ID: 932421205

View in Genome Browser
Species Human (GRCh38)
Location 2:71602528-71602550
Sequence ATGTCAGTGCAGAGGGACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 146}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932421205_932421214 13 Left 932421205 2:71602528-71602550 CCAGCGTCCCTCTGCACTGACAT 0: 1
1: 0
2: 0
3: 17
4: 146
Right 932421214 2:71602564-71602586 TTTCCCAGGGACCACTTTAGGGG 0: 1
1: 0
2: 0
3: 14
4: 122
932421205_932421219 23 Left 932421205 2:71602528-71602550 CCAGCGTCCCTCTGCACTGACAT 0: 1
1: 0
2: 0
3: 17
4: 146
Right 932421219 2:71602574-71602596 ACCACTTTAGGGGCGTGGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 63
932421205_932421208 -1 Left 932421205 2:71602528-71602550 CCAGCGTCCCTCTGCACTGACAT 0: 1
1: 0
2: 0
3: 17
4: 146
Right 932421208 2:71602550-71602572 TCCATCACACCTTCTTTCCCAGG 0: 1
1: 0
2: 3
3: 26
4: 259
932421205_932421213 12 Left 932421205 2:71602528-71602550 CCAGCGTCCCTCTGCACTGACAT 0: 1
1: 0
2: 0
3: 17
4: 146
Right 932421213 2:71602563-71602585 CTTTCCCAGGGACCACTTTAGGG 0: 1
1: 0
2: 2
3: 20
4: 153
932421205_932421217 18 Left 932421205 2:71602528-71602550 CCAGCGTCCCTCTGCACTGACAT 0: 1
1: 0
2: 0
3: 17
4: 146
Right 932421217 2:71602569-71602591 CAGGGACCACTTTAGGGGCGTGG 0: 1
1: 0
2: 1
3: 9
4: 134
932421205_932421210 0 Left 932421205 2:71602528-71602550 CCAGCGTCCCTCTGCACTGACAT 0: 1
1: 0
2: 0
3: 17
4: 146
Right 932421210 2:71602551-71602573 CCATCACACCTTCTTTCCCAGGG 0: 1
1: 0
2: 0
3: 22
4: 256
932421205_932421218 22 Left 932421205 2:71602528-71602550 CCAGCGTCCCTCTGCACTGACAT 0: 1
1: 0
2: 0
3: 17
4: 146
Right 932421218 2:71602573-71602595 GACCACTTTAGGGGCGTGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 56
932421205_932421212 11 Left 932421205 2:71602528-71602550 CCAGCGTCCCTCTGCACTGACAT 0: 1
1: 0
2: 0
3: 17
4: 146
Right 932421212 2:71602562-71602584 TCTTTCCCAGGGACCACTTTAGG 0: 1
1: 0
2: 3
3: 24
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932421205 Original CRISPR ATGTCAGTGCAGAGGGACGC TGG (reversed) Intronic
900139297 1:1132812-1132834 AGGTTAGGGCAGAGGGACACGGG - Intergenic
901182735 1:7352690-7352712 CTGTGAGTGCAGAGGGCCTCTGG + Intronic
901353443 1:8620278-8620300 ACATCAGTGCAGTGGGACCCAGG + Intronic
904804041 1:33118503-33118525 CTGTGACTGCAGAGGGAGGCAGG + Intronic
908229211 1:62087183-62087205 CTGTCAGTGGAGAGGGGAGCTGG + Intronic
913597543 1:120393273-120393295 AGGTCAGTGAAGAGGGTCCCAGG - Intergenic
914089787 1:144486041-144486063 AGGTCAGTGAAGAGGGTCCCAGG + Intergenic
914308823 1:146448175-146448197 AGGTCAGTGAAGAGGGTCCCAGG - Intergenic
914512504 1:148346315-148346337 AGGTCAGTGAAGAGGGTCCCAGG + Intergenic
914593285 1:149124956-149124978 AGGTCAGTGAAGAGGGTCCCAGG + Intergenic
