ID: 932431098

View in Genome Browser
Species Human (GRCh38)
Location 2:71674042-71674064
Sequence GTCCTGTGGGAAGACTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 335}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932431098_932431113 28 Left 932431098 2:71674042-71674064 CCTTCCCAGTCTTCCCACAGGAC 0: 1
1: 0
2: 2
3: 36
4: 335
Right 932431113 2:71674093-71674115 CCTACTCCTCTGCCTCCTCCAGG 0: 1
1: 2
2: 7
3: 162
4: 857
932431098_932431108 0 Left 932431098 2:71674042-71674064 CCTTCCCAGTCTTCCCACAGGAC 0: 1
1: 0
2: 2
3: 36
4: 335
Right 932431108 2:71674065-71674087 CTGGCTCTGGCAGGTCCCTTGGG 0: 1
1: 0
2: 2
3: 26
4: 282
932431098_932431105 -9 Left 932431098 2:71674042-71674064 CCTTCCCAGTCTTCCCACAGGAC 0: 1
1: 0
2: 2
3: 36
4: 335
Right 932431105 2:71674056-71674078 CCACAGGACCTGGCTCTGGCAGG 0: 1
1: 0
2: 3
3: 39
4: 360
932431098_932431107 -1 Left 932431098 2:71674042-71674064 CCTTCCCAGTCTTCCCACAGGAC 0: 1
1: 0
2: 2
3: 36
4: 335
Right 932431107 2:71674064-71674086 CCTGGCTCTGGCAGGTCCCTTGG 0: 1
1: 0
2: 5
3: 43
4: 332
932431098_932431109 1 Left 932431098 2:71674042-71674064 CCTTCCCAGTCTTCCCACAGGAC 0: 1
1: 0
2: 2
3: 36
4: 335
Right 932431109 2:71674066-71674088 TGGCTCTGGCAGGTCCCTTGGGG 0: 1
1: 0
2: 1
3: 20
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932431098 Original CRISPR GTCCTGTGGGAAGACTGGGA AGG (reversed) Intronic
900136080 1:1117436-1117458 GCCCTGAGGGAACCCTGGGATGG - Intergenic
900327957 1:2119666-2119688 GTCCTGCAGGAAGACTAGAAGGG - Intronic
900662396 1:3791341-3791363 CCTCTGTAGGAAGACTGGGAGGG - Intronic
901454054 1:9353219-9353241 GAGCTGTAGGAAGGCTGGGAGGG - Intronic
902179327 1:14675958-14675980 GTCCTGTGCTTAGACTTGGAGGG - Intronic
902536696 1:17123101-17123123 GTCATGGGGGAAGCCTGGGAAGG + Intergenic
903096586 1:20981214-20981236 GGCCTCTGGAAAAACTGGGAAGG + Exonic
903164336 1:21509963-21509985 GTCAGGTGGGACGCCTGGGAGGG - Intronic
903254813 1:22088965-22088987 GTCCTGTGGGATGTCATGGATGG + Intronic
903502785 1:23810797-23810819 TACCTGTGGGAAGACAGGGGAGG + Exonic
903548971 1:24144348-24144370 CCCCTGGGGGAAGACTGGGGAGG + Intergenic
904286178 1:29454499-29454521 GCCCAGTGGGGAGACTGGGTGGG - Intergenic
904444354 1:30555893-30555915 GTCTTGTGGGAAGAACGGGGAGG + Intergenic
904705450 1:32386893-32386915 GGACTGTGGGAAGACAGAGAGGG + Exonic
905203660 1:36330495-36330517 GTCTTTTGGGAAGACAGAGACGG - Intergenic
905278182 1:36832713-36832735 GTCCTTTGGGAAGGATGGGCAGG + Intronic
905870979 1:41404539-41404561 CTCCTGTGGGAAGCTTGGCAAGG + Intergenic
906661465 1:47585755-47585777 GAGCTGTGGTGAGACTGGGATGG + Intergenic
906702912 1:47872751-47872773 GTCCCTTGAGAAGACTGGGTTGG + Intronic
906784789 1:48605446-48605468 GTCCTGGAGGAAGGCTGGGCAGG - Intronic
907490774 1:54807467-54807489 GCTCTGTGGGTAGACTGGGCGGG + Intronic
