ID: 932428599

View in Genome Browser
Species Human (GRCh38)
Location 2:71659709-71659731
Sequence TCATTGCCTGAGATGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932428589_932428599 29 Left 932428589 2:71659657-71659679 CCCTTCCTTACATTTTGTGCCCA 0: 1
1: 0
2: 2
3: 29
4: 378
Right 932428599 2:71659709-71659731 TCATTGCCTGAGATGGAGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 209
932428593_932428599 9 Left 932428593 2:71659677-71659699 CCAAGATAAGTGCGTGAGCTGTC 0: 1
1: 0
2: 0
3: 4
4: 31
Right 932428599 2:71659709-71659731 TCATTGCCTGAGATGGAGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 209
932428592_932428599 10 Left 932428592 2:71659676-71659698 CCCAAGATAAGTGCGTGAGCTGT 0: 1
1: 0
2: 1
3: 37
4: 467
Right 932428599 2:71659709-71659731 TCATTGCCTGAGATGGAGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 209
932428591_932428599 24 Left 932428591 2:71659662-71659684 CCTTACATTTTGTGCCCAAGATA 0: 1
1: 1
2: 5
3: 32
4: 204
Right 932428599 2:71659709-71659731 TCATTGCCTGAGATGGAGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 209
932428590_932428599 28 Left 932428590 2:71659658-71659680 CCTTCCTTACATTTTGTGCCCAA 0: 1
1: 1
2: 4
3: 17
4: 428
Right 932428599 2:71659709-71659731 TCATTGCCTGAGATGGAGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932428599 Original CRISPR TCATTGCCTGAGATGGAGAG GGG Intronic
901401454 1:9017757-9017779 CCATTGCCTGAGAGCGAGTGGGG - Intronic
902640907 1:17765541-17765563 ACATAGCCTGCCATGGAGAGGGG - Intronic
902827786 1:18988931-18988953 TCACTTCCTCATATGGAGAGTGG + Intergenic
903136082 1:21310132-21310154 ACATTGCCTCAGAGGGAGGGAGG + Intronic
903325687 1:22567392-22567414 ACATTGCCTGAGAGGGAGGGAGG + Intronic
905585776 1:39116825-39116847 TCATTATCTGACATGGATAGTGG + Intronic
905870769 1:41403297-41403319 GCAGTGACAGAGATGGAGAGAGG - Intergenic
907616342 1:55930546-55930568 CCATTCCCTAAGATGGAGAAGGG + Intergenic
908393907 1:63707682-63707704 TCATTGCCTGAGAAGGGCAGAGG + Intergenic
910675578 1:89813111-89813133 GCAGTGCCTGCGCTGGAGAGAGG - Intronic
912570269 1:110616252-110616274 TCACTTCCTGAGATGATGAGGGG + Intronic
915137477 1:153743337-153743359 TCATGGGCTGAGATGGGAAGTGG + Intronic
917044555 1:170843612-170843634 TCATTGCTGAAGATGGAGTGAGG + Intergenic
922918432 1:229278165-229278187 TCATTGCCTGAAAAGAAGAAAGG - Intronic
924187705 1:241512886-241512908 TCATTGCATGAGATAGAGACTGG - Intronic
1063464263 10:6232774-6232796 TCTTTGTCTGGGATGGAGGGAGG + Intronic
1064945070 10:20778202-20778224 TGCATGCCTGGGATGGAGAGTGG + Intergenic
1065807567 10:29409227-29409249 TCTCTGTCTGAGATGGAGAAAGG + Intergenic
1067983134 10:51110516-51110538 TGGTTGCCTGGGATGGAGAGAGG + Intronic
1069163875 10:65124765-65124787 ACATTGCCTGTAATTGAGAGTGG - Intergenic
1070000823 10:72375775-72375797 TCTTTGACTGTGATGGTGAGTGG - Exonic
1072344376 10:94488955-94488977 TCACTACCTGGGATTGAGAGGGG + Intronic
1072531560 10:96324178-96324200 TCATTGCCTGAGACCTAGAAAGG + Intronic