916660435 1:166918518-166918540 ATCAGAGTGCAGAGGGAGGCAGG + Exonic
918311849 1:183290755-183290777 ACCTCACTGCAGAGGGAGGCAGG - Intronic
918524117 1:185446550-185446572 TTGTCAGTGAAGAGGGTGGCTGG + Intergenic
919978163 1:202626241-202626263 ATGCCACTGCAGAGGGAGGGTGG - Intronic
922097511 1:222454962-222454984 GTGTCAGTACAGAGGAACGTCGG + Intergenic
1067644840 10:48088249-48088271 ATGTCTGTACAGAGGGATGAGGG - Intergenic
1070150818 10:73803806-73803828 AAGTCTGTGCTGAGGGAAGCTGG + Intronic
1070282196 10:75058093-75058115 ATATAAGTGCAGAGGGAGGTGGG - Intronic
1070476830 10:76837006-76837028 AAGTCAGTGCAGAAGAAAGCAGG + Intergenic
1073523014 10:104152471-104152493 ATGAGACTGGAGAGGGACGCAGG + Intronic
1073910508 10:108337674-108337696 ATGTCAGTTCAGCTGGACGAGGG - Intergenic
1074544044 10:114388613-114388635 GTCTCAGTGCAGAGGTAGGCTGG - Intronic
1075465386 10:122646930-122646952 ATGTCAATGCAGTGGAATGCAGG + Intergenic
1077028596 11:452802-452824 AAGTCAGTGCAGGTGGACTCAGG - Intronic
1077351146 11:2093737-2093759 ATGTCAGAGGAGAGGGCCACGGG + Intergenic
1077706990 11:4496364-4496386 ATGTCAGTGCTGCAGGACTCTGG - Intergenic
1078434860 11:11315953-11315975 ATGTCAGTACAGAGTGATGCGGG - Intronic
1079109130 11:17594238-17594260 AGGTCAGGGAAGAGGGATGCTGG + Intronic
1080811885 11:35712651-35712673 CTGTCAGTGCAGAGAGGAGCTGG - Intronic
1083278294 11:61609969-61609991 GTGACAGTGCAGAGGGATGGGGG + Intergenic
1084334057 11:68446661-68446683 TTGGCAGAGCAGAGGGAGGCAGG - Intronic
1084679829 11:70660498-70660520 ATGCCAGTGCCCAGGGACACTGG - Intronic
1085053571 11:73391902-73391924 ATGTCTGGGCACAGGGACGTGGG - Intronic
1085267659 11:75246775-75246797 GTGACAGTGCTGAGGGAAGCAGG - Intergenic
1088355730 11:108942071-108942093 ATGTGAGAGCAGAGGGACAGTGG - Intergenic
1089670738 11:120055209-120055231 GTGTCAATGCAGAGGGAATCAGG - Intergenic
1090356907 11:126146560-126146582 AGGTCTGTGCAGAGGGATGAGGG - Intergenic
1090936186 11:131344684-131344706 ATGACAGTGGAGAGAGACCCTGG + Intergenic
1091306296 11:134538400-134538422 ATGGCAGGGCAGAGGGAGGCAGG + Intergenic
1094644590 12:32310046-32310068 ATGACAGTGTAGAGGGGCACAGG + Intronic
1098542635 12:71674776-71674798 ATGTAAGTTCAGAGGGAGGCAGG + Intronic
1101345346 12:103880964-103880986 GTGTCAGTGCTTAGGGATGCGGG - Intergenic
1103500967 12:121401062-121401084 ATCTCAGTGCAGAGGTGTGCTGG + Intronic
1103980897 12:124736362-124736384 ATGGCAGGGCAGAGGGGAGCTGG - Intergenic
1104339026 12:127930045-127930067 CTCTCAGTGGAGAGGGAAGCTGG - Intergenic
1104951446 12:132442415-132442437 CTGGGAGTGCAGAGGAACGCGGG - Intergenic
1105296396 13:19090794-19090816 ATGGCAGTCCAGAGGGACATTGG - Intergenic
1108595401 13:51944644-51944666 ATGGCAGTGGACAGGGAGGCAGG - Intronic
