ID: 932419310

View in Genome Browser
Species Human (GRCh38)
Location 2:71592193-71592215
Sequence GGCCGAGCACCCTGCAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 192}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932419300_932419310 3 Left 932419300 2:71592167-71592189 CCCCCTTGTCCTCTGTGGGCCCT 0: 1
1: 0
2: 4
3: 43
4: 368
Right 932419310 2:71592193-71592215 GGCCGAGCACCCTGCAGAGAGGG 0: 1
1: 0
2: 3
3: 25
4: 192
932419296_932419310 15 Left 932419296 2:71592155-71592177 CCCAGGCAGAAGCCCCCTTGTCC 0: 1
1: 0
2: 0
3: 14
4: 221
Right 932419310 2:71592193-71592215 GGCCGAGCACCCTGCAGAGAGGG 0: 1
1: 0
2: 3
3: 25
4: 192
932419297_932419310 14 Left 932419297 2:71592156-71592178 CCAGGCAGAAGCCCCCTTGTCCT 0: 1
1: 0
2: 1
3: 24
4: 356
Right 932419310 2:71592193-71592215 GGCCGAGCACCCTGCAGAGAGGG 0: 1
1: 0
2: 3
3: 25
4: 192
932419303_932419310 0 Left 932419303 2:71592170-71592192 CCTTGTCCTCTGTGGGCCCTGCG 0: 1
1: 0
2: 3
3: 30
4: 344
Right 932419310 2:71592193-71592215 GGCCGAGCACCCTGCAGAGAGGG 0: 1
1: 0
2: 3
3: 25
4: 192
932419301_932419310 2 Left 932419301 2:71592168-71592190 CCCCTTGTCCTCTGTGGGCCCTG 0: 1
1: 0
2: 5
3: 49
4: 360
Right 932419310 2:71592193-71592215 GGCCGAGCACCCTGCAGAGAGGG 0: 1
1: 0
2: 3
3: 25
4: 192
932419306_932419310 -6 Left 932419306 2:71592176-71592198 CCTCTGTGGGCCCTGCGGGCCGA 0: 1
1: 0
2: 1
3: 14
4: 143
Right 932419310 2:71592193-71592215 GGCCGAGCACCCTGCAGAGAGGG 0: 1
1: 0
2: 3
3: 25
4: 192
932419295_932419310 25 Left 932419295 2:71592145-71592167 CCAGGGGGGGCCCAGGCAGAAGC 0: 1
1: 0
2: 2
3: 41
4: 531
Right 932419310 2:71592193-71592215 GGCCGAGCACCCTGCAGAGAGGG 0: 1
1: 0
2: 3
3: 25
4: 192
932419302_932419310 1 Left 932419302 2:71592169-71592191 CCCTTGTCCTCTGTGGGCCCTGC 0: 1
1: 0
2: 3
3: 31
4: 393
Right 932419310 2:71592193-71592215 GGCCGAGCACCCTGCAGAGAGGG 0: 1
1: 0
2: 3
3: 25
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932419310 Original CRISPR GGCCGAGCACCCTGCAGAGA GGG Intronic
900080097 1:850180-850202 GGCAGAGAAGCCTTCAGAGAAGG + Intergenic
900363436 1:2300836-2300858 GGCCGAGGACCCTGCAGATCTGG - Intronic
904320638 1:29695748-29695770 GGGTGAGCACTCAGCAGAGAGGG + Intergenic
906521715 1:46470550-46470572 GTCCAAGCACCCAGCAGCGATGG - Intergenic
908431261 1:64060739-64060761 GACTCAGCACTCTGCAGAGAAGG + Intronic
910936450 1:92486803-92486825 CGCCGAGCCCCCGGCGGAGAGGG + Intronic
915740188 1:158113423-158113445 TGCCGAGCCCCCTGCCGAGCGGG - Intergenic
915835265 1:159171424-159171446 GGCCGAGCTCCCGGGGGAGAGGG + Intergenic
920387843 1:205580786-205580808 GGCCCAGCACCCTGGAGACATGG - Exonic
1062979464 10:1710030-1710052 GACTGAGCACTTTGCAGAGAAGG - Intronic
1063179382 10:3584091-3584113 GGCCAACCACGCTGCAGGGAAGG - Intergenic