1072804746 10:98417386-98417408 TCAGTACCTGACATGGAGGGTGG + Exonic
1073879629 10:107965770-107965792 TCATTGCATGTGGTGGGGAGGGG + Intergenic
1074185785 10:111098529-111098551 TCTTTGCAGGAGAAGGAGAGAGG - Intergenic
1075745422 10:124724208-124724230 TCAATGCCAGAGATGGGGTGAGG + Intronic
1075776277 10:124991017-124991039 CCATGGCCTGAGATGGGAAGTGG + Intronic
1076492512 10:130872205-130872227 TCTATGCCTGAGATTGAGAAGGG - Intergenic
1078290086 11:10001368-10001390 TCATTGCCTCATACTGAGAGGGG - Intronic
1078459180 11:11500383-11500405 TCATTTCCTCACATGGAAAGTGG + Intronic
1078637249 11:13063413-13063435 GCATTTCCTGAGATGGGGAATGG - Intergenic
1079235208 11:18683446-18683468 GCATTGCCTGCGATGGGGTGGGG - Intergenic
1080020228 11:27552398-27552420 TTATTGACAGAGATGGAGAAGGG + Intergenic
1080828668 11:35870928-35870950 CCATTGCCTGAGAGGGAGGAGGG - Intergenic
1081256237 11:40899162-40899184 TAAATGCCTGAGCTGGAGTGAGG + Intronic
1081836445 11:46159512-46159534 TCAATGCCTGGGATGGGGTGAGG + Intergenic
1082895198 11:58182831-58182853 TGATTGCCTCAGCTGGGGAGAGG + Intergenic
1084104215 11:66970341-66970363 TCATTGGGTGGGCTGGAGAGGGG + Intergenic
1085030158 11:73266264-73266286 TCAAAGCCTGGGATGGAGCGTGG + Intronic
1087609541 11:100417495-100417517 ACATTGGCTTATATGGAGAGGGG + Intergenic
1090418323 11:126556240-126556262 TGGTGGCATGAGATGGAGAGAGG + Intronic
1090463867 11:126915591-126915613 TCATTGACTCACATGAAGAGTGG + Intronic
1090789119 11:130075017-130075039 TTATGGCCTAAGATGGAAAGTGG + Intronic
1091602946 12:1928950-1928972 GCTGTGCCTGACATGGAGAGAGG - Intergenic
1091678139 12:2506231-2506253 TCATTGCCTGGAAGGTAGAGAGG + Intronic
1091760301 12:3082927-3082949 TCATTTCTTGAGATCGTGAGGGG - Intronic
1094016709 12:25872150-25872172 TGATTGCCTGAGGTGGGGTGGGG + Intergenic
1099596542 12:84673472-84673494 ACATGGCCTGAGGTGGGGAGTGG + Intergenic
1100307677 12:93366033-93366055 TCATTGCCTTTGATGGTGACTGG + Intergenic
1100467778 12:94862705-94862727 TCATTTTCTCAGGTGGAGAGTGG - Intergenic
1102506843 12:113389237-113389259 CCTCTGCCTGACATGGAGAGAGG - Exonic
1103973155 12:124685006-124685028 CCACTGCCTGAAGTGGAGAGAGG - Intergenic
1104000177 12:124855222-124855244 TGATTGCCTGTGCTGGGGAGGGG - Intronic
1104246037 12:127042485-127042507 TCATAGCCTGATATGTAGAAAGG - Intergenic
1105386380 13:19933533-19933555 TTGTTGCCTGAGATAGAGATTGG + Intergenic
1105995508 13:25667537-25667559 TCACAACATGAGATGGAGAGTGG - Intronic
1117823850 14:59679429-59679451 TCATGGTCTTAGCTGGAGAGAGG - Intronic
1119213795 14:72852454-72852476 CCCTTGCCTGAAATGGGGAGAGG + Intronic
1119438379 14:74612309-74612331 TCATTACCGGAGAGGGAGCGAGG + Exonic
1120089211 14:80311555-80311577 TCATTGCCTGATAAGGACATTGG + Intronic
1120510644 14:85409763-85409785 CCATTGTCTGAGAGGAAGAGGGG - Intergenic
1122101541 14:99414303-99414325 TCATGGCATGAGGTGCAGAGCGG - Intronic
1122529850 14:102417986-102418008 CCATTGACTGAGATGGAGACTGG + Intronic
1124874771 15:33581492-33581514 ACATTCCCTGAGAAGGAGAGTGG - Exonic
