ID: 932421009

View in Genome Browser
Species Human (GRCh38)
Location 2:71601366-71601388
Sequence CTCTATTCCTTGAGGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932421009_932421013 -9 Left 932421009 2:71601366-71601388 CCTTCTACCCTCAAGGAATAGAG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 932421013 2:71601380-71601402 GGAATAGAGGCTGCAAACCATGG 0: 1
1: 0
2: 1
3: 13
4: 163
932421009_932421015 30 Left 932421009 2:71601366-71601388 CCTTCTACCCTCAAGGAATAGAG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 932421015 2:71601419-71601441 CATAGTCCATGAGTGTCATGAGG 0: 1
1: 0
2: 0
3: 4
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932421009 Original CRISPR CTCTATTCCTTGAGGGTAGA AGG (reversed) Intronic
900321872 1:2088484-2088506 CTCGAGTCCTTGAGTGAAGACGG + Intronic
901977044 1:12953350-12953372 CTCGTTTCCTTGAAAGTAGAAGG + Intronic
902008125 1:13248420-13248442 CTCGTTTCCTTGAAAGTAGAAGG - Intergenic
904252238 1:29233346-29233368 CTATAATCCTTGAGAGAAGAAGG - Intergenic
905311241 1:37050524-37050546 CTCATTGCCTTGAGGGCAGAGGG - Intergenic
907707190 1:56842734-56842756 CTCTTTTCCTCCAGGATAGAGGG + Intergenic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
909210919 1:72822204-72822226 CTCTCATCCTTCAGGGTTGATGG - Intergenic
911745252 1:101434811-101434833 TTCTCTTCCTTGAGGAGAGAAGG - Intergenic
915941181 1:160119453-160119475 CTCTATTTCCTGAGGGAAGTGGG + Intronic
916456519 1:164976595-164976617 CTCCATTTCTTGTGGCTAGACGG + Intergenic
917213559 1:172655525-172655547 CTCTATGCCTGGAGGATAGCAGG + Intergenic
917415721 1:174807454-174807476 GTCTATCCCTTGATTGTAGAGGG + Intronic
918253540 1:182726306-182726328 CTCTACTCCTAGAGGAAAGAGGG - Intergenic
919938605 1:202271310-202271332 CTCTAGTCCTCTAGGGTAGGGGG - Intronic
920283553 1:204862242-204862264 CTTTATCCTATGAGGGTAGATGG - Intronic
922542613 1:226430359-226430381 CTCTGTTCCTTGACCATAGATGG + Intergenic
924024481 1:239818141-239818163 CTCTCTTCCTGGATTGTAGATGG + Intronic
1064554843 10:16538014-16538036 CTCTCTTCCTGGTGTGTAGATGG - Intergenic
1067562537 10:47314044-47314066 CTCTTTTGCTTGTGTGTAGAAGG + Intergenic
1070339576 10:75484780-75484802 CTCTTTTCCTGGATTGTAGACGG - Intronic
1070664260 10:78332363-78332385 CTCTGTTACTTGAAGGCAGACGG + Intergenic
1074969680 10:118525860-118525882 CTCTATTTCTGAAGGGAAGAAGG + Intergenic
1088840833 11:113626411-113626433 CTCTAGTTCTGGAGGCTAGAAGG + Intergenic
1088850223 11:113698113-113698135 CTCTTTTCCTGGATTGTAGATGG - Intronic
1096712309 12:53466324-53466346 CTCTTTTCCATGAGGGTAATGGG + Intronic
1097136536 12:56861630-56861652 CTCTCTTCCTTGCTTGTAGATGG + Intergenic
1099396678 12:82148311-82148333 GTCTACTACTTGAGGGTGGAAGG - Intergenic
1099610115 12:84857460-84857482 GTCTTTTCCTTCAGGGCAGAAGG + Intergenic
1102356280 12:112238823-112238845 CTGTACTCCTTCAGGGTACAGGG + Intronic
