ID: 932420096

View in Genome Browser
Species Human (GRCh38)
Location 2:71596545-71596567
Sequence TTAAATGCACAGATGCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932420094_932420096 -10 Left 932420094 2:71596532-71596554 CCAGACGGTTTCATTAAATGCAC 0: 1
1: 0
2: 1
3: 4
4: 68
Right 932420096 2:71596545-71596567 TTAAATGCACAGATGCCTCTGGG 0: 1
1: 0
2: 2
3: 13
4: 177
932420092_932420096 17 Left 932420092 2:71596505-71596527 CCGAGCTTGGAGCTGATGGTATC 0: 1
1: 0
2: 0
3: 11
4: 73
Right 932420096 2:71596545-71596567 TTAAATGCACAGATGCCTCTGGG 0: 1
1: 0
2: 2
3: 13
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932420096 Original CRISPR TTAAATGCACAGATGCCTCT GGG Intronic
904226520 1:29025631-29025653 TAACATGCACAGATGTCTGTGGG + Intronic
908757173 1:67479665-67479687 TCAAATGCACACATGCTCCTCGG - Intergenic
909262244 1:73505276-73505298 TTACATGCACATATGCTTGTTGG - Intergenic
910262884 1:85308462-85308484 CTAAATCAAAAGATGCCTCTGGG + Intergenic
918306528 1:183251671-183251693 GTAAATGAACAGATGCCACCAGG + Exonic
918606307 1:186431059-186431081 TTTAAAGCACAGGTGGCTCTTGG + Intergenic
919560815 1:199115990-199116012 TGAAATGTGCAGTTGCCTCTGGG - Intergenic
919851425 1:201675596-201675618 TTAAATGTGCAAATTCCTCTGGG - Intronic
919921401 1:202168570-202168592 GGAAATGGACAGAGGCCTCTGGG - Intergenic
920922162 1:210307104-210307126 GTCAACGCACAGATTCCTCTAGG + Intergenic
924104012 1:240632806-240632828 TTAAATATACACATGCCTGTGGG + Intergenic
924809892 1:247391736-247391758 GGAAATGCACAGATGGGTCTAGG - Intergenic
1063137128 10:3227617-3227639 TTCAATGCACATCTGTCTCTGGG - Intergenic
1063917713 10:10901105-10901127 TTAAATATACAGATCCCTTTTGG - Intergenic
1064703159 10:18043160-18043182 TAAAGTGGACAGATGCCTGTTGG + Exonic
1077394595 11:2314887-2314909 CTAAGTCCACAGAAGCCTCTTGG + Intronic
1081524997 11:43921687-43921709 TCAAATGCACAGCTGCCACACGG - Intergenic
1084112108 11:67021101-67021123 TCAAATGCACAGATGCATTGTGG - Intronic
1085047366 11:73361539-73361561 TCAAATGCACTCATGCCTATGGG - Intronic
1088724257 11:112620502-112620524 TTAAATGCCCAGCTCCCTCCAGG + Intergenic
1089093684 11:115900091-115900113 TTGAATGCACTGGTGACTCTGGG + Intergenic
1094258949 12:28469510-28469532 TTAAATCCACAGATTGCTTTGGG - Intronic
1095936410 12:47687731-47687753 TTAAATGCACTAAAGCCTCTGGG - Intronic
1097799560 12:63898808-63898830 TTGAATGCATAGATACCTTTTGG + Intronic
1099028312 12:77493493-77493515 CTCATTGCACTGATGCCTCTTGG + Intergenic
1099688119 12:85915296-85915318 ATAAATGCCCAAATGCCTGTTGG - Intergenic
1102466278 12:113132611-113132633 ATAGATCCACAAATGCCTCTGGG + Intronic
1102656843 12:114489341-114489363 TTAAATTCCCAGAGGCCTTTGGG - Intergenic
1104310235 12:127648104-127648126 TGAAATGAAAAGATGCGTCTGGG + Intergenic
1104383090 12:128325256-128325278 TTCAATGCCCAGAATCCTCTTGG + Intronic