1126201154 15:45987601-45987623 TGGTTGCCAGAGCTGGAGAGAGG - Intergenic
1128768668 15:70266233-70266255 ACACTGGCAGAGATGGAGAGGGG - Intergenic
1129233399 15:74209139-74209161 TCTGTGCCTGAGCTGGAGATGGG - Intronic
1129744361 15:78007854-78007876 GCAGTGCCCGAGATGGGGAGAGG + Intronic
1132247314 15:100307563-100307585 GCTTAGCTTGAGATGGAGAGAGG + Intronic
1133650723 16:7811657-7811679 TGGTTGCCTGAGATAGAGAATGG + Intergenic
1134016024 16:10889051-10889073 TCATTGCCACGGATGAAGAGAGG + Intronic
1134395106 16:13855361-13855383 GCATTTCCTGGGATGGAGAGTGG - Intergenic
1134610075 16:15601133-15601155 TGCTTGGCTGAGATGGAGAGCGG - Intronic
1134635719 16:15790391-15790413 ACTTTGCCTGGGATGGGGAGTGG + Intronic
1135475404 16:22770260-22770282 TAATTGCCAGAGATGGACAATGG + Intergenic
1136233742 16:28902564-28902586 ACATAGCCTGTGGTGGAGAGAGG - Exonic
1138771908 16:59675773-59675795 TGATTGCCAGAGCTGGAGACGGG - Intergenic
1141899675 16:86982978-86983000 TATTTGCTTGAGAAGGAGAGTGG - Intergenic
1142131161 16:88432091-88432113 TCTTTGCCTGGGAAGGGGAGTGG + Exonic
1142273184 16:89101629-89101651 TCACTGCCTGTGATGCTGAGGGG + Intronic
1142471155 17:164070-164092 GCATTGCCTGAGGTGGTGGGCGG + Intronic
1143175914 17:4955059-4955081 TGAAGGCCTGAGATGGGGAGAGG - Exonic
1143357411 17:6340668-6340690 TCATTTCCTAAAGTGGAGAGTGG + Intergenic
1143981097 17:10870624-10870646 TTATTGAGTGAGATGGAGTGGGG - Intergenic
1144774010 17:17775238-17775260 CTATTGCCTGAGTTGGAGTGCGG + Intronic
1146526759 17:33573349-33573371 TCATTTCCTGAGATGGGCCGTGG - Intronic
1148142188 17:45336826-45336848 CCCTTTCCTGAGATGGAGAGCGG - Intergenic
1150139159 17:62714096-62714118 TCCTTGGCTGAGATGGAGCCAGG + Intronic
1150553298 17:66231037-66231059 TGAGTGCCTGATATTGAGAGAGG + Intronic
1150703299 17:67466343-67466365 TCAATGGCTGACATTGAGAGGGG - Intronic
1150759156 17:67944718-67944740 TCATGACCTCAGATTGAGAGTGG + Intronic
1151574655 17:74946645-74946667 TCATTGCCTGGGAGGGAGGCAGG - Exonic
1151948278 17:77331292-77331314 TCACTGCGTCAGAGGGAGAGAGG + Intronic
1152451603 17:80384901-80384923 TCATTTCCTGTGATGCAGCGTGG - Intronic
1152641423 17:81450869-81450891 TTATTGCCTGGGCTGGAGTGTGG - Intronic
1154978951 18:21486440-21486462 TCCTTGCCTGTGGTGGACAGGGG - Intronic
1154989164 18:21583711-21583733 TCATTGCCTGGGATGAAGAGTGG + Intronic
1155980861 18:32177939-32177961 TGATGGGCTGAGAGGGAGAGAGG - Intronic
1157963149 18:52179281-52179303 TCAATGCCTGGGATGTAGTGAGG - Intergenic
1158339045 18:56445785-56445807 TCATTCCCTGAGGTTGAGAAGGG - Intergenic
1160610280 18:80078985-80079007 TCATTTACTTAGCTGGAGAGAGG + Intronic
1160744430 19:704055-704077 ACATTGCCTGGGATGCAGGGAGG + Intergenic
1163155345 19:15437146-15437168 GGACTGCCTGAGGTGGAGAGGGG + Intronic
1163186157 19:15640977-15640999 TCCTAGCCTGTGATGGAGATGGG + Intronic
1163190432 19:15673167-15673189 TCCTGGCCTGGGATGAAGAGGGG + Intronic
1163202752 19:15780265-15780287 TCCTGGCCTGGGATGGGGAGGGG - Intergenic
1163218550 19:15897970-15897992 TCCTGGCCTGGGATGGAGAGGGG - Intronic
