCTCCATTTCTTCTGTCAAATGG - Intronic
988905044 5:35778948-35778970 CCCAAATCTATTTTGTAAAAAGG - Intronic
990156967 5:52888457-52888479 CCCCCATCACTTAGCTAAAGTGG + Intronic
992002127 5:72446047-72446069 CCACCATCTCTTTTGTAAGGAGG + Intronic
992327618 5:75677126-75677148 CCACTTTCTCTTCTGTAAAATGG - Intronic
992786695 5:80176820-80176842 CCCTCAGCTCATATGAAAAAGGG + Intronic
993517030 5:88850339-88850361 CCTCCATTTCATCTGTAAAATGG - Intronic
993649021 5:90495529-90495551 TCCCATTCTCTTATGTACAAAGG + Intronic
994902175 5:105788153-105788175 CTCCCAACTTTTATTTAAAAGGG + Intergenic
994941031 5:106324456-106324478 CGCCCATTTCTTATGTATACTGG - Intergenic
995545987 5:113231608-113231630 CCCCCATATCATCTCTAAAATGG + Intronic
996011748 5:118488202-118488224 ACCTCATCCCTTATTTAAAAGGG + Intergenic
997816640 5:137025769-137025791 CACCTATCTCATCTGTAAAATGG - Intronic
997843098 5:137260096-137260118 CACCCATCTCTGAAATAAAAAGG - Intronic
998194542 5:140056353-140056375 CCTCCATATCATCTGTAAAATGG + Intergenic
998882017 5:146654254-146654276 CCCCCACCTCCCCTGTAAAATGG - Intronic
999253797 5:150198299-150198321 CCCCCATCCCTTACCTATAAAGG + Intronic
999547481 5:152646296-152646318 CTCTCAGCTCTTAGGTAAAATGG + Intergenic
999630060 5:153561593-153561615 CCCCCATTTCTTAGAGAAAATGG - Intronic
1002203030 5:177541822-177541844 CTCCAATCTCTGATATAAAATGG + Intronic
1006948767 6:37803842-37803864 CCCTCATCTAGAATGTAAAATGG - Intergenic
1006965881 6:37984368-37984390 CCCTCTTCTCATATGTACAACGG - Intronic
1007145570 6:39626443-39626465 CCCCCAGCTCTGATGTTTAATGG + Intronic
1008976395 6:57432082-57432104 CATTCATCTCATATGTAAAAAGG - Intronic
1009742455 6:67764403-67764425 CCACCATCTCTTTTCCAAAATGG - Intergenic
1011124663 6:83994269-83994291 CCACCATGTTTTATGTAAATAGG + Intergenic
1012248010 6:96947889-96947911 CACCCTTATCTTATGTCAAAAGG + Intronic
1012549178 6:100452230-100452252 CAACCATCTCTTATTTTAAAAGG + Intronic
1017697058 6:157026684-157026706 CCCCCATCTCAAAAATAAAAAGG - Intronic
1020034773 7:4958377-4958399 CCTCCGTCTCTTTTGTAAAATGG - Intronic
1020529674 7:9317105-9317127 CCTCCATCTTTTCTGTCAAAAGG - Intergenic
1022389541 7:29931406-29931428 CAGTCATCTCATATGTAAAATGG - Intronic
1024030235 7:45454514-45454536 CCTCCATCTCTTAGATAAATAGG - Intergenic
1025030308 7:55551592-55551614 CCCCCTTCCCTTAGGAAAAAGGG + Intronic
1025964221 7:66253221-66253243 CCCAAATCTCTCATATAAAATGG - Intronic
1030235279 7:107253140-107253162 CCACCATATCTTATGCAAATAGG - Intronic
1032688167 7:134256710-134256732 CCCTCATGTCTTAACTAAAATGG + Intronic
1032867144 7:135937505-135937527 CCCAAATCCCTTATATAAAATGG + Intronic
1034144915 7:148861076-148861098 TGCTCATCTCTTATATAAAATGG + Intronic
1034376619 7:150650488-150650510 CCCCAATAACTTATGGAAAAAGG - Intergenic