907871616 1:58448807-58448829 GTCCAGTGGTGAGACAGGGAAGG - Intronic
908132483 1:61087982-61088004 ATCCTATGGGAAGTCTGGGAAGG - Intronic
908794505 1:67817681-67817703 GTCCTTAGGGAAGAAAGGGAAGG + Intronic
909331872 1:74423166-74423188 TACCTGTGGGAGGGCTGGGAGGG - Intronic
911089548 1:94007570-94007592 GTCCTGTGAGAAGAATAGGAAGG - Intronic
911453506 1:98095124-98095146 GTGCTGTGAGTAGACAGGGAAGG - Intergenic
913150594 1:116038689-116038711 GTCTTCTGGTAAGACTGTGATGG + Intronic
916315416 1:163443131-163443153 CTACTTTGGGAGGACTGGGACGG - Intergenic
919356545 1:196531275-196531297 GTCCTTTTGGAAGTCTGTGAGGG - Intronic
919506745 1:198408313-198408335 ATCCTGTGGGAAGAAAAGGAAGG - Intergenic
920531532 1:206706185-206706207 TCCCTGTGGGAAGACCAGGAGGG - Intronic
920846997 1:209602350-209602372 GTTCTGTGGGATGACTTAGATGG - Intronic
921366335 1:214378241-214378263 GCCCAGTGGGAATAGTGGGAAGG - Intronic
921942187 1:220853674-220853696 GTCGTGTGGGAAGGCTGGTTAGG + Intergenic
922203142 1:223423900-223423922 ATCCTATGGGACGACTGGGCAGG - Intergenic
922767707 1:228164546-228164568 GTCCTGTGGGAGGACAGGCTGGG + Intergenic
922979459 1:229813422-229813444 GACCTGTGGGAAAGCTGGGCTGG + Intergenic
923711373 1:236390154-236390176 GACTTGAGGGAAGAGTGGGAGGG + Intronic
1063313684 10:4981831-4981853 GCCTTGTGGGCAGACCGGGAGGG + Exonic
1068874337 10:61980479-61980501 TTCCTGTGGAACAACTGGGAGGG + Intronic
1069835151 10:71303544-71303566 GTGCTGTAAGAAGACTGGCAAGG + Intergenic
1070306679 10:75243755-75243777 GTCCTGTGGTGAGATTGGGTGGG + Intergenic
1070440374 10:76436949-76436971 GTCCTGTTTGAGGAGTGGGAAGG - Intronic
1071304713 10:84288585-84288607 GTCCTCAGGGCAGGCTGGGAAGG - Intergenic
1071304962 10:84291465-84291487 GTCTTGTGGGCAGCCTGGGCTGG - Intergenic
1072004693 10:91233184-91233206 GCTCAGTGGTAAGACTGGGATGG - Intronic
1073299512 10:102462167-102462189 CTGCTGTGGGGAGACTGGGCAGG + Intronic
1073916468 10:108410215-108410237 GTCCTTTGGGAGGACATGGATGG - Intergenic
1076424377 10:130357103-130357125 GTGCTTTAGAAAGACTGGGAAGG - Intergenic
1077088458 11:766426-766448 CTCCTGTGGGAAGCCTTGAAGGG - Intergenic
1077430197 11:2512495-2512517 GTCTTGAGGGAAGACTGGGAGGG - Intronic
1078455425 11:11471010-11471032 GTCCTGAGGAAAGGCAGGGAAGG - Intronic
1079328017 11:19511243-19511265 GTCCTGTGGGATGACAAGGCAGG - Intronic
1079452122 11:20606343-20606365 GTACTGTGGGAGGACTCAGAAGG + Intronic
1081806225 11:45892247-45892269 GTCCTCTGGGAAGACGGTGCTGG - Intronic
1082286408 11:50322530-50322552 GTACTGAGAGTAGACTGGGAGGG - Intergenic
1083689485 11:64398390-64398412 GCCCTGAGGCAAGACTGTGAAGG - Intergenic
1084166920 11:67379439-67379461 GTCCTTTGGGAAGCCTGAGCTGG - Intronic
1084273621 11:68041248-68041270 GTCCTGTGGGTGGACACGGATGG - Exonic
1084368611 11:68721272-68721294 GCCCTGTGGCAAGAGAGGGAGGG - Intronic
1084377060 11:68784715-68784737 GGCCTGTGGGAATCCTGGCACGG - Intronic