1163222917 19:15934751-15934773 TCCTGGCCTGGGATGGGGAGGGG - Exonic
1163494273 19:17636151-17636173 TCTTGGCCTGAAATGGACAGTGG + Exonic
1165347452 19:35257787-35257809 TTAGTGCCTGAGAAGCAGAGAGG + Intronic
926898471 2:17722186-17722208 TAATTGTCTAAGCTGGAGAGAGG - Intronic
927173002 2:20386374-20386396 TGAAGTCCTGAGATGGAGAGAGG + Intergenic
927257559 2:21053426-21053448 TCACTGCCAGAGAAGGAGATGGG + Intergenic
929171207 2:38934681-38934703 ACAGTGCCTGAGATGGAGGGAGG - Intronic
929345020 2:40871299-40871321 TCATTTTCTGAGTTGTAGAGGGG - Intergenic
931241464 2:60456518-60456540 TGATTTCCTGAGATGCATAGTGG - Intronic
932428599 2:71659709-71659731 TCATTGCCTGAGATGGAGAGGGG + Intronic
932449027 2:71797891-71797913 TCCTGGCCTAAGATGGTGAGTGG + Intergenic
933783120 2:85815417-85815439 TCACTGCTTTAGATGGGGAGTGG - Intergenic
934920739 2:98343254-98343276 TGATTGCCTGAGAAGGAAACAGG + Intronic
935482955 2:103616176-103616198 TAATTGCATAACATGGAGAGGGG - Intergenic
937028538 2:118719088-118719110 TCATTACCAGGGCTGGAGAGAGG + Intergenic
937803794 2:126113713-126113735 TCATTTCATGAGATGAAGTGAGG - Intergenic
937930975 2:127205050-127205072 TCTTCGGCTGAGATGGAGAGAGG - Intronic
938224506 2:129604378-129604400 TCACTGCCTCAGCTGGACAGAGG + Intergenic
940528672 2:154850507-154850529 TCATTGTCTAAGATGCAGATTGG + Intronic
941621190 2:167781637-167781659 TCCCTGCCTGAGAGGGAAAGGGG - Intergenic
942319649 2:174725289-174725311 TCATTGCAAGGGATGCAGAGTGG + Intergenic
943074826 2:183180990-183181012 TCATTGCCTCAGATGGAGGTAGG - Intergenic
945188733 2:207165727-207165749 TCAATGCAGGAGAGGGAGAGAGG + Exonic
946119022 2:217492904-217492926 TCATTGCAGGAGATGGAGAAAGG - Intronic
1170436898 20:16339647-16339669 TCATTTACTGAGATGGGGAAAGG - Intronic
1172004872 20:31812149-31812171 ACCCTGCCTGAGATGGTGAGGGG - Intergenic
1172197511 20:33102179-33102201 GCGGTGCCTGAGAGGGAGAGAGG + Intronic
1173598033 20:44272381-44272403 TCATTGGCTGAGAGGGAGCTGGG + Intronic
1174378204 20:50140059-50140081 TCATTCACAGAGATGGAGAGAGG - Intronic
1174797194 20:53532003-53532025 GCATTTCCTGGGAGGGAGAGGGG + Intergenic
1175588986 20:60172144-60172166 TCATGGCCTGACATGGAGCTCGG + Intergenic
1177476007 21:21624102-21624124 ACATTCCCTGAAATGGAGACTGG - Intergenic
1178702485 21:34845311-34845333 TCCTTGCCAGGGATGGAGACAGG + Intronic
1178826484 21:36021250-36021272 TCAAAGCCAGTGATGGAGAGAGG + Intergenic
1179126889 21:38598933-38598955 TCTTTCCCTGGGGTGGAGAGAGG - Intronic
1180127273 21:45801042-45801064 CCATTGCCAGAGTTGGAGAGTGG - Intronic
1182905475 22:33932189-33932211 TTGTTGCCTGGGCTGGAGAGTGG + Intergenic
1184713754 22:46268535-46268557 TCGTTGCTTGTGGTGGAGAGCGG - Exonic
1185374780 22:50477356-50477378 TGATGGCCTGAGATGAGGAGTGG - Intergenic
949332589 3:2938716-2938738 TCATTTCCTGAGAGGGAGAGAGG + Intronic
950128747 3:10527566-10527588 TCCTTGTCTCAGAGGGAGAGTGG - Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950670101 3:14520862-14520884 CCATTTCCTGAGATGGGGATGGG - Intronic
