ID: 932421741

View in Genome Browser
Species Human (GRCh38)
Location 2:71605436-71605458
Sequence TCGTGGGTCCCTGAATGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932421741 Original CRISPR TCGTGGGTCCCTGAATGCCC AGG Intronic
900505561 1:3028462-3028484 TCGTGAGTCCCAGAAAGCCTGGG - Intergenic
901873153 1:12150343-12150365 GTATGGGTCCCTGAATGCACAGG - Intergenic
907272497 1:53299059-53299081 TCGTGGGTTCTTGAATCCCTCGG - Intronic
909066934 1:70946647-70946669 TGGTGGGTCCATGAACACCCAGG - Intronic
915563547 1:156701365-156701387 TCTTCAGTCCCAGAATGCCCAGG + Intronic
915744630 1:158146442-158146464 CCGTCAGTTCCTGAATGCCCAGG + Intergenic
917392016 1:174547482-174547504 TAGTGTGTGCCTGTATGCCCAGG + Intronic
917895388 1:179482308-179482330 TCATGGGTCCCTGATTGTCTGGG - Intronic
919654370 1:200182994-200183016 CCTTGGGTCCCTGAATGGCCTGG + Intergenic
922208371 1:223468581-223468603 TGGTGGGACCCTGTCTGCCCTGG + Intergenic
1067913718 10:50374214-50374236 TTGTGGTTCACTGAATGCCCAGG - Intronic
1076401809 10:130189902-130189924 TCCTGGGTCCCAGAGTGCCCTGG + Intergenic
1078633884 11:13030894-13030916 TATTGGCTCCCTGAATGGCCGGG - Intergenic
1078895334 11:15592331-15592353 GCGTGGCTTCCAGAATGCCCTGG + Intergenic
1081523655 11:43907778-43907800 TCATGAGTCTCTGCATGCCCTGG - Intronic
1082060364 11:47854952-47854974 TTGAGGGGCCCTGAAAGCCCAGG + Intergenic
1084437935 11:69155051-69155073 TCCTGTGGCCCAGAATGCCCTGG + Intergenic
1086238241 11:84658242-84658264 TCGTGGGTCCCTGATTATCATGG + Intronic
1089082221 11:115786341-115786363 GCATGGTTCCCTGAAAGCCCAGG + Intergenic
1089164949 11:116468676-116468698 TCCTGTGTCCCTGATGGCCCAGG + Intergenic
1091409105 12:227599-227621 TCTTGGGTGCCTGACAGCCCTGG - Exonic
1092898952 12:13040580-13040602 GCCTGGGTCCCTGAATGGCTGGG + Intergenic
1093367343 12:18320168-18320190 GAGTGGGTCCCTTAATGCCTAGG - Intronic
1096366003 12:51028815-51028837 TCGTGGATCACTGATTGACCAGG - Intergenic
1096843231 12:54391400-54391422 TCGCGGAGCCCTGAGTGCCCGGG - Intergenic
1098295450 12:68999542-68999564 TCTTTGCTCCCTGAATGCTCTGG + Intergenic
1101546295 12:105716610-105716632 TTGTGGGGCCCTGTAAGCCCAGG + Intergenic
1102956811 12:117064217-117064239 TCATGTGTACGTGAATGCCCTGG - Intronic
1103684008 12:122716971-122716993 TGGTGGGTTCCTGTATGCCCAGG - Intergenic
1104195835 12:126537000-126537022 TTGTGGATGCCTGAATGCCTGGG + Intergenic
1107083975 13:36405687-36405709 TCCTTGGTCCCTGAATAACCAGG - Intergenic
1115396073 14:32909726-32909748 ACATGGGTCCCTGATTCCCCTGG - Intergenic
1116705714 14:48296025-48296047 TAGTGCTTCCCTGAATGACCTGG + Intergenic
1132313577 15:100875129-100875151 ACGTGGGTCCCTGATGGCCCTGG - Intergenic
1132604212 16:787006-787028 CGGTGGGTCCCTGCCTGCCCAGG + Intronic
1132625188 16:888209-888231 CCGTGGGTCCCTGCCCGCCCAGG + Intronic
1133370223 16:5240760-5240782 ACGTGGGCCCCTGAGTGACCGGG + Intergenic
1133746089 16:8687754-8687776 TGCTGGCTCCCTGAGTGCCCGGG + Intronic
1135673042 16:24391143-24391165 TCGTGGGTGCCTGTAGTCCCAGG + Intergenic
1135985382 16:27180034-27180056 TCGGGGGTCACAGAAAGCCCAGG - Intergenic
1136024467 16:27460987-27461009 TCCTGGCTCCTTGAGTGCCCAGG - Exonic
1138588916 16:57988805-57988827 CTGTGGGTCCCTGAAGCCCCAGG - Intergenic
1139361689 16:66403528-66403550 TCTAGGGTCCCTGAACGCCCTGG + Exonic