1086357403 11:86017631-86017653 ATGCTGTGGCAAAACTGGGAAGG - Intronic
1087104180 11:94394071-94394093 GTCCAGTGAGAGGACTGGGGAGG + Intronic
1087277374 11:96174095-96174117 GCCATGTGGAAGGACTGGGATGG - Intronic
1088729064 11:112664699-112664721 GTCATGTGGGAAGAGAGGGAAGG + Intergenic
1089603025 11:119626722-119626744 ATGCTGTGGGCAGACAGGGAAGG + Intronic
1089696020 11:120216770-120216792 GTGCCTTGGGAAGCCTGGGAGGG - Intronic
1090126379 11:124089319-124089341 GGCATATGGGAAGCCTGGGAGGG - Intergenic
1090446631 11:126770125-126770147 GTCCAGTGGGAAGCCTGAGTTGG + Intronic
1091391343 12:128183-128205 GCCCTGTGGGATGACTGAGAGGG - Intronic
1091433044 12:453033-453055 GAGCTGGGGCAAGACTGGGAAGG - Intergenic
1091551587 12:1539159-1539181 GTCCCGTGGGGAGAGCGGGAGGG + Intronic
1093971140 12:25377137-25377159 GTACTGTGGGAGGACTAGGCGGG + Intergenic
1095943274 12:47739865-47739887 ATCCTGTGTGAAGACTGGGCTGG - Intronic
1096239198 12:49950590-49950612 GGCCTGTGGGTGGGCTGGGATGG + Intergenic
1097042010 12:56161419-56161441 GGACTCTGGGGAGACTGGGAAGG - Exonic
1097287424 12:57888876-57888898 ACCCTGTGAGAAGGCTGGGATGG + Intergenic
1097639234 12:62159700-62159722 GACTTGGGGGAAGAGTGGGAGGG + Intronic
1098231677 12:68377607-68377629 GTCATGTCGGAAGACTAAGAGGG + Intergenic
1099581408 12:84451561-84451583 ATCTTGGGGGAAGAGTGGGAAGG - Intergenic
1100699779 12:97134912-97134934 CTCCTGTGGGAAAACAGAGATGG + Intergenic
1100822080 12:98441086-98441108 GACTTGTGGGAAGACAGAGAGGG + Intergenic
1102463673 12:113115555-113115577 GTCCTGGGGGAGGAATGGGGAGG - Intronic
1102829669 12:115986031-115986053 GACGTGTGGTAAGAATGGGAGGG + Intronic
1102980765 12:117239138-117239160 GTCCTCTGTTGAGACTGGGAAGG + Intronic
1104167901 12:126251595-126251617 CTCATGAGGGAAGGCTGGGAGGG + Intergenic
1104606642 12:130194231-130194253 GTCCTGTGGGAAGAATAGTGAGG + Intergenic
1108708959 13:53014996-53015018 GCTCTGTGGGGAAACTGGGAAGG + Intergenic
1109231941 13:59767970-59767992 GCCCTGTGGGTAGACAGGAAAGG - Intronic
1110318662 13:74135739-74135761 GGGCTGTGGGAAGGCCGGGAAGG + Intergenic
1111849389 13:93553366-93553388 GTCCTGATGGAATACTGCGATGG + Intronic
1112262019 13:97885681-97885703 GTGCAGTGGGGAAACTGGGAGGG + Intergenic
1112585501 13:100715656-100715678 GCCCTCCGGGAAGACTGGTAGGG + Intergenic
1113329624 13:109315812-109315834 ATCCTGAGGGATGACAGGGAGGG - Intergenic
1114284915 14:21232238-21232260 GTGCTGTAGCATGACTGGGAAGG - Intronic
1114540164 14:23449443-23449465 GACCTGGGGGGAGACTGTGAAGG - Intergenic
1114635398 14:24184237-24184259 GTCCAGTGGGAAGACAGGAGGGG + Intronic
1115141734 14:30179535-30179557 ATGCAGTGGGAAGACCGGGATGG + Intronic
1115536717 14:34379933-34379955 GCCCTGTGAGCAGAGTGGGAAGG + Intronic
1116773487 14:49153328-49153350 GTTCTTTGGGTAGACTGAGAGGG - Intergenic
1117077884 14:52122463-52122485 GTCCTGCGGGAAGACAGCTAAGG - Intergenic