1107372981 13:39772465-39772487 CTCCATTGTTTGAGGGTTGAGGG + Intronic
1109859983 13:68184714-68184736 CCCCATTCCTTGAGTCTAGATGG - Intergenic
1115383723 14:32770798-32770820 CTCAACTCCTTGAGGGTAAAAGG + Intronic
1126247666 15:46527993-46528015 CTCTCTCCCTTAGGGGTAGAAGG + Intergenic
1128674887 15:69601233-69601255 TTCAGTTCCTTGAGGGCAGAGGG + Intergenic
1129623650 15:77173904-77173926 ATTTATCCATTGAGGGTAGAGGG + Intronic
1131439092 15:92445077-92445099 CTCCATTCCTTGAGAGATGAGGG + Intronic
1131832883 15:96365605-96365627 CTCTATTCCTTTACTGTGGACGG - Intergenic
1134648871 16:15892551-15892573 ATTTCTTCCTTGAGGGTAGCAGG - Intergenic
1135151246 16:20008162-20008184 CTCTATTCCTTGAGTTTCAAAGG - Intergenic
1137626088 16:49909686-49909708 CTCTCTTCCTTGTTGGCAGATGG + Intergenic
1137906075 16:52323233-52323255 TTCTATTCCTTGTAGGTAGGGGG + Intergenic
1138700220 16:58854901-58854923 CTCTTTGGCTTGGGGGTAGAAGG + Intergenic
1138903591 16:61303391-61303413 CTCTCTTCCTGGCTGGTAGATGG - Intergenic
1141272583 16:82554695-82554717 CTCTATTCATTGTGGGTCTAGGG + Intergenic
1148261650 17:46189325-46189347 TTCCATTCCTTGAGTTTAGAGGG - Intronic
1158703492 18:59770467-59770489 CTGTAGTCCTTGAAGGGAGAAGG + Intergenic
1165890103 19:39106845-39106867 CTGTCTTCCTTGAGGGCAGCAGG + Intronic
925166593 2:1719418-1719440 CTGTGTGCCTTGAGGGTACATGG + Intronic
930454301 2:51585355-51585377 ATTTATTCCTTGAGGCAAGATGG - Intergenic
932421009 2:71601366-71601388 CTCTATTCCTTGAGGGTAGAAGG - Intronic
933593078 2:84254538-84254560 AAGTCTTCCTTGAGGGTAGAGGG - Intergenic
936656203 2:114490431-114490453 CTAATTTCCTTGAGGGAAGAAGG + Intronic
937893107 2:126955280-126955302 CTCTATTCCTTCTGGTTTGAGGG - Intergenic
937972571 2:127561916-127561938 CTCTCTTCCTGGCTGGTAGATGG + Intronic
941600673 2:167539945-167539967 CTCTATTCCTTCAGGAGAAAAGG + Intergenic
1170016030 20:11783231-11783253 CTCATTTCCTTCAGGGTAAAAGG - Intergenic
1170630243 20:18058811-18058833 CTTTATGCCTGGAGGGGAGAGGG + Intronic
1171014914 20:21531316-21531338 CTATTTTCCCTGAGGGAAGATGG + Intergenic
1174317155 20:49712682-49712704 CTCCTAGCCTTGAGGGTAGATGG - Intronic
1174897669 20:54468157-54468179 CTCCATTCCTTTAAGGTAAAGGG - Intergenic
1176937932 21:14888085-14888107 CTCTATTCCTGCAGAGTTGATGG - Intergenic
1177847127 21:26302716-26302738 GTCTATTGCTTGACGATAGAGGG + Intergenic
1181362042 22:22344870-22344892 TTCTTTTCCCTGAGGGCAGAAGG + Intergenic
1182058820 22:27382205-27382227 CTGGATTCCTTTAGGGTAGAAGG + Intergenic
951586761 3:24222632-24222654 CCAAATTCCTTGAGGGCAGAAGG - Intronic
954845054 3:53548053-53548075 CTCTACTCCTTGATGGAAGTGGG - Intronic
959596399 3:108133618-108133640 TTCTAATCCATGAGGGTAGAGGG - Intergenic
959837437 3:110936652-110936674 TGCTATTCCTTGAGGTAAGATGG + Intergenic
960139660 3:114139842-114139864 GTCAGGTCCTTGAGGGTAGAAGG + Intronic