1110841569 13:80149786-80149808 ATGGCATTGCAGATGGACTCTGG - Intergenic
1113226591 13:108166759-108166781 AAGTCAGTGCCGTGGGATGCAGG - Intergenic
1113697178 13:112354774-112354796 ATCTGAGGGCACAGGGACGCCGG + Intergenic
1113792594 13:113037064-113037086 ATCTCAGTGCAGAGAGGGGCTGG + Intronic
1116402219 14:44521760-44521782 ATGGCAGTGTAGAGGCAAGCTGG - Intergenic
1118240035 14:64047168-64047190 CTCTCAGTGGAGAGGGAAGCTGG + Intronic
1119530292 14:75355301-75355323 ATGACAGTGTAGAGTGACTCAGG + Intergenic
1119959086 14:78834348-78834370 ATTTCAAGGCAGAGGGACCCAGG - Intronic
1123634187 15:22286897-22286919 ACATCAGTGCAGTGGGACCCAGG - Intergenic
1124237455 15:28002728-28002750 ATGTAAGAGCAGAGGAAAGCAGG - Intronic
1124334740 15:28848396-28848418 GTGTCACTCCAGAGGCACGCAGG - Intergenic
1128357255 15:66936777-66936799 TGAGCAGTGCAGAGGGACGCTGG - Intergenic
1134095140 16:11414076-11414098 ATTGCAGGGCAGAAGGACGCAGG + Intronic
1134147334 16:11776443-11776465 ATGTCAGAGCTGAGGTAAGCTGG - Exonic
1138295286 16:55880188-55880210 CTGTCAGTGCAAGGGGAGGCTGG - Intronic
1138974791 16:62191247-62191269 CTGTCAGTGCAGAAGAACACAGG + Intergenic
1140453464 16:75090156-75090178 ATGTGAGTGCAGAGGGACTTAGG + Intronic
1140550096 16:75856275-75856297 CTCTCAGTGGAGAGGGAAGCTGG - Intergenic
1144847352 17:18226762-18226784 ACATCAGTGCAGAGGGAGGCGGG - Intronic
1146917743 17:36688971-36688993 ATGTCACTGCATCGGGACGGTGG + Intergenic
1150225369 17:63521922-63521944 ATGTCAGTGCAGAGGGGCTGGGG - Intergenic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1155978070 18:32153241-32153263 ATGACAGTGTAGAGGTAAGCTGG - Intronic
1156226644 18:35116324-35116346 ATGAGACTGCAGAGGGAAGCGGG + Intronic
1156911638 18:42417541-42417563 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
1165907189 19:39201240-39201262 AGGTCAGTTCAGAAGGACCCCGG - Exonic
1167569249 19:50276704-50276726 ATTTCAGAGCAGAGGAAGGCAGG - Intronic
925222497 2:2153431-2153453 GTGTGTGTGCAGAGGGACTCTGG - Intronic
925744024 2:7029688-7029710 ATGCCAGGGCAGAGGGACTCTGG + Intronic
927682586 2:25149745-25149767 AAGTCAGGGCAAAGGGACTCTGG + Intronic
929763715 2:44826795-44826817 ATGCCAGTGCTGAGGGCCGCTGG + Intergenic
932421205 2:71602528-71602550 ATGTCAGTGCAGAGGGACGCTGG - Intronic
933989378 2:87622897-87622919 ATGTCAGGGCAGAGGGCACCAGG + Intergenic
934048708 2:88192121-88192143 ACTCCAGTGCAGAGGGACTCTGG + Intergenic
934159214 2:89232168-89232190 ATGGCAGTGTAGAGGCAGGCAGG - Intergenic
934169439 2:89327331-89327353 ATGGCAGTGCAGAGGCAGGCAGG - Intergenic
934197855 2:89855254-89855276 ATGGCAGTGCAGAGGCAGGCAGG + Intergenic
934208059 2:89950257-89950279 ATGGCAGTGTAGAGGCAGGCAGG + Intergenic