1117345396 14:54827088-54827110 GTCATGTGGGAGGTCTTGGAGGG - Intergenic
1119083929 14:71722555-71722577 GTCCTGTGAGACCACTGGGCAGG + Intronic
1119898675 14:78242371-78242393 GACCTGTGGGAAGAGGGGGAGGG - Intronic
1120171013 14:81247404-81247426 GTCCTGGGGGATGACTGTCAGGG + Intergenic
1120591592 14:86380698-86380720 GACCTGTGGGAATACTGAGGAGG + Intergenic
1120942898 14:89966289-89966311 GTCCTGTTCAAAGACTGAGATGG + Intronic
1121027762 14:90628997-90629019 GTGCTGCGTGAAGACTGGGATGG + Intronic
1121102529 14:91259897-91259919 GTGCTGGGGGAGGACAGGGATGG + Intergenic
1122442133 14:101739333-101739355 GTCCTGTGGAAATACAGGAAGGG + Intergenic
1122499669 14:102188400-102188422 TTCCTGAGGGAAGAGTGGGCAGG + Intronic
1122544507 14:102514754-102514776 TTCATGTGGCAAGACTGGCAAGG + Intergenic
1122745846 14:103896789-103896811 GGCCTGTGGGGGGAGTGGGAGGG + Intergenic
1122819127 14:104332503-104332525 TCCCTCTGGGAAGACTGGGACGG - Intergenic
1123034369 14:105465955-105465977 GTCCTGTGGGAAGAGGTGGCTGG + Intronic
1124465963 15:29940079-29940101 ATTCTGGGGGAAGACTGGGTGGG + Intronic
1125688976 15:41581276-41581298 GGAGTGTGGGGAGACTGGGAGGG + Exonic
1125928489 15:43582939-43582961 GTCCAGAGGAAAGCCTGGGATGG + Exonic
1125941655 15:43682774-43682796 GTCCAGAGGAAAGCCTGGGATGG + Intergenic
1126309440 15:47299075-47299097 GTGCAGCGGGAAGGCTGGGATGG + Intronic
1126789354 15:52206601-52206623 GTCCTGTGAGGACACAGGGATGG + Intronic
1127855105 15:62947790-62947812 GTCCTCAAGGAAGACTGAGAAGG - Intergenic
1128305008 15:66592671-66592693 CTGCTGTGGGCAGTCTGGGAAGG - Intronic
1128495461 15:68195936-68195958 GTCCTGGGGGGAGTCTGGGAGGG + Intronic
1128496198 15:68200039-68200061 GTCCTGTGGGTTGGCGGGGAGGG - Intronic
1129597980 15:76979724-76979746 GGCGTGTGGGAAATCTGGGACGG + Intergenic
1129698170 15:77752475-77752497 GCCCTGTGGGGAGGCTGGGCCGG - Intronic
1129878213 15:78990776-78990798 GTCCTGTGGGCAGAAGGGGCCGG + Intronic
1132079335 15:98851501-98851523 GTACTGATGGAGGACTGGGAAGG - Intronic
1133771890 16:8871472-8871494 GTACTTTGGGAGGCCTGGGAGGG + Intergenic
1133787447 16:8984426-8984448 GACTAGTGAGAAGACTGGGATGG + Intergenic
1134414017 16:14028469-14028491 GTGCTGTGCTAGGACTGGGAAGG + Intergenic
1135187592 16:20328623-20328645 GGCCACTGGGGAGACTGGGATGG - Intergenic
1135636919 16:24085580-24085602 TTGCTCTGGGAAAACTGGGATGG + Intronic
1136068881 16:27776379-27776401 ATCCAGTGGGAAAAGTGGGACGG - Intronic
1136504442 16:30693926-30693948 GTCCTGTGGGGAGAGGGAGAAGG + Intergenic
1136748660 16:32614175-32614197 GAGCTGTGGGAAGACTAAGAGGG - Intergenic
1137001194 16:35232578-35232600 GCCCAGTGGGTAGAATGGGATGG + Intergenic
1138215894 16:55205067-55205089 TACCTGTGGGAAGACTGGGTTGG - Intergenic
1138498355 16:57422807-57422829 GTCCTCTGGGAGGACAGCGAAGG + Intergenic
1138659767 16:58510122-58510144 TGCCTGTGGGAAGGCTGGGGAGG + Intronic
