ID: 932420115

View in Genome Browser
Species Human (GRCh38)
Location 2:71596606-71596628
Sequence TTCCATGCACTGGACCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 248}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932420115_932420123 11 Left 932420115 2:71596606-71596628 CCTGCCAGGTCCAGTGCATGGAA 0: 1
1: 0
2: 2
3: 29
4: 248
Right 932420123 2:71596640-71596662 ATGCCAGAGAGGCTCCCACCAGG 0: 1
1: 0
2: 0
3: 17
4: 173
932420115_932420119 0 Left 932420115 2:71596606-71596628 CCTGCCAGGTCCAGTGCATGGAA 0: 1
1: 0
2: 2
3: 29
4: 248
Right 932420119 2:71596629-71596651 AGGAGAGCCCCATGCCAGAGAGG 0: 1
1: 0
2: 1
3: 32
4: 288
932420115_932420126 16 Left 932420115 2:71596606-71596628 CCTGCCAGGTCCAGTGCATGGAA 0: 1
1: 0
2: 2
3: 29
4: 248
Right 932420126 2:71596645-71596667 AGAGAGGCTCCCACCAGGTAGGG 0: 1
1: 0
2: 1
3: 9
4: 157
932420115_932420127 17 Left 932420115 2:71596606-71596628 CCTGCCAGGTCCAGTGCATGGAA 0: 1
1: 0
2: 2
3: 29
4: 248
Right 932420127 2:71596646-71596668 GAGAGGCTCCCACCAGGTAGGGG 0: 1
1: 0
2: 1
3: 8
4: 170
932420115_932420128 20 Left 932420115 2:71596606-71596628 CCTGCCAGGTCCAGTGCATGGAA 0: 1
1: 0
2: 2
3: 29
4: 248
Right 932420128 2:71596649-71596671 AGGCTCCCACCAGGTAGGGGTGG 0: 1
1: 0
2: 1
3: 26
4: 230
932420115_932420129 21 Left 932420115 2:71596606-71596628 CCTGCCAGGTCCAGTGCATGGAA 0: 1
1: 0
2: 2
3: 29
4: 248
Right 932420129 2:71596650-71596672 GGCTCCCACCAGGTAGGGGTGGG 0: 1
1: 0
2: 2
3: 15
4: 210
932420115_932420125 15 Left 932420115 2:71596606-71596628 CCTGCCAGGTCCAGTGCATGGAA 0: 1
1: 0
2: 2
3: 29
4: 248
Right 932420125 2:71596644-71596666 CAGAGAGGCTCCCACCAGGTAGG 0: 1
1: 0
2: 1
3: 23
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932420115 Original CRISPR TTCCATGCACTGGACCTGGC AGG (reversed) Intronic
900098868 1:952513-952535 TTTCATGCAGTGGACCTTGACGG - Exonic
900458825 1:2790416-2790438 GTCCAAGCCCTGGACCTGGTGGG - Intronic
900643916 1:3700152-3700174 GTCCCTGCATTGGGCCTGGCAGG - Intronic
900832509 1:4975317-4975339 TTCCAAGCATCAGACCTGGCTGG + Intergenic
901028484 1:6292013-6292035 CTCCCTGCAAAGGACCTGGCAGG + Intronic
901356268 1:8652154-8652176 AGACATCCACTGGACCTGGCAGG + Intronic
901748610 1:11391753-11391775 CTCCATGCACTGGCCCAGGTAGG + Intergenic
902997461 1:20237923-20237945 GACCATGCACTGGCTCTGGCCGG + Intergenic
904266176 1:29319671-29319693 TTCTCTGCACTGCACCTTGCAGG + Intronic
905837308 1:41137075-41137097 TTCAAAGTACTGGTCCTGGCCGG - Intronic
905839614 1:41163382-41163404 TTCCACTCACTTGGCCTGGCAGG - Intronic
907020401 1:51060900-51060922 TTCCACCCACTCGGCCTGGCAGG - Intergenic
908996701 1:70164102-70164124 TCCCAGCCACTGCACCTGGCCGG - Intronic