1105461159 13:20589018-20589040 TGGAATTAACAGATGCCTCTAGG + Intronic
1106124813 13:26891610-26891632 TTAAATGTACAGTTTCTTCTTGG + Intergenic
1106869553 13:34003871-34003893 TTAAATCTACAGATGGATCTTGG + Intergenic
1108729818 13:53223493-53223515 TGAAATGAAAAGATGCCTCTGGG + Intergenic
1108889818 13:55243193-55243215 TTAAATGGCCAGATGCTTCGTGG + Intergenic
1111500019 13:89106456-89106478 TTTAATGAACAGATGTCTCTAGG + Intergenic
1111532238 13:89552944-89552966 CTAAATGCACAGATGCAACTTGG - Intergenic
1112521674 13:100101130-100101152 TAAAAAGCATAGATGCCTCCCGG - Intronic
1112761127 13:102694509-102694531 TTCAATGCACAGCTGTCTTTGGG - Intergenic
1112839707 13:103561186-103561208 TTAAATGCAGAAATGCTTTTGGG - Intergenic
1113256081 13:108507182-108507204 TTAAATACACAGATGCTCCTTGG - Intergenic
1113491594 13:110696777-110696799 TTAATTTCACAGATGCCACAAGG - Intronic
1118079744 14:62344831-62344853 TTAAATACACAGATACTTCCTGG - Intergenic
1118610585 14:67536482-67536504 TTATATGCACAGTTTCCACTGGG - Intronic
1118726971 14:68635716-68635738 TCAAATGCTCAGTTGCCCCTGGG + Intronic
1121836529 14:97097436-97097458 TTTAGTCCACAGAGGCCTCTGGG + Intergenic
1124811642 15:32944906-32944928 GTGAATGCACTGATGTCTCTTGG - Intronic
1126447872 15:48770046-48770068 TTAAATGAACAGATAAATCTGGG - Intronic
1127884252 15:63185502-63185524 TTAAAGGCAAAGCAGCCTCTGGG - Intergenic
1130633302 15:85591773-85591795 TTCAATGAACAGATGCCCCAGGG - Intronic
1131988202 15:98066136-98066158 TTAAAGGCAAAGAGCCCTCTGGG - Intergenic
1133130596 16:3674070-3674092 AAAAAAGAACAGATGCCTCTGGG - Intronic
1133131934 16:3681521-3681543 ATAATTGCCCAGAAGCCTCTTGG - Intronic
1133429385 16:5723468-5723490 TTTAATCCACAGTTGCCTGTGGG - Intergenic
1133429412 16:5723670-5723692 TTTAATCCACAGATTCCTGTGGG - Intergenic
1135397017 16:22139024-22139046 TCACAAGCACAGGTGCCTCTGGG - Intronic
1136873433 16:33828445-33828467 TTCTATGCACAGATGCATTTGGG + Intergenic
1137542681 16:49376041-49376063 TTAAAAGCCCAGATGCTTCTGGG - Intronic
1138879152 16:60989656-60989678 TTAAATACGCAAATGCCTCTTGG - Intergenic
1141254753 16:82390592-82390614 TTAAAGCCACAGACACCTCTTGG + Intergenic
1141361652 16:83400822-83400844 TGAAATGCACTGAAGCCTATGGG + Intronic
1203098742 16_KI270728v1_random:1287610-1287632 TTCTATGCACAGATGCATTTGGG - Intergenic
1145693827 17:26772178-26772200 TTACATGCACATATACCTATAGG - Intergenic
1147559587 17:41500609-41500631 CAAAAAGTACAGATGCCTCTGGG - Intergenic
1147861839 17:43528413-43528435 TGAAACCCACAGATGTCTCTGGG - Exonic
1147879965 17:43647107-43647129 TTAAAGCCGCAGATGCCTCTGGG - Intronic
1148340272 17:46869276-46869298 TTTAAAAAACAGATGCCTCTGGG + Intronic
1149102302 17:52921588-52921610 CTAAATGCACAGAAGCTTTTAGG - Intergenic
1151549296 17:74812718-74812740 TTAAACGCACAGAGACCTGTGGG - Intronic