1140296168 16:73711809-73711831 CTCCTGTGGCAACACTTGGAAGG - Intergenic
1141572799 16:84944360-84944382 CTGCTGTGGGAAGAATGGGTGGG - Intergenic
1141620076 16:85232601-85232623 CTCCTGTGTGAGGACTGGGCAGG + Intergenic
1141740382 16:85887819-85887841 GTATTGTGGGGAGAGTGGGAGGG - Intergenic
1203050793 16_KI270728v1_random:873389-873411 GAGCTGTGGGAAGACTAAGAGGG - Intergenic
1142499423 17:323960-323982 GCCTTGTGGGATGACTGTGAGGG - Intronic
1142528822 17:564903-564925 GTGCTGTGTGAAGAATGGGAAGG + Intronic
1142862498 17:2771325-2771347 GTGCTGGGGGAAGAGTGGGCAGG - Intergenic
1144206784 17:12985009-12985031 GTGCTTTGGGATGACTGGGCTGG + Intronic
1144658082 17:17050814-17050836 GTCCTGTGGGGAGCCGGTGAGGG + Intronic
1147880246 17:43648820-43648842 GAGCTGTGGGAAGGCTGGGGAGG - Intronic
1148211391 17:45810892-45810914 GTGCTGTGGGATGAATGGGCAGG - Intronic
1148289766 17:46434631-46434653 GTCCTGAAGGAAGAGTGGCAGGG - Intergenic
1148311934 17:46652203-46652225 GTCCTGAAGGAAGAGTGGCAGGG - Intronic
1148731334 17:49838613-49838635 GTCCTCTGGGAAGTCTGTGGTGG + Exonic
1149650100 17:58271326-58271348 GAGCTGTGGGAAAGCTGGGAGGG + Intronic
1151339104 17:73458363-73458385 GCCCTGGGGGATGCCTGGGAGGG - Intronic
1152367613 17:79865744-79865766 GTCCTGTGGGATGGATGGGCTGG + Intergenic
1153002191 18:465753-465775 CTCCTTTAGAAAGACTGGGAAGG - Intronic
1153387241 18:4511326-4511348 GGCCAGTGGGAGAACTGGGAAGG - Intergenic
1154399730 18:14025253-14025275 TTCCTGTGGCAACAGTGGGAGGG + Intergenic
1155517097 18:26635304-26635326 GTCCTGTGGGCACAGTGGGCAGG - Intronic
1157518014 18:48324764-48324786 GTGCTGCGTGAAGACTGGGTTGG + Intronic
1157605347 18:48922862-48922884 TGCCTGTGGGAAGACTGTGTAGG - Intronic
1160707674 19:536993-537015 GTCCTGTGGGGAGAGTGGGTCGG - Exonic
1163007168 19:14404363-14404385 GTCCTGTGGGCAGATGGGGGTGG - Exonic
1163576188 19:18112137-18112159 GTCCTGTGGCAGGACTGAGGTGG + Intronic
1164540176 19:29116028-29116050 ATCCTGGGGGAGGACAGGGAGGG + Intergenic
1165216186 19:34274511-34274533 GTCATTTGCCAAGACTGGGAAGG + Intronic
1166015120 19:39973929-39973951 GGTTTGTGGGAAGACAGGGAGGG + Intronic
1166679822 19:44759457-44759479 TCCCTGGGGGGAGACTGGGAGGG - Exonic
1167576935 19:50322322-50322344 TTGCTGTGGGCAGCCTGGGAGGG - Intronic
925291763 2:2752590-2752612 GTCCTGTGGGCAGGGAGGGAGGG + Intergenic
925412155 2:3646016-3646038 CTCCGGTGGGGAGACAGGGAAGG - Intergenic
926167734 2:10532010-10532032 GTCCTGAAGGATGACGGGGAAGG - Intergenic
927430834 2:23025018-23025040 GTCCCATGGGAAGACATGGACGG - Intergenic
927842970 2:26457012-26457034 CTCCTGTGGGCAGCCTGGGTGGG + Intergenic
928034410 2:27808473-27808495 AACCTGTGTGAAGACTGAGATGG - Intronic
928370124 2:30734548-30734570 AGTCTGTGTGAAGACTGGGAAGG + Intronic
928453426 2:31398740-31398762 GTCCTTTGGGGAGCCTGGGAGGG - Intronic
928625706 2:33137935-33137957 GTCTTGTGGGAAGGCTGGCTGGG + Intronic