911025185 1:93427947-93427969 TTCCACCCACTTGGCCTGGCAGG - Intergenic
913378420 1:118182374-118182396 TTCCATGCAATGGTCAAGGCAGG - Intronic
915184966 1:154097947-154097969 TTCCATCCACTCGGCCTGGCAGG + Intronic
915216225 1:154342418-154342440 TTCCATGCTCTGGAGCTCTCTGG + Intronic
919077003 1:192825861-192825883 TTCCATGCCATGGACCTTGATGG - Intergenic
919409218 1:197222840-197222862 TTATATTCACTGGAGCTGGCAGG + Intergenic
920074299 1:203325543-203325565 TTCGGTGCACTGGGCCTGGCAGG + Intergenic
921097951 1:211902843-211902865 TTCCATCCACTCGGCCTGGCAGG - Intergenic
922141538 1:222893397-222893419 TTCCGCCCACTCGACCTGGCAGG + Intronic
923009865 1:230080146-230080168 TTCCTTGTACTGGCCCTGGAAGG + Intronic
923079608 1:230641277-230641299 TCCCTAGCACTGGACCTAGCAGG - Intergenic
923391502 1:233516982-233517004 TTCCACTCACTTGGCCTGGCAGG - Intergenic
923656373 1:235920709-235920731 TTCCAGTCACTGGACCTGGGAGG - Intergenic
924193438 1:241579556-241579578 TTCCATGCACTTGGCAAGGCAGG + Intronic
924680086 1:246221826-246221848 TTCCACCCACTCGCCCTGGCAGG - Intronic
924862158 1:247936394-247936416 GCCCATGCCCTGGACATGGCAGG + Intergenic
1067018175 10:42772903-42772925 TTCCACTCACTTGGCCTGGCAGG - Intergenic
1068083732 10:52348531-52348553 TTCCACGCACTCAGCCTGGCAGG - Intergenic
1069561627 10:69435037-69435059 TTCCATGTACTTGGCCTGGCAGG + Intergenic
1070568396 10:77621059-77621081 TTCCATGCACGGGGTTTGGCAGG + Intronic
1070660748 10:78303555-78303577 TTCCCTGCACTGCCCCTGGCGGG - Intergenic
1070831324 10:79419770-79419792 TTCCATTCACTAGGCCTTGCAGG + Intronic
1073050030 10:100661424-100661446 CTCTATGCACTGGGCCAGGCTGG + Intergenic
1075071787 10:119324698-119324720 AGCCATGCACTGGCCCTGCCCGG - Intronic
1075427371 10:122352342-122352364 TGCCCTCCACTGGTCCTGGCAGG + Intergenic
1075538625 10:123293851-123293873 GTCCATGCACAGGGGCTGGCTGG + Intergenic
1075844870 10:125537042-125537064 TGCCATGCACAGGGCCTGGTGGG + Intergenic
1076744644 10:132506707-132506729 CTCCAGGCTCTGCACCTGGCAGG + Intergenic
1077287296 11:1773207-1773229 TGCCATGTCCTGGACCTGGAGGG - Intergenic
1077363279 11:2150553-2150575 TTCAGTGCTCTGGACCTGACAGG - Intronic
1078196049 11:9137989-9138011 CTCCATCCCCTGGGCCTGGCAGG - Intronic
1078404447 11:11057691-11057713 TGCCATGCACTGGAGGAGGCTGG + Intergenic
1079183977 11:18220367-18220389 TTCCATTCACTCTGCCTGGCAGG + Intronic
1079997126 11:27305978-27306000 TTCCACCCACTCGGCCTGGCAGG - Intergenic
1080041525 11:27764212-27764234 TTCCCTGCTCTGGACATGGAGGG - Intergenic
1080485872 11:32705611-32705633 TTCCATTCACTTGACCTGGCGGG - Intronic
1081770474 11:45647594-45647616 TTCCAGGCACTGGAAGTGGGTGG + Intergenic
1083590285 11:63889603-63889625 TTGCATCCACTGGGCCTGTCAGG - Intronic