1064552746 10:16520345-16520367 GGCCGGGCTCCCTGGAGCGACGG - Intronic
1069635466 10:69922330-69922352 GCCTGAGCACCCTGCAGTGATGG + Intronic
1071351489 10:84750453-84750475 AGCCTAGAACCCTGCACAGAAGG - Intergenic
1071503878 10:86221649-86221671 GGCCCAGCACCCTCCAGGAATGG + Intronic
1072612884 10:97030895-97030917 GGCCCAGCCCTCTGCAGAGAGGG + Intronic
1073027253 10:100497107-100497129 TGGCCAGTACCCTGCAGAGAAGG + Intronic
1073101110 10:101007181-101007203 GGCAGAGCTCCCTACAGAGCTGG - Exonic
1074121355 10:110496508-110496530 GGAAGAGCAGCCTGCAGGGAAGG + Intergenic
1075738605 10:124679522-124679544 GGCAGAGCCCCATGGAGAGAGGG + Intronic
1075887273 10:125911885-125911907 GGGCGGGCTCCCTGCACAGAAGG + Intronic
1076469807 10:130710476-130710498 GGCCGAGGAGCCTTCAGAGTAGG + Intergenic
1076782190 10:132730460-132730482 GGCCGAGGAGCCTGCAGACAGGG - Intronic
1076876996 10:133220835-133220857 GGCCGCGCATCCAGCAGAGGAGG + Intronic
1077551124 11:3200781-3200803 GCCCGGGCCCCCTGCAGGGAAGG + Intergenic
1078141225 11:8694403-8694425 GGCTGAGCACCCTGCAGGGAGGG + Intronic
1078352713 11:10607746-10607768 GAACCAGCCCCCTGCAGAGATGG - Intronic
1079401173 11:20107571-20107593 GTCCGAGCACCCTTCACAGGAGG - Intronic
1080839481 11:35970983-35971005 GGCTGAGCACCAGGGAGAGATGG - Intronic
1083709877 11:64541354-64541376 GGCAGGGCACCCTGCAGAGTAGG - Intergenic
1084400662 11:68941103-68941125 TGCTGAGCACCATGCACAGAAGG + Intergenic
1084570711 11:69958098-69958120 GCACCAGCACCTTGCAGAGAAGG + Intergenic
1084648244 11:70473340-70473362 AGCCCATCACCCTGCAGAGCCGG - Intronic
1085326711 11:75611976-75611998 GGCCGAGCACACTGCAGCTCTGG - Intronic
1085697155 11:78714763-78714785 GGCGGGGCACACTGCAGAGCAGG - Intronic
1085722918 11:78929073-78929095 GGCAGCTCACCATGCAGAGAAGG + Intronic
1088795024 11:113260521-113260543 GGCCAAGCATCCTGGAGAAAAGG + Intronic
1089036151 11:115394662-115394684 GACTGAGCACACTACAGAGATGG + Intronic
1091848855 12:3679021-3679043 GGCCCAGCGCCATGAAGAGAAGG - Exonic
1095296629 12:40534484-40534506 GGTCTAGGACTCTGCAGAGAAGG + Intronic
1095409839 12:41909524-41909546 GGCTGAGCAGGCTGCAGAGGTGG - Intergenic
1096077046 12:48812498-48812520 GGCAGGGCACCCTGCTGAGAGGG - Intergenic
1096606633 12:52771168-52771190 GGCTGAGCAGCGTGGAGAGATGG - Exonic
1096609457 12:52791375-52791397 GGCCGAGCAGCATGGAGAGATGG - Exonic
1100603365 12:96131245-96131267 AGAAGAGCACCCTGCAGAGAGGG + Intergenic
1103869484 12:124081107-124081129 GGCTGAGCAGCCTCCAGAGAAGG + Intronic
1104725290 12:131071856-131071878 CTCCGAGAACCCTGCAGAGACGG - Intronic
1104801744 12:131559296-131559318 CTCCGAGAACCCTGCAGAGACGG + Intergenic
1104913459 12:132251661-132251683 GGCCCAGCCCCCGGCAGACAGGG + Intronic
1107836692 13:44417503-44417525 GGCTGAGAGCCCTGCAGAAATGG - Intergenic
1108932738 13:55849030-55849052 AGCAGAGCACCTTGAAGAGAAGG + Intergenic