929675293 2:43920764-43920786 GGACTGTGGGAAGACAGGGAAGG + Intronic
929715337 2:44304088-44304110 GGCCTGTCAGAAGACTGGGAAGG - Intronic
930624944 2:53686599-53686621 GTTATGTGGAAAGAGTGGGACGG + Intronic
931126938 2:59288709-59288731 GCCCTCTGGGAACACTGGGAAGG + Intergenic
931220473 2:60284347-60284369 GTGCTATGGGAAGGCTGAGATGG - Intergenic
932431098 2:71674042-71674064 GTCCTGTGGGAAGACTGGGAAGG - Intronic
932713306 2:74083443-74083465 GAGCTGTGGGAAGACAGGGTTGG + Intronic
933151533 2:78921391-78921413 GTTCAGTAAGAAGACTGGGATGG - Intergenic
933757596 2:85652221-85652243 GTCCTGAGGTAACACTGTGAAGG + Intergenic
934559386 2:95304804-95304826 GGCCTGTGGGGAGCCAGGGAGGG - Intronic
934989849 2:98913517-98913539 GCACTGTGGTCAGACTGGGAAGG + Intronic
934992739 2:98932995-98933017 TTCCTGTGGGAACTCAGGGAAGG + Intronic
935098215 2:99967556-99967578 GTCCTGGGGGCAGACTGAAATGG + Intronic
937033535 2:118761827-118761849 GTTCTGTGGGAAGCTGGGGAGGG + Intergenic
937319072 2:120949984-120950006 ATCCAGTGTGAAGATTGGGAGGG + Intronic
937355413 2:121195275-121195297 GTCCTGAAGCAGGACTGGGATGG + Intergenic
937845626 2:126575860-126575882 GTGCTGTGAGAGGACTTGGATGG - Intergenic
938065221 2:128278379-128278401 GGCATGTGGGAAGTCTGGGGCGG + Intronic
939813536 2:146865860-146865882 GACTTGGGGGAAGAGTGGGAGGG + Intergenic
940588736 2:155691737-155691759 GTGCTGTGCGAAGACTGGTAAGG - Intergenic
941318075 2:164019592-164019614 GACTTGAGGGAAGAGTGGGAGGG - Intergenic
943343989 2:186715602-186715624 GTGCTGTGGGAACTCAGGGAAGG + Intronic
943620834 2:190146152-190146174 GACCTGGGGGAAGATTGGGAGGG - Intronic
944128524 2:196320487-196320509 GGCCTGTGGAAAGACGGCGAAGG - Intronic
944665393 2:201955112-201955134 GCACTTTGGGAAGACTAGGAGGG - Intergenic
946104824 2:217359957-217359979 GAACTGTAGGAGGACTGGGATGG + Intronic
946284381 2:218692152-218692174 GTCCTGTGCGAAGCCATGGATGG + Exonic
947586891 2:231361984-231362006 GAACTGTGGGAAGGATGGGAAGG + Intronic
948712331 2:239832982-239833004 GTCCTGTGGTTGGCCTGGGATGG + Intergenic
1168981694 20:2009499-2009521 GACCTGTGAGAAGAGAGGGATGG + Intergenic
1169859469 20:10136120-10136142 CCTCTTTGGGAAGACTGGGAAGG - Intergenic
1169931043 20:10833265-10833287 ATCCTGTGGGGAGACTTGGAGGG + Intergenic
1170799134 20:19575974-19575996 GCTCTGTGGGAAGGCTTGGAGGG + Intronic
1171475979 20:25409146-25409168 GGCCTGTGGGGAGTCTAGGAAGG + Intronic
1172442740 20:34977558-34977580 GTCCTGTGGCCAGGCTGGGGGGG + Intronic
1172845746 20:37929151-37929173 GTCCTGTGGCAGGAGAGGGAGGG + Intronic
1173145989 20:40524752-40524774 GGCCTGTGGGAAAATTGGGTGGG - Intergenic
1174034310 20:47658366-47658388 CAACTGTGGGAAGGCTGGGAAGG - Exonic
1174227121 20:49010212-49010234 GACCTGAGGAAAGAATGGGACGG - Exonic
1175123979 20:56738042-56738064 GTCCTGTGGGAGGCCAGGCATGG - Intergenic