1084200777 11:67556649-67556671 TTCCATGCACTGCAGATGGGAGG - Intergenic
1084615330 11:70231953-70231975 TCCCCTGCCCTGGCCCTGGCCGG + Intergenic
1086001342 11:81989028-81989050 TACCATGCACTAGTTCTGGCTGG - Intergenic
1086268107 11:85027474-85027496 TTCCACCCACTTGGCCTGGCAGG + Intronic
1086377145 11:86213129-86213151 TTCCATGCTGTGGCACTGGCTGG + Intergenic
1088682298 11:112253749-112253771 CTCCATGCACTGGGCCTGGTTGG - Intronic
1089774058 11:120823886-120823908 TTCCCTGCTCTGGCCCTGGAGGG - Intronic
1090447618 11:126777318-126777340 TGCAAAGCACTGGGCCTGGCAGG + Intronic
1096466844 12:51851364-51851386 TGCCAGGCACTTGACCTGCCTGG - Intergenic
1096676737 12:53230360-53230382 TTCCAGGCTCTGGAGCGGGCAGG - Intronic
1096686653 12:53292564-53292586 TTCCCTGCAGTGAAGCTGGCTGG + Exonic
1097078445 12:56412285-56412307 TTCCACCCACTTGGCCTGGCAGG + Intergenic
1097491852 12:60281589-60281611 TTCCATCCACTCGGCCTAGCAGG + Intergenic
1098213858 12:68195069-68195091 CTCTATGCACTGTACCTTGCAGG + Intergenic
1098386127 12:69920683-69920705 TGCCATTCACTGAACATGGCAGG - Intronic
1098837294 12:75438493-75438515 TTCCAGGCACTGGTACTGCCTGG + Intergenic
1102583571 12:113907795-113907817 ATCGATGCTCTGGCCCTGGCTGG - Intronic
1103928862 12:124438441-124438463 GTCCATGCACAGCACCTGGTTGG - Intronic
1105774050 13:23639813-23639835 TTCCAAGCGCTGCACATGGCTGG + Intronic
1106379692 13:29224111-29224133 TTCCACCCACTCAACCTGGCAGG - Intronic
1107841309 13:44459978-44460000 TTCCACCCACTTGGCCTGGCTGG - Intronic
1110778131 13:79433276-79433298 TTCCACCCACTCGGCCTGGCAGG - Intergenic
1111005376 13:82240480-82240502 TTCCACCCACTTGGCCTGGCAGG - Intergenic
1113422013 13:110178171-110178193 TTCCCTGGACTGGACATGCCGGG - Exonic
1113764198 13:112870707-112870729 TTCCATGAACTGCACCTCGCAGG - Intronic
1113829774 13:113286443-113286465 TTTCTAGCACTGGACCTGGGGGG - Intergenic
1116643525 14:47496869-47496891 TTCCATGGACTGGTGTTGGCAGG + Intronic
1119495741 14:75077293-75077315 TTCCAAGCACTGAACCTCTCAGG + Intronic
1121274947 14:92661178-92661200 CTCCATGCACAGCACCTGGCAGG + Intronic
1121921760 14:97888505-97888527 CTCCAGGCACTGGCTCTGGCAGG + Intergenic
1122320185 14:100850993-100851015 TCACATGCACTTGCCCTGGCAGG + Intergenic
1122534477 14:102452590-102452612 GGGCATGCACTGGACCAGGCTGG + Exonic
1123185368 14:106511534-106511556 CACCATGGACTGGACCTGGAGGG - Intergenic
1124001721 15:25765888-25765910 TCCTTTGCACTGCACCTGGCAGG - Intronic
1125771726 15:42172129-42172151 TTCCTTGCCTTGAACCTGGCAGG + Intronic
1127475101 15:59325710-59325732 CTCCATCCACTGGCCCAGGCTGG + Intronic
1128942301 15:71798875-71798897 CTCCATGCACAGGCCCTGACAGG + Intronic
1129591226 15:76916614-76916636 TTCCACCCACTTGGCCTGGCAGG - Intergenic