1151828126 17:76534991-76535013 TTGGAAGCCCAGATGCCTCTGGG - Intronic
1152788208 17:82263234-82263256 TTAAATGCACAGACACCTGGTGG - Intronic
1152802336 17:82336821-82336843 TTACCAGCCCAGATGCCTCTTGG + Intergenic
1153116993 18:1670368-1670390 TAAAATGGACAGATTCATCTTGG + Intergenic
1153905696 18:9659481-9659503 TTAAAAGGACAGATGGCACTGGG + Intergenic
1155230802 18:23773092-23773114 GTAAATGCACACATGACCCTTGG + Intronic
1155639511 18:27997168-27997190 GTAAATGCTGAGAAGCCTCTAGG - Intronic
1156380072 18:36550515-36550537 TTAAATCCACAGATCACTTTGGG + Intronic
1156407477 18:36796740-36796762 TTCCATGCACAGATGGCCCTAGG - Intronic
1156786406 18:40920852-40920874 TTAATTGCACAGATGATTCAAGG - Intergenic
1158213022 18:55071106-55071128 TAATATGCATAAATGCCTCTGGG - Intergenic
1159758166 18:72391333-72391355 TTGCAGGCACAGATGCTTCTTGG + Intergenic
1161163758 19:2774497-2774519 TTAAGTGCACAGATGTCTAATGG + Intronic
1162855852 19:13468020-13468042 TTAAATGTATAAATTCCTCTGGG + Intronic
1166633034 19:44424728-44424750 TTAGATCCACAAATGCTTCTGGG + Intronic
925174494 2:1772552-1772574 ATAAATGAACAGAGGCCTGTGGG + Intergenic
925273885 2:2635520-2635542 GTAAATGCAAAGATGACCCTGGG - Intergenic
925406037 2:3605950-3605972 TTAAAAGCACAAAGGCCACTGGG - Intronic
927129159 2:20042751-20042773 TTAAATGCAGTGAAGCCTCCTGG - Intronic
927413839 2:22856119-22856141 TACAGTGCACAGATACCTCTTGG - Intergenic
929803773 2:45127103-45127125 TTAAAAGCACATAAACCTCTCGG + Intergenic
930096070 2:47568170-47568192 ATATGTGCACAGGTGCCTCTAGG + Intronic
931721998 2:65073326-65073348 TTTTGTGCACAGATGCCTTTAGG + Intronic
931886483 2:66623873-66623895 TTACATGCAAAGATGCATATAGG - Intergenic
932420096 2:71596545-71596567 TTAAATGCACAGATGCCTCTGGG + Intronic
934163657 2:89274967-89274989 TTAAAGACACAGGTGCCGCTGGG - Intergenic
934203615 2:89907557-89907579 TTAAAGACACAGGTGCCGCTGGG + Intergenic
934974814 2:98793891-98793913 TTAAAGACACAGATGCCTAGTGG + Exonic
936287237 2:111190296-111190318 TTTGAGGCAAAGATGCCTCTTGG + Intergenic
937624455 2:124026875-124026897 ATAAATGCACAGGGTCCTCTAGG - Intronic
937666410 2:124492643-124492665 TTAAATATACAGATGACTTTGGG + Intronic
941179287 2:162238476-162238498 TTAAAATCACAGATGAATCTTGG - Intronic
941646920 2:168050511-168050533 TTAAAAGCAGAGAAGCCTCCTGG + Intronic
941949636 2:171140425-171140447 TTAAATCAGCAGATGCCTGTAGG - Intronic
943500944 2:188688980-188689002 TTAAATCCATAAATTCCTCTGGG + Intergenic
945881027 2:215325512-215325534 TTGTATGCAGAGATGCATCTGGG + Intronic
948553167 2:238789268-238789290 TTAAATGCAAAGGTGAGTCTGGG - Intergenic
949018403 2:241726534-241726556 TTGAACACACGGATGCCTCTGGG + Exonic
1171266554 20:23776244-23776266 ATAAATGCACAGCTGCCTGCTGG - Intergenic
1171272341 20:23826735-23826757 ATAAATGCACAGCTGCCTGCTGG - Intergenic
1178410952 21:32363346-32363368 TTAAATGCACACATGTCTCTAGG + Intronic