1178916093 21:36706287-36706309 GTGCTGTTGGAAGTCAGGGATGG - Intronic
1179330532 21:40396824-40396846 GTCAAGTTGTAAGACTGGGAGGG - Intronic
1179715842 21:43287799-43287821 CTCCTGTGGGTGCACTGGGAAGG - Intergenic
1179788508 21:43742628-43742650 GCACTTTGGGAAGACTAGGAGGG + Intronic
1180165541 21:46023988-46024010 GTCTTGTGGGCAGGCTGTGAGGG + Intergenic
1180656999 22:17430352-17430374 GACATGTGGGAAGAGAGGGAGGG - Intronic
1181002279 22:19993492-19993514 GCCCTGGGGGAAGGCTAGGAAGG + Intronic
1181754394 22:25013033-25013055 ATCCTCTGGGTAGAGTGGGATGG + Intronic
1182416235 22:30223160-30223182 GTCCAGTGGGAAGACGGACATGG - Intergenic
1183217763 22:36492174-36492196 GGACAGCGGGAAGACTGGGAGGG + Intronic
1183400587 22:37601567-37601589 GTCCTGTGGCAGGACAGGGGAGG - Intergenic
1183459336 22:37940568-37940590 TTCCTGTGTGGAGCCTGGGAGGG - Intronic
1183722723 22:39571834-39571856 GTACTGTCAGATGACTGGGATGG + Intronic
1183936218 22:41263918-41263940 GTCATGTGGAAAAACTGGGATGG + Intronic
1184688836 22:46108410-46108432 GGCCTGTGGGGACACTGGGTGGG - Intronic
1185050925 22:48553555-48553577 GTCCTGGGGCAGGGCTGGGAGGG + Intronic
1185130497 22:49035998-49036020 GCCCTGTGTGAGGACTGGGACGG - Intergenic
1185295472 22:50051190-50051212 GACTTGGGGGAAGATTGGGAGGG - Intronic
949250048 3:1972924-1972946 GTAGTGTGGGAAGACTGGTTAGG - Intergenic
949459678 3:4276955-4276977 GTTCTGAGGGAAGATGGGGATGG + Intronic
949785330 3:7733913-7733935 GTACTGTGCTAAGCCTGGGAAGG - Intronic
950491407 3:13307289-13307311 GTCCTGGGGGCGGGCTGGGAAGG - Intergenic
950687237 3:14627360-14627382 CTCCTGTGGGAGGCCTGGGCGGG - Intergenic
952126428 3:30305971-30305993 TTCCAGAGGGAAGCCTGGGAGGG - Intergenic
952973178 3:38669467-38669489 GTCCTGTAGCAAAACTGTGAAGG + Intergenic
953392058 3:42539648-42539670 GGGCTGTGTGAAGGCTGGGAGGG + Intergenic
956000298 3:64722905-64722927 GTGCAATGGGAAGCCTGGGATGG + Intergenic
959122047 3:102244202-102244224 CTCCTGGGGCAAGGCTGGGATGG + Intronic
959580163 3:107975295-107975317 TTCCTGAGGGAAGGATGGGATGG - Intergenic
960133320 3:114080695-114080717 GGCCAGAGGGAAGACTGGGCAGG - Intronic
960722076 3:120634631-120634653 GTCCTGTGAGAGTACTGAGAGGG + Intronic
960949657 3:122991095-122991117 GTGCAGTGTGAAGTCTGGGAAGG - Intronic
961129463 3:124452478-124452500 ATACTGTGGGAACACTGGGAAGG + Intronic
963799592 3:149662569-149662591 GTCCTGTCGTGAGAGTGGGAAGG - Intronic
963870438 3:150409284-150409306 GTCCTGTCGGAAACCGGGGAGGG - Exonic
964724132 3:159796483-159796505 TTCCTCTGGGAAATCTGGGAAGG - Intronic
967191828 3:186991411-186991433 GTGCTGTGGGAGCACAGGGAAGG + Intronic
967692654 3:192494812-192494834 GTGCTGTGGGAAGAATTGGAGGG + Intronic
968284141 3:197498536-197498558 GTGCTCTGGGGAGACTGGAAGGG - Intergenic
969043260 4:4317799-4317821 ATGCTGGGGGAAGACAGGGAAGG - Intronic
969123763 4:4930684-4930706 GACCTTTGTGAAGACAGGGAGGG - Intergenic