953722404 3:45368053-45368075 TCATTGACAGACATGCAGAGAGG - Intergenic
954240276 3:49288249-49288271 TCATTTCCTGAGTGGGATAGAGG - Intronic
954361199 3:50123785-50123807 TCACTGGCAGAGCTGGAGAGGGG + Intergenic
956185354 3:66557216-66557238 CTGTTGCCTGAGATTGAGAGTGG + Intergenic
956654421 3:71535344-71535366 TCATGGCCTGAGAAGCAGAGGGG + Intronic
958197150 3:90255905-90255927 GGATTGCCTGAGCTGGAGGGCGG + Intergenic
958984524 3:100764762-100764784 GCATTTCCTTAGATCGAGAGGGG - Intronic
960483139 3:118217738-118217760 CAGTTGCCTGAGGTGGAGAGTGG - Intergenic
961699904 3:128735180-128735202 TCAATGCCTGGGGTGGTGAGGGG + Intronic
962626350 3:137229301-137229323 TCATGACCTGAGATGGGCAGTGG + Intergenic
963214598 3:142731220-142731242 TCATTGGCTGAGCCGCAGAGAGG + Intronic
963548044 3:146685712-146685734 TCAGGGCCTGTGATGGGGAGGGG + Intergenic
963680238 3:148365233-148365255 TCATCTCCAGAGATGGGGAGTGG - Intergenic
964670721 3:159222523-159222545 TGATTACCAGAGGTGGAGAGAGG + Intronic
964855448 3:161141064-161141086 GCATTGCCTGTGGTGGGGAGGGG - Intronic
965248788 3:166313895-166313917 TCAATGCTTAAGATGGAGAAAGG - Intergenic
968162726 3:196439993-196440015 GCATTTCCTGGGATGCAGAGTGG - Intergenic
970238705 4:13985433-13985455 GAATTGCATGAGTTGGAGAGAGG + Intergenic
970365144 4:15350512-15350534 TAGTGGCCAGAGATGGAGAGAGG - Intronic
974966379 4:68765610-68765632 TTTTTTCCTGAAATGGAGAGTGG + Intergenic
976488523 4:85639417-85639439 TCTTTGCCTGAGATTTAGATCGG - Intronic
977683628 4:99822681-99822703 TCATAGGATGAGATGGATAGAGG - Intronic
978193568 4:105944237-105944259 ACAGTATCTGAGATGGAGAGAGG - Intronic
979502919 4:121460827-121460849 TCAGTGCCTGAGAGAGAGACAGG + Intergenic
980195238 4:129579246-129579268 TCATTGCCTGAGACAGGGAATGG - Intergenic
982765506 4:159343265-159343287 TCATTTCCTGAAATTGACAGAGG - Exonic
986735338 5:10663682-10663704 TCATTGCCAGAGACGCAGAGGGG - Intergenic
986811605 5:11365614-11365636 TCATTGCATGATATGGGAAGAGG + Intronic
987260250 5:16195643-16195665 TTGTTGCCTGGGATGGAGTGCGG + Intergenic
988109509 5:26799803-26799825 TTAATGACTGAGATGGAAAGAGG + Intergenic
988643706 5:33070082-33070104 TCACTTCCTGAGAGTGAGAGCGG + Intergenic
991444801 5:66688099-66688121 TCATGACCAGAGATGGAGAGTGG - Intronic
992318621 5:75587016-75587038 TCATTTCAAGGGATGGAGAGAGG + Exonic
992448081 5:76851501-76851523 TGATTGCATGAGAGAGAGAGAGG + Intronic
992602807 5:78421545-78421567 TCATTGCCTGTGAGGAGGAGAGG + Intronic
993532438 5:89041127-89041149 TAAATGCCTAAGATGGAGACTGG - Intergenic
993547883 5:89235263-89235285 TCCATGTCTGAGATGGACAGAGG + Intergenic
994157075 5:96515624-96515646 TCATTTCCTAAAATGCAGAGTGG - Intergenic
995041068 5:107588607-107588629 TCATTGCCTGGGTTGTAGAAAGG + Intronic
995686627 5:114779550-114779572 ACACTGCCTTAGATGAAGAGGGG - Intergenic
995770067 5:115659362-115659384 TCATTGTCAGTAATGGAGAGGGG + Intergenic
997621155 5:135297015-135297037 CCTGTGCCTGAGATGGAGGGAGG - Intronic
998004577 5:138648637-138648659 TCCTGCCCAGAGATGGAGAGGGG - Intronic