1140357560 16:74319329-74319351 TCACGGGTCCCTGCATGACCTGG + Intergenic
1140473957 16:75229372-75229394 TCCTGGTGCCCTGGATGCCCAGG - Exonic
1140586131 16:76294189-76294211 TTGTGGGTCCCTGAATAGCAGGG - Intronic
1142683193 17:1562229-1562251 CCGTGGGCCCCTCCATGCCCCGG + Intronic
1144678494 17:17176958-17176980 TGGTGTGGCCCTGAGTGCCCAGG - Intronic
1145825994 17:27877723-27877745 CCGTGGGCCCCTGCATGACCGGG + Intronic
1146655562 17:34632748-34632770 TCGAGGGTCCATGAACGCCAGGG + Exonic
1147403438 17:40194442-40194464 TCGTGCTGCCCTGCATGCCCAGG + Exonic
1148737499 17:49873094-49873116 TGGTGGGTCCCTGACACCCCTGG - Intergenic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150310980 17:64129635-64129657 TTGGGGGTCCCAGAAGGCCCCGG - Intronic
1151665031 17:75540879-75540901 TCATGGGTCGCTGAATGTCCTGG - Intronic
1151712510 17:75814839-75814861 TTGTGGCTCCCTTAATGCCCAGG + Intronic
1152084251 17:78207928-78207950 GGGTCTGTCCCTGAATGCCCCGG + Intergenic
1161594848 19:5146003-5146025 TCGAGTGTCACTGAGTGCCCAGG + Intronic
1161995300 19:7707882-7707904 TCCTGGGTCCCTGAAGGGCTGGG - Intergenic
1164061735 19:21681247-21681269 TGGTGGGTGCCTGTATTCCCAGG + Intergenic
1165258414 19:34593906-34593928 TTGTGGTTCCCTGCATGCCTAGG + Intronic
1167892274 19:52550096-52550118 TCGTGGGATCCTTCATGCCCAGG + Intronic
1167912020 19:52711481-52711503 TCGTGGGATCCTTCATGCCCAGG - Intronic
926192376 2:10738522-10738544 CCGTGGGTCCCTGAAGGACCGGG - Intronic
927293218 2:21424561-21424583 TCAGGGGTGGCTGAATGCCCTGG - Intergenic
932347298 2:71004082-71004104 TCGGGGGTCCCTCCATGCCTTGG + Intergenic
932421741 2:71605436-71605458 TCGTGGGTCCCTGAATGCCCAGG + Intronic
933112711 2:78424267-78424289 CCATGGGTTCCTGAATGCTCTGG + Intergenic
933420753 2:82042889-82042911 TCCTGGGCCCCTGACTGCACAGG - Intergenic
934762529 2:96864483-96864505 CCATGGGTACCAGAATGCCCTGG + Intronic
938079140 2:128360031-128360053 CCGTGGGACCCTGAGTGTCCAGG + Intergenic
939017737 2:136920986-136921008 TCCTGGGCCCCTGAGAGCCCAGG + Intronic
947728377 2:232414975-232414997 TCTTGGGTCGCTCACTGCCCAGG + Intergenic
948134824 2:235628575-235628597 TGGTGGGTCCTTGAATGCTCTGG + Intronic
948860809 2:240751799-240751821 CCATGGGTCCATGGATGCCCCGG + Intronic
1172081559 20:32345121-32345143 ACGAGGCTCCCAGAATGCCCTGG - Intergenic
1173421132 20:42902074-42902096 TCCTGGTTTCCTGCATGCCCTGG - Intronic
1175499332 20:59438792-59438814 TCATGTCTTCCTGAATGCCCTGG + Intergenic
1177387438 21:20426031-20426053 TCCTGGCTGCCTGAATGGCCGGG - Intergenic
1180159055 21:45990975-45990997 CAGGGGGTCCTTGAATGCCCTGG - Exonic
1181059769 22:20276752-20276774 TCGCTGGTCCCTGAGTGCCAAGG + Intronic
1182796176 22:32993246-32993268 TGTTGGGTCCCTGGATCCCCGGG - Intronic
1184648383 22:45908280-45908302 CACTGGGTCCCTGCATGCCCGGG + Intergenic
1185020899 22:48374411-48374433 CTGTGGGTGCCTGAATGCCATGG - Intergenic
1185120902 22:48969378-48969400 CCGTGGGGCCCTGAGTGCCTGGG + Intergenic
949903895 3:8842634-8842656 TCATGTGTACCTGAATCCCCTGG + Intronic
950430038 3:12945282-12945304 TCCTGGGTTCCTGGCTGCCCTGG + Intronic
961611155 3:128140947-128140969 TCATGTGTCCCTTAATGCCAGGG - Intronic
962251555 3:133839091-133839113 GCGTGGGGCTGTGAATGCCCTGG - Intronic
963068679 3:141284213-141284235 ACCTGGGGCCCTGAATGACCAGG - Intronic