1130519781 15:84653667-84653689 TTCTATGCATTCGACCTGTCAGG - Exonic
1130738014 15:86570844-86570866 TTCCGCTCACTCGACCTGGCAGG + Intronic
1130988475 15:88860328-88860350 TCCTCTGCACAGGACCTGGCGGG - Exonic
1131930944 15:97440094-97440116 TTCAATGCAGTGGACCTATCTGG - Intergenic
1133248605 16:4465426-4465448 TTAGGTGCACTGGCCCTGGCTGG - Intronic
1133254670 16:4509415-4509437 TTCAATGAACTGGACCAGGCCGG + Exonic
1134230977 16:12430201-12430223 TTCCATGGACTGGGGCTGGGGGG - Intronic
1137238036 16:46631679-46631701 TTTCAAGCAATGGACATGGCAGG + Intergenic
1138190379 16:55009427-55009449 TTCCAGGCACTGAGCCGGGCTGG + Intergenic
1138277763 16:55748594-55748616 AGCCATGGACTGGACCTGGCCGG - Intergenic
1138283656 16:55791661-55791683 AGCCATGGACTGGACCTGGCCGG - Intergenic
1138285346 16:55805326-55805348 AGCCATGGACTGGACCTGGCCGG + Intronic
1140541150 16:75757471-75757493 GTCCATGCCCTGGTCCTTGCAGG - Intronic
1140972726 16:80028996-80029018 TAGCATGCACTGGAGCTGGGTGG - Intergenic
1142120558 16:88384533-88384555 TTCCATGCCATGCGCCTGGCAGG + Intergenic
1142210312 16:88805468-88805490 TTCCATGCCCTGGCCCAGCCCGG + Exonic
1143204811 17:5134161-5134183 TTCCAAGCCCTGGGCCAGGCTGG + Intronic
1143407383 17:6686437-6686459 TGCCATGCTCTGTCCCTGGCTGG + Intronic
1144875858 17:18396839-18396861 TTCCAAGCCCTGGGCCAGGCTGG + Intergenic
1145118265 17:20232143-20232165 GCCCAGGCACTGGCCCTGGCAGG + Intronic
1145156371 17:20547581-20547603 TTCCAAGCCCTGGGCCAGGCTGG - Intergenic
1145233388 17:21191162-21191184 TTCTCTGCCCTGGCCCTGGCTGG - Exonic
1145241205 17:21241907-21241929 CTCCATGCACGGGCGCTGGCTGG - Exonic
1146087078 17:29839312-29839334 TTCCACCCACTCGGCCTGGCAGG - Intronic
1146603377 17:34237427-34237449 TTCCAGGCCCTGGGACTGGCTGG + Intergenic
1148386142 17:47236616-47236638 TTCCACCCACTCGGCCTGGCAGG + Intergenic
1148604129 17:48916075-48916097 GTACATGGACTGGACCTGCCTGG + Exonic
1148845585 17:50527984-50528006 CTCCAAGCACTTGCCCTGGCGGG + Intronic
1149884810 17:60328995-60329017 TTCCATCCACTTGGCCTGGCAGG - Intronic
1151352155 17:73538104-73538126 TTCACTGCACTTGGCCTGGCTGG + Intronic
1151542845 17:74773588-74773610 TGCCATGCAGTGCAGCTGGCAGG - Exonic
1152125170 17:78442348-78442370 TTCCCTGCACTGGCCTTTGCTGG + Intronic
1152921226 17:83067524-83067546 TTCCATGCACTGGACACTGCAGG + Intergenic
1153427833 18:4986740-4986762 TTCCACCCACTTGACCTGGCAGG + Intergenic
1153880613 18:9418642-9418664 TGGCCTGCACAGGACCTGGCAGG - Intergenic
1155158280 18:23176215-23176237 TTCCATGCACTGGGGGTGGGGGG + Intronic
1155684608 18:28533163-28533185 TTCTATAAACTGGACATGGCTGG + Intergenic
1156426774 18:37022106-37022128 TACTTTGCACTTGACCTGGCAGG + Intronic