1179117731 21:38509529-38509551 TTAAATGTAGAGGTGCCTCAGGG + Intronic
1179611789 21:42556692-42556714 TTAGAGGCAGAGGTGCCTCTTGG + Intronic
1183867014 22:40712027-40712049 CTACAGGCACAGTTGCCTCTAGG + Intergenic
1184109928 22:42388675-42388697 TTTCATGCCCAGCTGCCTCTTGG - Intronic
1185178295 22:49344105-49344127 TTAAAGGCAGAGATTCCTCATGG - Intergenic
951430876 3:22605600-22605622 TTGAAGGCATAGATGCCTATGGG + Intergenic
952609401 3:35189551-35189573 TCAGAAGCACTGATGCCTCTGGG - Intergenic
953856067 3:46499894-46499916 TGAAATCCACAAATGCCTATAGG - Intronic
954871231 3:53769034-53769056 TTTAATGTAAAGATGCCTCCTGG + Intronic
960754350 3:120993864-120993886 TTGAATGTACAGATGGCTTTGGG + Intronic
961025903 3:123557207-123557229 TTGAATGCACAGTTGACACTAGG - Intronic
964137766 3:153364607-153364629 TTAAAAGAAAAGATCCCTCTGGG - Intergenic
964448566 3:156786987-156787009 TAAAACTCACAGATCCCTCTGGG - Intergenic
965940421 3:174172884-174172906 TTAAATCCATAGATGGCTGTGGG + Intronic
967266989 3:187699803-187699825 TTACATGCACAGAGGCCACTTGG + Intronic
967543417 3:190695421-190695443 CTAAATGCACAGATGTGTGTGGG - Intergenic
970740954 4:19237061-19237083 TTCACTGCACGGCTGCCTCTGGG - Intergenic
972639802 4:40915123-40915145 TTAAAGGCACAGTGGCCTCCAGG + Intronic
972698283 4:41469079-41469101 GTGGATGCACAGATGACTCTTGG - Intronic
973303866 4:48621072-48621094 TTAAATACACAGATATCTTTGGG + Intronic
975897540 4:79111699-79111721 TTAATTGCACAGATTGCTTTGGG + Intergenic
977242240 4:94586784-94586806 ATTAATCCACAGATCCCTCTTGG - Intronic
977326262 4:95578670-95578692 TCAAATGCACAGATGCACATAGG - Intergenic
981748078 4:148069739-148069761 TTAATTTCCCAGATGCATCTAGG + Intronic
983265989 4:165508549-165508571 AGAAATGCAAAGATGCCGCTGGG + Intergenic
984438918 4:179740728-179740750 TTCAGTGCACAGATGAGTCTTGG + Intergenic
984442852 4:179794567-179794589 TTACATCCACACATGCCTCTGGG + Intergenic
989421605 5:41246278-41246300 GTAAATCAACAGATGCCTCCAGG + Intronic
990259663 5:54008143-54008165 TTAAATGCCAAGAGTCCTCTGGG + Intronic
993234475 5:85286079-85286101 TAAAATGCACACATGCGGCTGGG + Intergenic
995236930 5:109839816-109839838 TTAAATGGGCTGAAGCCTCTAGG - Intronic
995427352 5:112040593-112040615 TTAAATTCACAGAAGCCTTTTGG - Intergenic
996255291 5:121394362-121394384 TTAAATGAAGAAATGCCCCTAGG + Intergenic
996625122 5:125561825-125561847 TTATATACCCAAATGCCTCTGGG - Intergenic
996849905 5:127940235-127940257 ATAAAATCACAGATACCTCTTGG - Intergenic
997635731 5:135403753-135403775 TTAAATTCAGAGATGCCTCTAGG - Intergenic
999142466 5:149371547-149371569 ATGAGTGCACAGACGCCTCTAGG - Intronic
1000189906 5:158900234-158900256 ATACATTCACATATGCCTCTTGG - Intronic
1006960042 6:37919924-37919946 CTAACTGGAGAGATGCCTCTGGG + Intronic
1008347353 6:50443943-50443965 TTAGATGCTGACATGCCTCTAGG + Intergenic