935147218 2:100404029-100404051 TTGCCAGTGCACAAGGACGCTGG - Intronic
936141990 2:109948462-109948484 AAGACAGTGGAGAGGGAGGCAGG + Intergenic
936178677 2:110246410-110246432 AAGACAGTGGAGAGGGAGGCAGG + Intergenic
936202701 2:110423022-110423044 AAGACAGTGGAGAGGGAGGCAGG - Intronic
936304464 2:111327929-111327951 ATGTCAGGGCAGAGGGCACCAGG - Intergenic
936723619 2:115285177-115285199 ATGTCACTGTAGAGAGACGTAGG - Intronic
943568231 2:189542193-189542215 GTCTCAGTGCAGAGAGAGGCAGG - Intergenic
943675390 2:190711669-190711691 ATGGCAGTGCAGAGAGATGGAGG - Intergenic
944143988 2:196486386-196486408 ATGTCAGTGAACAGGGAGGGTGG + Intronic
947263565 2:228251926-228251948 ATGGCAGTGCAGTGGGATGGTGG + Intergenic
948663577 2:239521169-239521191 ATGTCTGTCCACAGGGACCCTGG + Intergenic
948777391 2:240296803-240296825 GTGTCAGTGCAGAGGACCGGGGG + Intergenic
1170293749 20:14801242-14801264 CTGTCACTGCTGAGGGGCGCAGG - Intronic
1170432672 20:16290811-16290833 ATGTCAGGGAAGAGGGAGGTAGG + Intronic
1171079065 20:22159551-22159573 ATTTCAGAGCAAAGGAACGCTGG + Intergenic
1176024534 20:62978919-62978941 ATGGCAGTGCCCAGGGACGGGGG + Intergenic
1176226573 20:64003497-64003519 ATGTGAGTGCACAGGGTCGGGGG - Intronic
1179251742 21:39676383-39676405 TTGTCAGTGCAGATGGAGACTGG + Intergenic
1179583991 21:42363480-42363502 ATGTCATTGGAGAAGGAAGCTGG - Intronic
1181593435 22:23898072-23898094 ATGGCAGTGGATAGGGAGGCAGG + Intronic
1183084985 22:35481163-35481185 AGGTGAGGGCAGAGGGAGGCAGG + Intergenic
1183640352 22:39088939-39088961 AAGGCAGGGCAGAGGGACCCTGG - Intergenic
1184241439 22:43213024-43213046 AGGCCAGAGCAGAGGGAGGCGGG + Intronic
1184794911 22:46726552-46726574 ATGTCATTGCAGGGGGAATCAGG - Intronic
949563909 3:5227963-5227985 CTGTGAGTGCTGAGAGACGCTGG - Intergenic
954898378 3:53996860-53996882 CAGTCACTGCTGAGGGACGCTGG - Intergenic
957665359 3:83218616-83218638 ATGTCATGGCAGCAGGACGCAGG - Intergenic
962844796 3:139264745-139264767 AGGTAAGTGGAGAGGGAAGCAGG - Intronic
963045196 3:141097167-141097189 ATGTAAGGGCAGAGGGACATTGG - Intronic
963049594 3:141129614-141129636 CTGTCATTTCAGAGAGACGCTGG + Intronic
963718557 3:148833287-148833309 ATGTCAGGGCAATGGGAGGCAGG - Intronic
965615554 3:170588427-170588449 ATGTCAGTGGAGAGGTAGGCAGG - Intronic
967990509 3:195126804-195126826 AGGTCAGAGCAGAGGGCCCCTGG - Intronic
968762884 4:2451438-2451460 AGCTCAGTGGAGAGGGACTCGGG + Intronic
969428300 4:7138575-7138597 ATGTGTGGGCAGAGGGACACAGG - Intergenic
970444876 4:16115230-16115252 AAGGCAATGCAGAGGGAGGCTGG + Intergenic
981258968 4:142696632-142696654 ATGGCAAGGCAGAGGGACGCAGG - Intronic
981772600 4:148327573-148327595 AGGTCATTGCAGAGGGACTTTGG - Intronic
984582071 4:181521682-181521704 ATGGCAGTGCTGAGGGAGGAAGG - Intergenic