1156882966 18:42102726-42102748 TTCCTTTCACTGGCCCTAGCAGG - Intergenic
1157921903 18:51721754-51721776 TACCCTGCACTGAAGCTGGCTGG + Intergenic
1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG + Intronic
1159930815 18:74311594-74311616 TTCCACCCACTTGGCCTGGCAGG + Intergenic
1161251065 19:3280609-3280631 CTCCATGCCCTGGAGCTAGCAGG - Intronic
1161980603 19:7628298-7628320 TCCCATTCCCTGGCCCTGGCAGG - Exonic
1162514607 19:11140391-11140413 TTACAGCCACTGCACCTGGCTGG - Intronic
1163861368 19:19744658-19744680 TTGCAAGCCCTGGGCCTGGCTGG + Intergenic
1163965084 19:20738815-20738837 TTCCAAACACTTGATCTGGCTGG + Intronic
1166831817 19:45643806-45643828 GTCCAGGCACCGGACCTGGGAGG - Intronic
926675663 2:15618406-15618428 TTCCACCCACTTGGCCTGGCAGG + Intronic
927743031 2:25589838-25589860 TTCCACCCACTCGGCCTGGCAGG + Intronic
927787044 2:25981581-25981603 TACCATGCAGGGGACCTGGGTGG - Exonic
931697433 2:64881916-64881938 TACCATGCAGTGGACCAGGCGGG + Intergenic
931938128 2:67220753-67220775 TTCCATGCACTTTACCTGTTGGG - Intergenic
932400646 2:71478919-71478941 CTCCAGGCTCTGAACCTGGCAGG + Intronic
932420115 2:71596606-71596628 TTCCATGCACTGGACCTGGCAGG - Intronic
934568421 2:95353234-95353256 TTCCATGCAGAGAACCTGGGTGG + Intronic
934696380 2:96403640-96403662 TTCCACCCACTTGGCCTGGCAGG + Intergenic
934700047 2:96431590-96431612 TTCCAGTCACTCGGCCTGGCAGG - Intergenic
935371378 2:102350614-102350636 TTCCATCCAGTGGCCCTGGGTGG + Intronic
935818281 2:106868312-106868334 TTCCAGGCCCTGCACCTTGCCGG - Intronic
935946791 2:108293998-108294020 TACCATGCACTGGTCTTGGGTGG + Intronic
937163894 2:119794323-119794345 TTCCATCCACTTGGCATGGCAGG + Intronic
937167992 2:119838288-119838310 TTCCGCCCACTTGACCTGGCAGG - Intronic
937228756 2:120384719-120384741 CTCCCTGCACTGGACCAGTCTGG + Intergenic
938078732 2:128357738-128357760 TTCCATTCACTGGGCCTCGGCGG - Intergenic
938084310 2:128388723-128388745 TTCCCCGGACTGCACCTGGCAGG - Intergenic
939802041 2:146721749-146721771 TTCCACCCACTTGGCCTGGCAGG - Intergenic
941404954 2:165075684-165075706 TTCCACCCACTGGGCCTGGCAGG - Intergenic
942986441 2:182148408-182148430 TTGCACTCACTAGACCTGGCAGG + Intronic
943023351 2:182601099-182601121 TTCCACCCACTCGGCCTGGCAGG + Intergenic
945394864 2:209305831-209305853 TTCCACCCACTCGGCCTGGCAGG + Intergenic
947461503 2:230307778-230307800 TTCCACCCACTTGGCCTGGCAGG - Intronic
948940893 2:241195776-241195798 AGACATGCACAGGACCTGGCGGG + Exonic
1169880647 20:10342468-10342490 TTCCACCCACTTGGCCTGGCAGG - Intergenic
1170737310 20:19023061-19023083 GGCCGTGCACTGGACCTGGCTGG - Intergenic
1174672108 20:52318177-52318199 TTCCAGGCACAGGAAGTGGCAGG + Intergenic