962678871 3:137778270-137778292 CACTATCTCTTGAGGGTAGAGGG + Intergenic
963486115 3:145936096-145936118 CTTTACTACTTGAGAGTAGATGG - Intergenic
964965107 3:162482316-162482338 TTCTACTCCTTGAGGAAAGAAGG - Intergenic
965350883 3:167609953-167609975 CTCTTTTCCTTCAGGGTAGTGGG - Intronic
965514031 3:169601426-169601448 CTCTATTCCTTGTGGGAATGAGG - Intronic
966646155 3:182248108-182248130 CTCTCTGCCTTTAGGGTAGAGGG - Intergenic
966778298 3:183562042-183562064 CACTACTTGTTGAGGGTAGACGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969269501 4:6089596-6089618 CTCTGTTCCTTTGGGGCAGAGGG - Intronic
971540961 4:27815821-27815843 TTCTACTGTTTGAGGGTAGAAGG - Intergenic
973811184 4:54571775-54571797 CTGTATTCCCTGACGCTAGAAGG - Intergenic
977608213 4:99004224-99004246 CTTCATTCCTTCAGGGTATATGG + Intronic
978086416 4:104661233-104661255 CTCTTTTACTTCAGGGTAAAAGG + Intergenic
981849021 4:149206015-149206037 CTGTATTCCTCGAGCTTAGACGG - Intergenic
983511800 4:168616883-168616905 CTCTATTACTTGAGGCATGAGGG - Intronic
986800792 5:11257955-11257977 CTCTATTCCCCGATGGAAGAGGG - Intronic
988365173 5:30289282-30289304 CTCCATTCCCTGAGGATAGAGGG + Intergenic
988583976 5:32493037-32493059 CTCTTCTCCTTCTGGGTAGATGG - Intergenic
988657081 5:33224097-33224119 GTCTGTTACTTGAGGATAGATGG - Intergenic
991277464 5:64866467-64866489 CTCTAGTTTTTTAGGGTAGAAGG + Intronic
991403463 5:66278015-66278037 CACTATTCTCAGAGGGTAGAAGG + Intergenic
992409926 5:76495420-76495442 CTCAGTTCCTGGAGGGCAGAGGG + Intronic
998232311 5:140368573-140368595 CTCTGTTCCCTGTGGGGAGAGGG - Exonic
1003819105 6:9876147-9876169 CTCTCTTTGTTGCGGGTAGATGG - Intronic
1004417229 6:15436164-15436186 CTCCCTTCCTTGAGGACAGAGGG + Intronic
1004516640 6:16327070-16327092 CTTTTGTCGTTGAGGGTAGAAGG + Exonic
1004889318 6:20084025-20084047 CTATAATACTTAAGGGTAGAAGG - Intergenic
1006583120 6:35088005-35088027 CTCTGTTCTGTGAGGGAAGAAGG - Intronic
1007707379 6:43799140-43799162 CTCTCTTCCTAGAGGATAGGAGG + Intergenic
1009316947 6:62231475-62231497 CTCTAATCCCCAAGGGTAGAGGG - Intronic
1009642912 6:66361566-66361588 CTCTTTTCCTGGATTGTAGATGG + Intergenic
1010761562 6:79729054-79729076 CTCTATTCCATGGAGGTAGGTGG - Intergenic
1017984576 6:159432393-159432415 CTCTATCTCTTGATGGAAGAGGG + Intergenic
1018161438 6:161047537-161047559 AACTATGCCTTGAGTGTAGAGGG + Intronic
1018299418 6:162385177-162385199 CTCAATTCCTTGAGGGAATGGGG - Intronic
1022184453 7:27953646-27953668 CTATATTCTTTGGGGGTGGAGGG + Intronic
1023531784 7:41164484-41164506 CTCTGTTCTTTAAGTGTAGAGGG - Intergenic
1030675906 7:112385035-112385057 CCCAATTCCCTGAGGGTAGGAGG + Intergenic
1031424768 7:121592167-121592189 CTCTCTTCATTGCTGGTAGATGG + Intergenic
1031608925 7:123801949-123801971 TTTTGTTCCTAGAGGGTAGAGGG + Intergenic
1032327009 7:130938456-130938478 CTCTGTCCTTTGAGGGTAGGAGG - Intergenic
1035006834 7:155669817-155669839 CTCTATTTCTTCAGGTGAGAGGG + Intronic