1116801640 14:49450267-49450289 AGCCCAGAACCCTGGAGAGAAGG + Intergenic
1117326552 14:54674162-54674184 GGCCTAGGTCCCTGCAGAGTCGG + Intronic
1120709700 14:87780816-87780838 GGCCGAGTACCCCTCTGAGAAGG - Intergenic
1121603146 14:95220878-95220900 CGCAGAGCCCCCTGAAGAGACGG - Intronic
1121695862 14:95911358-95911380 GGCCCAGGGCACTGCAGAGAGGG - Intergenic
1122749344 14:103921311-103921333 GGCCTACCTCCCTTCAGAGAAGG + Intronic
1125505424 15:40265181-40265203 ACCCCACCACCCTGCAGAGAGGG - Intronic
1126137204 15:45403231-45403253 GGCCGGGAACCCTGCAGCGCCGG - Exonic
1126192683 15:45895129-45895151 GGCAGAGCAGCCTCCAGACATGG + Intergenic
1126204271 15:46025832-46025854 GGCCCAGAACCATGCAGTGAAGG - Intergenic
1127287697 15:57545531-57545553 GGCTGGGCCCCCTGCAGGGATGG + Intronic
1129251323 15:74310737-74310759 GGCTGAGCAGGCTGTAGAGAAGG + Intronic
1131151396 15:90049542-90049564 AGCCTACCACCCTGCAGACAGGG + Intronic
1132700815 16:1221292-1221314 GACCGGGCACCCGCCAGAGAGGG + Exonic
1132800868 16:1752329-1752351 TGACCAGCACCCTGCAGAGTAGG - Intronic
1133249981 16:4474479-4474501 GGCCGAGTCCACTGCAGAGGCGG + Exonic
1134238875 16:12489397-12489419 GGCCCATGACACTGCAGAGAAGG - Intronic
1135404005 16:22185186-22185208 GGCAGAGCAGCCTTCAGACATGG + Intronic
1135406994 16:22206047-22206069 GGCCTAGCATCCGGCAGCGAGGG - Intergenic
1135491364 16:22912592-22912614 GGCACTGCTCCCTGCAGAGAAGG + Intronic
1136283927 16:29230439-29230461 GGCCAAGGACCCTGCAGCAAGGG + Intergenic
1136685806 16:31994363-31994385 GGCCGAGGGCCCTGCTGGGAGGG - Intergenic
1136786419 16:32937896-32937918 GGCCGAGGGCCCTGCTGGGAGGG - Intergenic
1136883353 16:33915899-33915921 GGCCGAGGGCCCTGCTGGGAGGG + Intergenic
1137562369 16:49511010-49511032 GGCCCAGCTCCAGGCAGAGATGG - Intronic
1142088958 16:88199949-88199971 GGCCGAGGACCCCGCAGCAAGGG + Intergenic
1142366313 16:89651776-89651798 GGCCCAGCACACCGCAGGGAAGG + Intronic
1203088653 16_KI270728v1_random:1199562-1199584 GGCCGAGGGCCCTGCTGGGAGGG - Intergenic
1145737277 17:27241663-27241685 GACAGAGGACCCTGCTGAGAGGG + Intergenic
1146544358 17:33725417-33725439 GGCAGGGCAGCCTGCAGTGATGG + Intronic
1146600237 17:34208226-34208248 GTCCCAGCACCATGCAGTGAGGG + Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147159813 17:38563257-38563279 GGTCCAGCACCCTGCAGAGGAGG + Intronic
1148115040 17:45170491-45170513 GGCCCAACCCCCTGCAGAGAGGG - Intergenic
1148143114 17:45342323-45342345 GGCTGAGCAGCTTGCTGAGATGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150594457 17:66591803-66591825 GGCCGACTCCCATGCAGAGAGGG + Intronic
1151491328 17:74433532-74433554 GCCTGAGCGCCCTGCACAGAGGG + Intronic
1151551681 17:74826015-74826037 GGCTGAGCAGCCTGCAGGAAAGG + Intronic
1151569946 17:74921200-74921222 GGCCCTGCTCCCTGCAGACAGGG - Intronic