1175120782 20:56714851-56714873 TTCCTTGCACTGGACTTGCTGGG + Intergenic
1175455003 20:59105809-59105831 TTCCATGCACAGCTCTTGGCAGG + Intergenic
1176992984 21:15521320-15521342 TTCCACCCACTTGGCCTGGCAGG + Intergenic
1177989186 21:28018178-28018200 TTCCACCCACTCGGCCTGGCAGG + Intergenic
1178790165 21:35692739-35692761 AGCCATCCACTGGACATGGCCGG + Intronic
1178947517 21:36960243-36960265 TTCCACCCACTTGGCCTGGCAGG - Intronic
1179470813 21:41609041-41609063 AGCCATGCTCTGGGCCTGGCTGG - Intergenic
1180638692 22:17280979-17281001 TTCCTGACACTGGTCCTGGCTGG - Intergenic
1182273352 22:29169798-29169820 TTCCCAGCACTGGACCAGGTCGG - Intergenic
949552193 3:5120763-5120785 ATCCATGCATTGGTTCTGGCTGG + Intergenic
950411941 3:12844317-12844339 CTCCATGCCCAGGGCCTGGCTGG + Intronic
950994624 3:17481353-17481375 TTCCATCCACTTGGCTTGGCAGG - Intronic
951252484 3:20410175-20410197 TTGCATCCCCTGGGCCTGGCAGG + Intergenic
951562283 3:23981227-23981249 TTCCACCCACTTGGCCTGGCAGG + Intergenic
954132012 3:48565646-48565668 TGCGATGAACTGGCCCTGGCAGG + Exonic
954415368 3:50390844-50390866 TTCCAAGCACTGAACTTGGATGG - Intronic
957775725 3:84755983-84756005 TTCCACCCACTCGGCCTGGCAGG + Intergenic
958141632 3:89570498-89570520 TTCCATCTACTTGGCCTGGCAGG + Intergenic
958531006 3:95330162-95330184 TTCCATGCACTTGGCAAGGCAGG + Intergenic
958675416 3:97264198-97264220 TTCCATCCACTCAGCCTGGCTGG + Intronic
960590059 3:119357000-119357022 TCTCATGCACTGCAACTGGCAGG - Intronic
960942562 3:122944139-122944161 TGCCAGGCACTGGACTTGGGAGG - Intronic
962197664 3:133378001-133378023 TTCCATGGACTGGAGTTGGTCGG - Intronic
963534912 3:146514957-146514979 GTACAAGCACTGGAACTGGCTGG - Intergenic
965395370 3:168155169-168155191 TTCTATGCTCTGAACCTGGTGGG + Intergenic
965813237 3:172613337-172613359 TTCCACCCACTTGGCCTGGCAGG + Intergenic
967182315 3:186916667-186916689 TTCCATTCACAGCACCTGCCAGG + Intergenic
967693637 3:192506121-192506143 GACCATGCACTGGCTCTGGCTGG - Intronic
968219754 3:196927904-196927926 TTCCATCCCCTGGACATGCCTGG - Intronic
968632377 4:1658731-1658753 TTCCACGCACTGGCCCGTGCAGG + Intronic
968838190 4:2980837-2980859 TTCCACCCACTTGGCCTGGCAGG + Intronic
968943829 4:3653390-3653412 TCCCATGGCCTGGCCCTGGCCGG + Intergenic
969872177 4:10111452-10111474 TTCCTGGCTCTGCACCTGGCAGG + Intronic
970077187 4:12236872-12236894 TCCCAGGCACCGGACCTGTCAGG - Intergenic
971336634 4:25729210-25729232 AACCATGCACTGGTTCTGGCTGG + Intergenic
971877259 4:32323281-32323303 TGCCAGGCAGTGGCCCTGGCTGG - Intergenic
972828435 4:42787358-42787380 TTGCATCCACTGCACCTTGCAGG - Intergenic
974420287 4:61663591-61663613 TTCCTCCCACTTGACCTGGCAGG - Intronic
975221060 4:71813681-71813703 TTCCACCCACTCGACCTGGCAGG + Intergenic