1009599599 6:65781505-65781527 TTAAATGCAAAAATGTCTTTGGG + Intergenic
1009879719 6:69551310-69551332 TTAAACCCACAGATTCCTCAGGG - Intergenic
1010814283 6:80338464-80338486 TTAAATGCACTCAGGCCTCTAGG - Intronic
1012004346 6:93693894-93693916 TGAAAGGCAAAGATGCCACTGGG + Intergenic
1012818892 6:104059653-104059675 TAAAATGAAAATATGCCTCTTGG - Intergenic
1013595719 6:111658843-111658865 TTGAAAGCACATTTGCCTCTTGG + Intergenic
1019192485 6:170260904-170260926 CTATCTGCACAGCTGCCTCTGGG - Intergenic
1020865901 7:13561822-13561844 TTAGATGCAAAGATATCTCTGGG - Intergenic
1025724215 7:64043005-64043027 TAAAACTCACAGATGCCCCTGGG - Intronic
1027473917 7:78606357-78606379 TCATATGCAAAGAGGCCTCTGGG - Intronic
1028129299 7:87151874-87151896 TTAAAAGTACAGATGCTCCTTGG - Intergenic
1029673751 7:102051698-102051720 GTAAATGCATAAATACCTCTGGG + Intronic
1030422212 7:109321723-109321745 TAAAATGTACAGACACCTCTTGG + Intergenic
1032807440 7:135370827-135370849 TTACATGCAGAGAAGCCTCTTGG - Intronic
1032850550 7:135791546-135791568 GGAAATGCACAGATTCATCTAGG - Intergenic
1032919774 7:136532948-136532970 TTAATTCCACAGATTACTCTTGG - Intergenic
1033462355 7:141558587-141558609 TTGAGTGTACAGATACCTCTTGG + Intronic
1033467454 7:141608421-141608443 TCAAATACACACATGCCTCAGGG - Intronic
1038072553 8:24033407-24033429 GAAAAAGCACAGAAGCCTCTGGG - Intergenic
1041868361 8:62603686-62603708 TCAGATGCACAGATGCTTCCAGG - Intronic
1042375490 8:68046438-68046460 TGAATTGCACAGATGGTTCTTGG + Intronic
1044274551 8:90284919-90284941 TCAAATGCCCAGATGCATTTTGG - Intergenic
1045993524 8:108337797-108337819 TGAAATGCACAAATGCCATTAGG - Intronic
1046576730 8:116039309-116039331 CTGAATGGACAGTTGCCTCTTGG - Intergenic
1051730696 9:20139825-20139847 TAAAAAGCACTGATGCTTCTGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053310286 9:37013874-37013896 TCAAATGCACAGATCGCTGTGGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055631181 9:78225437-78225459 TTAAATGGACAGATACATCATGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058792010 9:108457287-108457309 TTTAAAGCATAGATGCTTCTAGG - Intergenic
1187544236 X:20231899-20231921 TTAAAACAACAGATGGCTCTCGG - Intronic
1187616833 X:21004628-21004650 ACAAATGCACAGATACCACTAGG + Intergenic
1189499026 X:41537458-41537480 TTACATGCACAGAGGCCATTGGG + Intronic
1189550149 X:42084525-42084547 TTAAATGCAAAGATTTTTCTAGG - Intergenic
1190710078 X:53061326-53061348 TTAACTGCACAGAAGCAGCTAGG - Intronic
1190828401 X:54039187-54039209 TTAAATCCACAGATACCTAGAGG - Intronic
1195981988 X:110588949-110588971 TAAAATGCACAGAAGCATCAAGG + Intergenic
1197353559 X:125405746-125405768 TTACATGCACATATGCCCTTTGG - Intergenic
1198447538 X:136732852-136732874 TTATAAGTACAGATGCTTCTTGG - Intronic
1199707932 X:150447055-150447077 TTGAATGCACAGATTCCAGTGGG + Intronic