1152523091 17:80871897-80871919 GGCAAAGCTCCCTGCAGAAAGGG - Intronic
1152932449 17:83116739-83116761 GCCCGAGCACGCTGGACAGAGGG - Intergenic
1154412802 18:14150457-14150479 GGCTCAGCACCCTGCAGGGAGGG + Intergenic
1155427740 18:25723968-25723990 AGCAGAGCTCCCTGCAGAGAGGG + Intergenic
1156479581 18:37427555-37427577 GGCTGGGGAGCCTGCAGAGAGGG - Intronic
1157293694 18:46427110-46427132 GTCTCAGCACCCTGCTGAGAAGG - Intronic
1158453705 18:57588446-57588468 GGCCCAGCACCCTGGATGGAGGG - Intergenic
1160025454 18:75211866-75211888 GGCCGAGCAGCATGCCGAGGAGG + Intronic
1160231722 18:77054058-77054080 GGCCAAGCACCCTGCAGACCAGG - Intronic
1160500366 18:79398637-79398659 GGCCGCGGGCCCTGCAGGGATGG - Intronic
1162948081 19:14055415-14055437 GGACGGTGACCCTGCAGAGATGG + Exonic
1163611953 19:18306287-18306309 GAACGAGGACCCTGAAGAGAAGG + Exonic
1164616069 19:29667466-29667488 GGCCCAGGTCCCTGCAGGGAAGG + Intronic
1164643617 19:29843477-29843499 GGCAGAGCCCCGTGCAGGGAAGG - Intergenic
1165157579 19:33797338-33797360 GGCCGAGCGCCCTGCAGAGCTGG + Intronic
1165386297 19:35512467-35512489 GCCACAGCTCCCTGCAGAGAGGG + Exonic
1166153604 19:40893667-40893689 TCCCGAGGATCCTGCAGAGAGGG + Intronic
1166722198 19:45002937-45002959 GTCGGGGGACCCTGCAGAGAAGG - Exonic
925304530 2:2838907-2838929 GGCCTGGAACTCTGCAGAGAAGG + Intergenic
926712122 2:15890126-15890148 GCCTGAGCACCCTGCAGTCAGGG + Intergenic
926978104 2:18535049-18535071 GACAGAGGACCCTGGAGAGATGG - Intergenic
932419310 2:71592193-71592215 GGCCGAGCACCCTGCAGAGAGGG + Intronic
933512331 2:83256767-83256789 GGCAGAGCACCATGCATTGAAGG + Intergenic
933899905 2:86841950-86841972 GGCAAAGCAACCTGCAAAGATGG + Intronic
936396964 2:112138554-112138576 CGCCCCGCACCCTGCAGGGACGG + Exonic
938203911 2:129400998-129401020 GGCAGAGCAGCCTGCACAGCAGG - Intergenic
942452602 2:176117618-176117640 GCCCGGGAACCCGGCAGAGAGGG + Intronic
946175222 2:217918445-217918467 GGCAGAGCCCCCTGCACAGGCGG + Intronic
948606022 2:239135713-239135735 GGCCGAGCACCCAGCAGGCATGG + Intronic
1169194332 20:3675092-3675114 GGGCCAGCAGCCTGCTGAGAGGG + Exonic
1171225181 20:23436769-23436791 GGCTGAGGAACCTGCAGACAGGG - Intergenic
1172013668 20:31860975-31860997 GGGCCAGCAGCCTGCAGAAAAGG - Intronic
1173273811 20:41560565-41560587 GCCCAAGCACCCTCCAGGGAGGG + Intronic
1175242725 20:57561658-57561680 GTCCCAGCACCCTGCAGGCAGGG + Intronic
1175625683 20:60486731-60486753 GGCCGGGGAACCTGCAGAGGAGG + Intergenic
1176166399 20:63676292-63676314 GGCCGTTTACCCTGCAGAGTCGG + Intronic
1176456626 21:6918237-6918259 TGCCTAGCACCATGGAGAGAGGG - Intergenic
1176834798 21:13783295-13783317 TGCCTAGCACCATGGAGAGAGGG - Intergenic
1176860205 21:14007798-14007820 GGCTCAGCACCCTGCAGGGAGGG - Intergenic