975321471 4:73012978-73013000 TTCCACCCACTTGGCCTGGCAGG - Intergenic
978149219 4:105414391-105414413 TTCCACCCACTCGGCCTGGCAGG + Intronic
978219575 4:106255303-106255325 TTCCATCCACTTGGACTGGCAGG + Intronic
982227013 4:153175533-153175555 TTCCATGGACAGGGCCTGGGTGG + Intronic
982611204 4:157575640-157575662 TTCCACCCACTCGGCCTGGCAGG - Intergenic
985916391 5:2921921-2921943 TTCCACCCACTCGGCCTGGCAGG - Intergenic
986316781 5:6594516-6594538 GACCATGAACTGGTCCTGGCTGG + Intergenic
987999722 5:25331969-25331991 TTCCACCCACTTGGCCTGGCAGG - Intergenic
989339310 5:40355488-40355510 TTCCACCCACTTGGCCTGGCAGG - Intergenic
995146152 5:108788410-108788432 TTCCATCCACTCAGCCTGGCAGG - Intronic
996856943 5:128019014-128019036 TTCTATGAACTGGACATGGTAGG - Intergenic
998351507 5:141504950-141504972 TTCAATGCATTGGACCAGCCTGG + Intronic
999126774 5:149251712-149251734 TTCCCTCCACTGGGGCTGGCAGG - Intronic
1000865505 5:166509265-166509287 TGCCTTGCCCTGGACCTGGCAGG - Intergenic
1002072276 5:176687369-176687391 TTCCACCCACTCGGCCTGGCAGG + Intergenic
1003147802 6:3523451-3523473 TTCCTTCCAATGGATCTGGCAGG - Intergenic
1006779651 6:36623648-36623670 TTCCAGGCCTTGGACCTGTCAGG + Intergenic
1007723641 6:43900988-43901010 TTCCAGGCACTGGAACATGCAGG - Intergenic
1008473367 6:51909356-51909378 TCCCTTCAACTGGACCTGGCTGG + Exonic
1012122502 6:95385251-95385273 TTCCACCCACTTGGCCTGGCAGG - Intergenic
1018520114 6:164639781-164639803 TTTCATGCTCTGGTCCTTGCGGG + Intergenic
1019047537 6:169160376-169160398 TTCCAGGCCCTGCACCTGACGGG + Intergenic
1021159549 7:17255206-17255228 TTAGATGCACTGGTCCTGGAAGG + Intergenic
1025848334 7:65220098-65220120 TTCCAATCCCTGGATCTGGCTGG - Intergenic
1026824035 7:73570263-73570285 TTCCACCCACTGGGCCTGGGAGG + Exonic
1027270111 7:76514331-76514353 TTCCCTGCACAGGCCCTGGGAGG - Intronic
1027779699 7:82506788-82506810 TTCCACCCACTCGGCCTGGCAGG + Intergenic
1028596181 7:92547804-92547826 TTCCATCCACTCGGCCTGGCAGG - Intergenic
1031334750 7:120514692-120514714 TTCCATGGACAGGAGCTGGTGGG + Intronic
1033541044 7:142356340-142356362 ACCCATGCCCTGCACCTGGCAGG - Intergenic
1034478054 7:151300119-151300141 TCCCATGGCCTGGACCTCGCTGG + Intergenic
1036824457 8:11965463-11965485 CTCCCTGCTCTGTACCTGGCAGG - Intergenic
1038286584 8:26211079-26211101 TTCCAACCACTGCTCCTGGCAGG + Intergenic
1038550245 8:28461258-28461280 TTCCAAGCACTGGAACTGCTGGG + Intronic
1038801735 8:30755401-30755423 TACCATGGACTGCACCTGGCTGG + Intronic
1039825303 8:41168471-41168493 TTACAGGCACTGCACCCGGCTGG + Intergenic
1040068856 8:43172936-43172958 AACCAAGCACTGGACCTGGCTGG - Intronic
1041164009 8:55073248-55073270 ATCCATGCAGTGGATCTGGCAGG - Intergenic