1037350766 8:17952690-17952712 CCCAAATCCCTTATATAAAATGG - Intronic
1038392565 8:27217476-27217498 CCTGCATCTTTTCTGTAAAATGG - Intergenic
1038598373 8:28911756-28911778 CTCAAATCACTTATGTAAAATGG - Intronic
1040883165 8:52230614-52230636 CCCCCACCCCGTATGTAAATGGG - Intronic
1040898759 8:52395158-52395180 CCACCATCTCTCCTGTACAATGG + Intronic
1042031914 8:64485571-64485593 CTCCAGTCTCTTATATAAAATGG - Intergenic
1044514045 8:93117854-93117876 CACCCATGTCTTCTGTAAACTGG - Intergenic
1045806719 8:106170953-106170975 TCCCCAACTCTCATTTAAAAGGG - Intergenic
1046027659 8:108744954-108744976 CCCAAATTTCTTATGCAAAATGG - Intronic
1047123824 8:121937717-121937739 CAGCCATCTCATCTGTAAAATGG - Intergenic
1047897184 8:129379721-129379743 TCCCCAGCTCTTAAGTCAAATGG + Intergenic
1050470319 9:5981743-5981765 CGTCCATCTCTTCTGGAAAATGG + Intronic
1051083899 9:13324802-13324824 CTCCAGTCTCTTATATAAAATGG - Intergenic
1051502263 9:17790728-17790750 GCCTCATCTGTAATGTAAAAGGG - Intronic
1056292676 9:85159637-85159659 CCCAGATTTCTTATATAAAACGG - Intergenic
1056299789 9:85229169-85229191 CCTCCAGCTCTGATGTAAGAAGG - Intergenic
1057076151 9:92139142-92139164 CCCCCACCTCTTATGTAGAGGGG - Intergenic
1057737284 9:97675194-97675216 CTCCCATCTCTGTTGTAAGAAGG + Exonic
1057773642 9:97987130-97987152 CCCCCATCCCTTAGGGAAATGGG - Intronic
1058455484 9:105134335-105134357 CACCCAGCTCTTATTTAAGATGG - Intergenic
1060015979 9:120086818-120086840 CCCCCATCTCTTAAAAAGAAAGG - Intergenic
1060991617 9:127853018-127853040 CCCTTTTCTCTTCTGTAAAATGG + Intronic
1061857351 9:133449566-133449588 CACCTTTCTCTTCTGTAAAATGG + Intronic
1185940913 X:4317976-4317998 ACCCCATCTCTTACATAAATAGG + Intergenic
1186112250 X:6270739-6270761 CTCAAATCCCTTATGTAAAACGG - Intergenic
1187020366 X:15375212-15375234 CCTCCATCTCCTTTTTAAAATGG + Intronic
1188118873 X:26280311-26280333 CTCCCATTTTTTAAGTAAAAGGG + Intergenic
1188189017 X:27151373-27151395 CTCCCATTTCTTATGAGAAAAGG + Intergenic
1188829365 X:34877545-34877567 CCCCCAGCTGTTGTGTAAATTGG - Intergenic
1190370556 X:49736418-49736440 CAACCCTCCCTTATGTAAAATGG - Intergenic
1195850065 X:109273273-109273295 CCCTTATCTCTTTTTTAAAAAGG - Intergenic
1195949869 X:110258563-110258585 CCATCATCTCTTTTATAAAAAGG + Intronic
1197483129 X:127011864-127011886 CCATCATCTCTTGTGTGAAATGG + Intergenic
1198944071 X:141990254-141990276 CTCCAATCTCTTAAGTATAAAGG + Intergenic
1198985606 X:142449080-142449102 CCCCCAGCACTTATTTGAAAAGG - Intergenic
1199302974 X:146234107-146234129 ACCACATCTCTTAAGAAAAATGG - Intergenic
1199419085 X:147622310-147622332 CCCAAATCCCTTATATAAAATGG + Intergenic
1202391264 Y:24372839-24372861 ACCCCATCTCCTATGTCAGAAGG - Intergenic
1202479521 Y:25297278-25297300 ACCCCATCTCCTATGTCAGAAGG + Intergenic