999274059 5:150317223-150317245 TCATGGCCTGACATGCAGTGAGG - Intronic
999893729 5:156006475-156006497 TCATTTCCTGGGAGGAAGAGAGG - Intronic
1001420429 5:171582092-171582114 TCTTTGCCTGAGATGGAAATCGG - Intergenic
1001542167 5:172547256-172547278 CCGTTTCCTGAGATGGGGAGGGG + Intergenic
1001753933 5:174151840-174151862 TCATTCCCTGAAACAGAGAGAGG - Intronic
1004897863 6:20166397-20166419 TCCTTCCCTGGGAAGGAGAGTGG - Intronic
1007216441 6:40243724-40243746 TCATTGCCTAAAATGGAGGCAGG + Intergenic
1008307846 6:49926735-49926757 ACATTGCCTGAGGTGGAGGTAGG + Intergenic
1008691837 6:53987763-53987785 CCATTAACTGAGATGGAGAGAGG + Intronic
1013219840 6:108068457-108068479 TCATTTACTGAGCTGGAGGGAGG - Intronic
1013462923 6:110392910-110392932 TCCTTGCGCGAGATGGACAGAGG - Exonic
1013616136 6:111845133-111845155 TCACTGCCTGAGTTGGACAGGGG + Intronic
1014130785 6:117829818-117829840 TCTTTGGCTGAGATACAGAGTGG - Intergenic
1014688437 6:124532393-124532415 TCTGTGCCTGAAAAGGAGAGGGG - Intronic
1018473323 6:164115570-164115592 TTATTGCATGATGTGGAGAGAGG - Intergenic
1019561572 7:1661910-1661932 TCTTTGCCTGAGATAGAAATTGG + Intergenic
1024410285 7:49032690-49032712 GCACTACCTGAGATGGAGATAGG + Intergenic
1026545655 7:71319700-71319722 TTATTGATTGAGATGGAGAAGGG - Intronic
1027247203 7:76375285-76375307 AGATTGCCGGAGATGGAGACAGG + Intergenic
1029539943 7:101176767-101176789 TCATTGGCTGAAAGAGAGAGGGG - Intronic
1030187663 7:106779542-106779564 TCCTTACCTGAGATGCAGACAGG + Intergenic
1033552244 7:142458144-142458166 CCAGGGACTGAGATGGAGAGTGG - Intergenic
1033554510 7:142477092-142477114 CCAGGGACTGAGATGGAGAGTGG - Intergenic
1033556789 7:142495198-142495220 CCAGGGACTGAGATGGAGAGTGG - Intergenic
1033559135 7:142514637-142514659 CCAGGGACTGAGATGGAGAGTGG - Intergenic
1034200941 7:149282407-149282429 CCTTTTCCTGGGATGGAGAGAGG + Exonic
1037021773 8:13981481-13981503 TAATTGTCTGAGATGGAGTTAGG + Intergenic
1044226771 8:89728226-89728248 TCTCTGACTGAGATAGAGAGAGG + Intergenic
1044654633 8:94534718-94534740 TTATTTCTTGAGAGGGAGAGAGG - Intronic
1044927093 8:97218576-97218598 TCAATGCCTGAGCAGGAAAGAGG - Intergenic
1047063215 8:121250921-121250943 GCAGTGCCTGAGATGCAAAGGGG + Intergenic
1049858410 8:144879658-144879680 TAAGTGCCTGAGATAGAGAAGGG - Exonic
1051678374 9:19581442-19581464 TCTGGGCCTGAGGTGGAGAGGGG - Intronic
1051720870 9:20035911-20035933 TCTTTGCCTGAAATGGCTAGGGG + Intergenic
1053122846 9:35559351-35559373 TCATTGCTGGAGGTGGGGAGGGG + Intronic
1055792333 9:79936144-79936166 TCTTTCCCTGAGTTGGAGCGTGG + Intergenic
1187018083 X:15350430-15350452 TCATTGGCTGCCTTGGAGAGGGG - Intronic
1195586474 X:106570676-106570698 TCATAGAATGAGATGGAGAGGGG - Intergenic
1196250245 X:113451913-113451935 CCATTCTCTGAGATGGGGAGGGG + Intergenic
1198518721 X:137431577-137431599 TCACTGCCTGAGATCAAGAGAGG - Intergenic
1199420298 X:147636953-147636975 TCATGGCCTCTGATGGGGAGGGG - Intergenic
1199766738 X:150946909-150946931 GCGTTGCTTGGGATGGAGAGAGG - Intergenic