1042207138 8:66340613-66340635 TTCACTGTTCTGGACCTGGCTGG + Intergenic
1043087030 8:75848562-75848584 TTCCACTCACTTGGCCTGGCAGG + Intergenic
1043666961 8:82826347-82826369 TTCCACCAACTTGACCTGGCAGG - Intergenic
1043695392 8:83209753-83209775 TTCCATCCACTTGTCCTGGCAGG - Intergenic
1044142942 8:88676439-88676461 TTCCGGGAACTGGTCCTGGCAGG - Intergenic
1044529369 8:93290350-93290372 TGCCAAGCACTGTACCAGGCGGG + Intergenic
1045961007 8:107968284-107968306 ATCCATGCACTGGAAATGACAGG - Intronic
1049096494 8:140551314-140551336 TTCCGTGCACTGGCGCTGGGGGG + Exonic
1049418007 8:142504332-142504354 CTCCAGGCCCTGGTCCTGGCTGG - Intronic
1050476482 9:6046148-6046170 TTCCATGCACTTGGCAAGGCAGG + Intergenic
1052552405 9:29968901-29968923 TTCCACCCACTTGGCCTGGCAGG + Intergenic
1052629727 9:31021868-31021890 TTACATGCACTGGACCTCCCAGG - Intergenic
1052652244 9:31320569-31320591 TTCCACCCACTTGGCCTGGCAGG + Intergenic
1053428912 9:38028957-38028979 GTCCATGCCCTGGCCCTGGAGGG - Intronic
1053619034 9:39797845-39797867 TTCCACCCACTCGGCCTGGCAGG + Intergenic
1054265122 9:62909584-62909606 TTCCACCCACTCGGCCTGGCAGG - Intergenic
1055022715 9:71687309-71687331 TTCCATGGACTGGAGGTGGAGGG - Intronic
1056404799 9:86263276-86263298 TTCCATGGCCTGGACTAGGCTGG - Intergenic
1056757067 9:89388579-89388601 TTCCATGCCCTGGGCCTTGAAGG + Intronic
1056840698 9:89996218-89996240 TTTCATCCCCTGGAACTGGCTGG + Intergenic
1056867061 9:90237351-90237373 GACCATGGACTGGCCCTGGCTGG + Intergenic
1057566109 9:96167361-96167383 TTCCTTTCAGAGGACCTGGCTGG + Intergenic
1058077833 9:100668345-100668367 TTCCACCCACTCGGCCTGGCAGG - Intergenic
1058855681 9:109059460-109059482 TCCTATACACTGGATCTGGCAGG - Intronic
1059019996 9:110566035-110566057 TGTCAGCCACTGGACCTGGCCGG - Intronic
1060196177 9:121625002-121625024 ATCCATGCCCTGGACGGGGCAGG - Intronic
1060727879 9:126017765-126017787 ACCCATGCCCTGGTCCTGGCTGG + Intergenic
1061000695 9:127900675-127900697 TTACAGCCACTGGGCCTGGCTGG - Intronic
1061883865 9:133581684-133581706 TTCCAGGCACTGGAGCTGGCCGG + Intronic
1062431307 9:136527948-136527970 TTCCATGGAGCGGCCCTGGCAGG - Intronic
1189393567 X:40599634-40599656 TTATATTCACTGGAGCTGGCAGG + Exonic
1189785537 X:44555826-44555848 TACCATGCAGTGGTTCTGGCCGG + Intergenic
1194512665 X:94814707-94814729 TTACAGACACTTGACCTGGCAGG - Intergenic
1195178396 X:102333250-102333272 TTCCACCCACTCGACCTGGCAGG + Intergenic
1195180468 X:102353833-102353855 TTCCACCCACTCGACCTGGCAGG - Intergenic
1197501124 X:127243751-127243773 TTCCACCCACCTGACCTGGCAGG + Intergenic
1197609408 X:128622353-128622375 CTCCACCCACTTGACCTGGCAGG + Intergenic
1197610738 X:128635446-128635468 TTCCAAGCACTGTACTGGGCCGG - Intergenic