1177821217 21:26032878-26032900 GGCTCAGAGCCCTGCAGAGATGG + Intronic
1178437084 21:32569535-32569557 TGCCGAGCTCCCAGCAGCGACGG - Intergenic
1178957099 21:37032430-37032452 GGCCATGCTCCCTGCTGAGAAGG - Intergenic
1179491165 21:41742409-41742431 GGCCTAGCAGCCTGCAGAGATGG + Intronic
1179893918 21:44351003-44351025 GCCCGAGCAACCTCCAGAGAGGG + Intronic
1180871747 22:19150446-19150468 GGCCGGGGGCGCTGCAGAGAGGG + Intergenic
1180911493 22:19454005-19454027 GGCTGAGCATCCTGTAGACATGG - Intronic
1181390900 22:22579993-22580015 GGCCCAGGACCCTGGAAAGAGGG - Intergenic
1181391798 22:22588369-22588391 GGCCCAGGACCCTGGAAAGAGGG - Intergenic
1181407962 22:22698102-22698124 GGCCCAGGACCCTGGAAAGAGGG - Intergenic
1181415956 22:22758892-22758914 GGCCCAGGACCCTGGAAAGAGGG - Intronic
1181937375 22:26448544-26448566 GGCCAAGCACCCTGAGGAAAGGG - Intronic
1182304491 22:29358549-29358571 GGTCTAGCTCCCTCCAGAGAGGG + Intronic
1182784690 22:32897503-32897525 GGCCTCCCATCCTGCAGAGAAGG + Intronic
1182902642 22:33911154-33911176 AGCAGAGCATGCTGCAGAGAAGG + Intronic
949125692 3:443330-443352 GGCAGAGCAGCTTGCACAGAAGG + Intergenic
953851636 3:46469585-46469607 TGCTGATCACCCTGAAGAGAGGG + Intronic
954415050 3:50389178-50389200 GGCCGAGCACCCTGCAGCTTGGG - Intronic
958813664 3:98892374-98892396 TGCAGAGCACCTTCCAGAGAAGG - Intronic
962197237 3:133374879-133374901 GGCAGAGCCCCCTGGGGAGATGG + Intronic
962755943 3:138465462-138465484 AGCCCAGCACCCCGCAGGGAGGG - Intronic
968235987 3:197030185-197030207 GGCCGAGCGCCCTGGCGAGGGGG + Intergenic
968236014 3:197030269-197030291 GGCCGAGCGCCCTGGCGAGGGGG + Intergenic
968236041 3:197030353-197030375 GGCCGAGCGCCCTGGCGAGGGGG + Intergenic
968236068 3:197030437-197030459 GGCCGAGCGCCCTGGCGAGGGGG + Intergenic
968405478 4:336687-336709 GGACGCGGACCCTGGAGAGATGG - Intergenic
968579307 4:1382560-1382582 GCCCCGGCACCCAGCAGAGATGG - Intronic
968661643 4:1801139-1801161 GGCAGAGCACCCTGGAGGGGAGG + Intronic
968865983 4:3212087-3212109 GCCCGAGCTGCCTGCAGAGCCGG + Exonic
968944567 4:3656827-3656849 GGCAGGACACCCTGCAGGGAGGG + Intergenic
969138812 4:5051709-5051731 GGCCGAGCACCGTGCAGGGGCGG - Exonic
969534479 4:7747451-7747473 GAGCGGCCACCCTGCAGAGAGGG + Intergenic
973720783 4:53721376-53721398 GGCCTAGCAGCCTTCAGAAATGG - Intronic
985732049 5:1554677-1554699 AGCCGCTCACCTTGCAGAGAAGG - Intergenic
985749994 5:1668177-1668199 TGCAGAGCGCCCTGCAGACAGGG - Intergenic
988732329 5:33984673-33984695 GGCCGAGCAACCAACAGAGATGG + Exonic
990330693 5:54722638-54722660 GGCAGAGCAGCATGCTGAGAAGG + Intergenic
992082407 5:73247444-73247466 GGCCGTGCACCCCAGAGAGATGG + Intergenic
993123392 5:83802489-83802511 GGTCCAGCACCCTGGAAAGATGG + Intergenic
996681188 5:126229259-126229281 GGCCAATGACCCTGCAAAGAGGG - Intergenic
997821598 5:137070844-137070866 GACTGAGCTGCCTGCAGAGATGG - Intronic