985425759 4:189828653-189828675 ATGGCAGGGCAGAGGGAGCCTGG - Intergenic
986190467 5:5492219-5492241 CTTTCAGTGCAGAGGTAAGCAGG + Intergenic
986393590 5:7306406-7306428 ATGTCACTCCAGAGGCACACGGG - Intergenic
986772841 5:10989163-10989185 CTGCCAGTGCAGAGGGGCACTGG + Intronic
988603586 5:32661651-32661673 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
999499615 5:152133616-152133638 AGGTCATGGCAGAGGGACACTGG - Intergenic
1003692121 6:8365148-8365170 ATCTCTGTGCAGAGGGAGGATGG - Intergenic
1009412957 6:63387721-63387743 ATGCCACTGCAGTGGGACCCTGG - Intergenic
1014634467 6:123828141-123828163 ATGTGAGTGCAGAGGAAGGATGG - Intronic
1018055428 6:160048147-160048169 CTGTCAGTGCAGAGGCACGGGGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019061666 6:169261866-169261888 ATCTCAGGGAAGAGGGAGGCCGG - Intergenic
1020748658 7:12111729-12111751 GCGTCAGGGCAGAGGGAGGCGGG + Intergenic
1023582982 7:41701317-41701339 AGGTCAGGGAAGAGGGACTCAGG + Intronic
1023955881 7:44886042-44886064 ACGGCAGTGCAGAGGCACCCAGG + Intergenic
1024692101 7:51814263-51814285 ATGTGAGGGCAGAGGGACACAGG + Intergenic
1032347953 7:131134318-131134340 CTGTCAGTGGAGAAGGACCCTGG - Intronic
1035468210 7:159093561-159093583 CTGTCAGTGCAGAGCAGCGCTGG + Intronic
1035861642 8:3035085-3035107 ATGTCAGCACAGAGGTACTCAGG - Intronic
1037670664 8:21012687-21012709 ATGTCACAGAAGAGGGAAGCAGG - Intergenic
1038033250 8:23663165-23663187 TTGTCAGAGCTGAGGGTCGCTGG - Intergenic
1045317132 8:101052864-101052886 ATGGCAGGGCAGAGGGAGGATGG - Intergenic
1049988719 9:973527-973549 ATGTCAGTGCAGGCAGACGCTGG - Intergenic
1053020292 9:34689793-34689815 ATGACCGTGCAGAGGGAGCCCGG - Exonic
1056250273 9:84740569-84740591 ATGTGACTGCAGAGGTGCGCAGG + Intronic
1056885439 9:90438794-90438816 ATGTCTGTGCAGGGGAAAGCTGG - Intergenic
1057003414 9:91533867-91533889 TTGTCATTGCAGAGGGGCGAGGG + Intergenic
1057263333 9:93598383-93598405 ATGGCAGTCCAGAGGGACATTGG + Intronic
1057270142 9:93645955-93645977 ATGTCATCTCAGTGGGACGCAGG - Intronic
1058935718 9:109767639-109767661 ATGTCAGGGCAGAGGGAGCGAGG - Intronic
1060456662 9:123804951-123804973 AAGTGAGTGCAGAGGTATGCTGG - Intronic
1061257987 9:129463886-129463908 ATGGCAGTGAAGAGGGAAGCTGG - Intergenic
1061866462 9:133494028-133494050 AGGTCAGGGCAGAGGGGCACAGG + Intergenic
1061959435 9:133980446-133980468 GTGTCAGGGCAGAGGGGCCCTGG + Intronic
1195932941 X:110096967-110096989 AAGTCAGTGCAGAAGGACTCTGG + Intronic
1197077655 X:122372784-122372806 ATTTCAGTGAAGAGTGACACTGG + Intergenic
1197299919 X:124765603-124765625 ATAACAGTGAAGAGGGAAGCAGG - Intronic
1202305573 Y:23466573-23466595 ACATCAGTGCAGTGGGACCCAGG - Intergenic
1202565236 Y:26204016-26204038 ACATCAGTGCAGTGGGACCCAGG + Intergenic