967850153 3:194076263-194076285 TCAGGGGTTCCTGACTGCCCTGG - Intergenic
974432475 4:61816858-61816880 TCCTGGGTCCCTGAGAGCTCAGG - Intronic
976409484 4:84696756-84696778 TCGTGGGTCCCCTTTTGCCCAGG + Exonic
978566716 4:110090506-110090528 TCTTGTGTTCCTGCATGCCCAGG - Intronic
982089645 4:151869244-151869266 TCTTGGGTTCCTAACTGCCCTGG + Intergenic
982149545 4:152437834-152437856 TCGTGACTCCCTGAAGGCTCAGG + Intronic
982707669 4:158727690-158727712 TGGTGGTTCCCTGAAGACCCAGG + Intergenic
983542302 4:168924975-168924997 TTGTGGCTCCCTGAATGAGCAGG - Exonic
989014518 5:36914156-36914178 TTGTGAGTGCCTGAATGACCTGG - Intronic
995827033 5:116312042-116312064 TGGTGGGCCCCTGCAGGCCCAGG - Intronic
996955498 5:129178606-129178628 TGCTGGATCCCTGAATGCCCAGG - Intergenic
997585558 5:135041003-135041025 TCGTGGGTCTCTGCGTTCCCAGG - Intronic
999237359 5:150106875-150106897 TCGTGGCTCCCTGAGTTTCCTGG + Intronic
999634834 5:153610891-153610913 TCGTGTGTCTCTCAAAGCCCTGG + Intronic
999660339 5:153856092-153856114 TCATGGTTCCCTGTTTGCCCTGG + Intergenic
1001845514 5:174917837-174917859 TCGGGGGGCTCTGAAAGCCCAGG - Intergenic
1002579859 5:180201318-180201340 CCGTAGGTCCTTGAATGTCCAGG - Intronic
1005988406 6:30888829-30888851 TCATGGGTCCCTGAGGGCCAGGG + Intronic
1007343173 6:41206560-41206582 TCGTGGGTGCCTGTAATCCCAGG + Intergenic
1015566443 6:134576883-134576905 TTGTGGGTCCATGAATCCCTGGG + Intergenic
1019621797 7:1996142-1996164 CCGGGGGACCCTGCATGCCCAGG - Intronic
1021053020 7:16012768-16012790 TCGTGGGTACCTGGAGTCCCAGG - Intergenic
1029465471 7:100721915-100721937 TCAAGGGTCCCTGAAGGCTCTGG - Intronic
1031126032 7:117774371-117774393 TCAGGGGTCCCTGAACCCCCGGG + Intronic
1033509987 7:142050939-142050961 GCATGGGTCCCTGAAGGACCAGG + Intronic
1034676303 7:152894962-152894984 AAGTGGGTCCCCGAATGCCCTGG + Intergenic
1037848530 8:22306468-22306490 TTGTGGGGCCCTGAGTGTCCTGG + Intronic
1038380604 8:27089648-27089670 TGTTAGGTCCCTGAATGTCCTGG + Intergenic
1041101393 8:54399334-54399356 ACGTGGGACCGTGAAAGCCCAGG + Intergenic
1041107139 8:54454539-54454561 CCGTGGGCCCCTGAGTGACCAGG - Intergenic
1044386984 8:91600563-91600585 TCATGGGTCCCTTAATGACAGGG + Intergenic
1046054975 8:109068496-109068518 TCGTGGGTCTCATAATGCTCAGG - Intergenic
1046676117 8:117110558-117110580 TCATGTGCCCCTGCATGCCCTGG - Intronic
1048543205 8:135361853-135361875 ACCTGGGTGCCTGAATGACCTGG + Intergenic
1049037978 8:140091435-140091457 TCTTGGGACTCTGAAAGCCCTGG - Intronic
1049435784 8:142585648-142585670 TTCTGGGTCCCCAAATGCCCCGG + Intergenic
1049849505 8:144823258-144823280 TCGTGGGTCTCTGTATGGCATGG + Intergenic
1057953280 9:99386721-99386743 TCGTGGGTCCTTTAATTTCCAGG - Intergenic
1060148045 9:121268567-121268589 TGGTGGTCCCCTGCATGCCCGGG - Intronic
1060602402 9:124886948-124886970 TCGAGGGGACCTGAATGCCCAGG + Intronic
1062131034 9:134893255-134893277 GCGAGGGGCCCTGAGTGCCCAGG - Intergenic
1062294842 9:135818945-135818967 TGGTGGGTCCCTGGCGGCCCCGG - Intronic
1062524449 9:136972601-136972623 TCGTGGATCCCAGAGTGGCCCGG - Intergenic
1185639453 X:1578871-1578893 TAATGGGTGCTTGAATGCCCTGG - Intergenic
1188032058 X:25275172-25275194 GCCTGGGTCACTGAATGGCCTGG - Intergenic
1198810348 X:140529924-140529946 TCATGGGTCACTTAATGACCAGG + Intergenic
1199811542 X:151354753-151354775 TTGAGAGTCTCTGAATGCCCTGG + Intergenic