998200289 5:140113569-140113591 AGCAGAGCCCCCTGCAAAGAGGG - Intronic
1001059265 5:168474642-168474664 GTCATAGCAGCCTGCAGAGAGGG - Intergenic
1001630019 5:173168122-173168144 GGCTGAGCATCCTGTAGATATGG - Intergenic
1005953500 6:30647796-30647818 GGCCACGCCCCCAGCAGAGACGG + Exonic
1014173121 6:118301119-118301141 GACACAGCACCCAGCAGAGAAGG - Intronic
1018428173 6:163701649-163701671 ATACGAGCACCCTGCAGTGAGGG - Intergenic
1018847208 6:167563892-167563914 GGCCTGGCACCCGGCAGGGATGG - Intergenic
1019263043 7:93061-93083 GTACGAGCACCCTGCAGAGCGGG + Intergenic
1019294085 7:264787-264809 GCAAGAGGACCCTGCAGAGAGGG + Intergenic
1020126051 7:5532974-5532996 GGCCGAGCAGCCTGGGGTGAGGG + Intronic
1024695111 7:51847857-51847879 GGTCGAGCATCCTGCAAAGCAGG + Intergenic
1025827745 7:65024326-65024348 GCCCGTGCACCCTGGTGAGAAGG - Intergenic
1025915280 7:65860780-65860802 GCCCGTGCACCCTGGTGAGAAGG - Intergenic
1034522821 7:151633052-151633074 GCCCGTGCACTCTGCAGGGATGG - Intronic
1035525414 8:308737-308759 GGCAGAGAAGCCTTCAGAGAAGG - Intergenic
1037951429 8:23020820-23020842 GGCTGAGCGTCCTGCACAGAAGG + Exonic
1043224068 8:77700878-77700900 GGCCAACGACCCTGCAAAGAGGG - Intergenic
1050693966 9:8259219-8259241 GGCAGAGCACCCAGCTGAGCTGG - Intergenic
1055000816 9:71447115-71447137 GGCCCTGCACTCTCCAGAGAAGG - Intergenic
1056313703 9:85368581-85368603 GGCCCATCAACCAGCAGAGAAGG + Intergenic
1056543199 9:87592156-87592178 GGCCTTGGACCCTGCAGAGCTGG - Intronic
1057176517 9:93004253-93004275 GACCCAGGACCGTGCAGAGAAGG - Intronic
1057200946 9:93139747-93139769 GGCCGAGCAGGCTGGACAGAAGG - Intergenic
1057607844 9:96513759-96513781 GGCCCTGCAGCCTCCAGAGAAGG + Intronic
1057915990 9:99055537-99055559 GGCTGAGGTCCCTGGAGAGAAGG + Intronic
1058538973 9:105992423-105992445 GGCAGAGCACTCTTCAGAGAGGG + Intergenic
1061133803 9:128722224-128722246 GGCGGAGCACCCTGGACTGAGGG + Intronic
1061370499 9:130194951-130194973 GGCTCAGCACCCTGCACACAGGG - Intronic
1061412959 9:130431032-130431054 GCCCCTGGACCCTGCAGAGAGGG + Intronic
1061714660 9:132511172-132511194 GGCAGAGGACCCAGGAGAGAGGG + Intronic
1062008032 9:134251376-134251398 GACCGAGCACCCTGCCAGGACGG - Intergenic
1062158901 9:135069094-135069116 GGAGGAGCAGCCTGGAGAGATGG + Intergenic
1203733608 Un_GL000216v2:114488-114510 GGGCGGGCTCCCTGCACAGAAGG + Intergenic
1186734670 X:12448984-12449006 GGCCAAGCACCCTGGATACAAGG + Intronic
1189254180 X:39624429-39624451 GGCCGAGCTACCTGCTGATAAGG - Intergenic
1197821922 X:130550170-130550192 TTCCAATCACCCTGCAGAGAGGG + Intergenic
1199815001 X:151389261-151389283 GGGAGAGCACCCTGGAGAGGTGG + Intergenic
1201612713 Y:15861081-15861103 TGCCTGCCACCCTGCAGAGAGGG + Intergenic
1202627404 Y:56873930-56873952 GGGCGGGCTCCCTGCACAGAAGG - Intergenic