1035717800 8:1767081-1767103 CTCTCAGCCATGAGGGTAGAAGG - Intronic
1038329743 8:26598714-26598736 CTCTGTTCCTTGTGGGTGGATGG + Intronic
1038975779 8:32694110-32694132 TTCTTTTCACTGAGGGTAGATGG + Intronic
1040387592 8:46924075-46924097 CTCTCCTCCTTTAGGGAAGATGG - Intergenic
1040530507 8:48262911-48262933 CCCTATTCCTTGAAGGTGAAGGG + Intergenic
1042546178 8:69953719-69953741 CTCTCTTCCTAAAGGTTAGAGGG - Intergenic
1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG + Intronic
1042813561 8:72852980-72853002 CTCTTTTTCTGGAGGGGAGAGGG + Intronic
1045370013 8:101513898-101513920 ATCTATTCCTTGAAGGTTGCTGG + Intronic
1047610699 8:126518035-126518057 TTCAATTCCTTGTGGGTAAAGGG + Intergenic
1048384941 8:133903441-133903463 CTCTATTCTATGAGGACAGATGG + Intergenic
1048533105 8:135268616-135268638 CTCTCTTCCTGGATTGTAGATGG - Intergenic
1048946002 8:139447912-139447934 CTCTCTTCCTAGATTGTAGATGG + Intergenic
1051580402 9:18667121-18667143 CTGAATTCCTTGAGGGAAGGGGG - Intronic
1051706136 9:19882098-19882120 CTCTATTTCCTTGGGGTAGAGGG + Intergenic
1051960424 9:22754490-22754512 CTATATTCTTTTAAGGTAGATGG + Intergenic
1052358913 9:27533280-27533302 TTCTATGCCAGGAGGGTAGAGGG - Intergenic
1053185814 9:36015397-36015419 GTCTGTTCCTTGAGTGTAGAAGG - Intergenic
1055182977 9:73412184-73412206 CTCTCTTCCTTGATTGCAGATGG - Intergenic
1055762996 9:79629901-79629923 CTCTGTCCCTTGAGCGTAGATGG + Intronic
1055774803 9:79755642-79755664 GTCAATTCTCTGAGGGTAGAAGG + Intergenic
1056316735 9:85397548-85397570 CTCTTTTTCTTGAGGGGAAAGGG - Intergenic
1056549564 9:87640787-87640809 TTCTCTTCCTTGAGGGGAGGGGG - Exonic
1057287924 9:93775266-93775288 CTCTCTTCCTTGCTTGTAGATGG - Intergenic
1059782041 9:117539857-117539879 CTATATTCCCTGAGGATAAATGG + Intergenic
1186755697 X:12669239-12669261 CTCAGTTCCTTGTGGGTAGTTGG - Intronic
1186851160 X:13581355-13581377 CTCTGTTTCTTGATGGTAGATGG + Intronic
1186929040 X:14367855-14367877 CTCTCTTCCTGGATGGCAGATGG - Intergenic
1188134345 X:26475750-26475772 CTCAGTTCATTGAGGGTATATGG + Intergenic
1191670626 X:63745267-63745289 CTCTGGGCCCTGAGGGTAGATGG + Intronic
1193184434 X:78495607-78495629 CTTCACTCCTTGAGGGTAAATGG - Intergenic
1194196068 X:90894148-90894170 CTCTATTACTTGTGGGTGGAAGG - Intergenic
1195977795 X:110546477-110546499 CTCTTTTCCTTGCTAGTAGATGG - Intergenic
1196345043 X:114645088-114645110 CTCTATTGTTTGAGGGCAGGGGG + Intronic
1197595286 X:128456713-128456735 GTCTAGTCCTTGAGGATAAAGGG + Intergenic
1198632998 X:138663019-138663041 CTCTAGACTTTGAGGGTGGAGGG - Intronic
1199365881 X:146982174-146982196 CTGTATTATTTGAAGGTAGATGG - Intergenic
1200308563 X:155053979-155054001 AGCTATTCCAGGAGGGTAGAGGG + Intronic
1200541912 Y:4468329-4468351 CTCTATTACTTGTGGGTGGAAGG - Intergenic
1202593248 Y:26509721-26509743 CTCTATTCCTTGATATTACATGG - Intergenic