969713763 4:8858825-8858847 GTCCTGGGGGGACACTGGGGTGG + Intronic
969993459 4:11288083-11288105 GTCCTGTGGTCAGTCTGGGCAGG - Intergenic
970079922 4:12270809-12270831 TTCCTCTGGGAAAACTGAGAAGG - Intergenic
972656161 4:41065647-41065669 GTCCTCAGGAAAGACTGAGATGG + Exonic
975321661 4:73015411-73015433 GTTCTGGAGGAAGAGTGGGAAGG - Intergenic
975614209 4:76230480-76230502 ATCGTGTGGGCAGACAGGGAGGG - Intronic
977625003 4:99180426-99180448 GCTCTGTGGGAAAACTTGGAGGG - Intergenic
977906499 4:102483347-102483369 GTCCTGTGGGAAGGCAGCTAAGG - Intergenic
978423571 4:108559632-108559654 GTCCTGAGATAAGACTGGGAGGG + Intergenic
978549318 4:109907974-109907996 GACCTGGGGGAAGTGTGGGAAGG + Intergenic
981657716 4:147130849-147130871 GTCCTCTGTGAAGCCTGGGTGGG + Intergenic
984541058 4:181037412-181037434 GGCCAGTGGGCAGACAGGGATGG - Intergenic
985623044 5:965815-965837 GTCCTGTGGGCAGGAGGGGAGGG + Intergenic
985624476 5:977775-977797 GTCCTCTGGGAAGGATGGGAAGG - Intergenic
988521599 5:31950300-31950322 GCCCTGTGGAAGGACTGAGAAGG + Intronic
992189420 5:74276568-74276590 GTCCTCTGGGAACATTTGGAGGG - Intergenic
994847673 5:105010913-105010935 GTCCTGTGAGAGGACAGTGAGGG + Intergenic
995033407 5:107506149-107506171 TTCCTGAGGGAAATCTGGGAAGG - Intronic
998357755 5:141555454-141555476 TTCCTGTAAGAAGGCTGGGAAGG - Intronic
998659057 5:144215742-144215764 GACCTCTGGGAATACTGGCATGG + Intronic
999776043 5:154813968-154813990 GGCCTGCTGGAAGACTGGGAGGG - Exonic
1000279177 5:159767417-159767439 GGCCTGTGGGAAGTCCGGGCAGG - Intergenic
1000381297 5:160632073-160632095 GTTCTGTGGGAAGAGAGGGAGGG - Intronic
1001734059 5:173984317-173984339 GCCATGTGGGAAGGCTGGTAGGG - Intronic
1001990531 5:176112551-176112573 GAGCTGTGGGAAGACTAGGAGGG - Intronic
1002226342 5:177725589-177725611 GAGCTGTGGGAAGACTAGGAGGG + Intronic
1002267506 5:178045624-178045646 GAGCTGTGGGAAGACTAGGAGGG - Intronic
1002334845 5:178470521-178470543 CCCCTGCAGGAAGACTGGGAAGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1002642880 5:180638924-180638946 GTGCTGTGGGAAGCATGGGGTGG - Intronic
1003382598 6:5638591-5638613 CTGCTCTGAGAAGACTGGGATGG - Intronic
1006420657 6:33931780-33931802 GCCATGTGGGAAGACGCGGAGGG - Intergenic
1006602439 6:35235061-35235083 ATTCGGTGGGAAGACTGAGAAGG + Intronic
1006925277 6:37650516-37650538 GACCAGTCGGAAGTCTGGGATGG - Intronic
1009883372 6:69596753-69596775 GTCATGTGGAAAGTCTGAGAAGG - Intergenic
1010454430 6:76038729-76038751 CAACTGTGGGAAGACTGGGGTGG - Intronic
1011668383 6:89658277-89658299 CTCCTGTGGGCAGACTGGTGTGG - Exonic
1014604383 6:123454121-123454143 GACTTGGGGGAAGAGTGGGAGGG + Intronic
1015836056 6:137421330-137421352 GACCTGTAGGAAGACTGAGCAGG + Intergenic
1016988646 6:149913551-149913573 GTCAGGAGGGAAGACAGGGAAGG + Intergenic
1017188355 6:151625463-151625485 GTCCTATAGGAAAACTGGAAAGG - Intergenic
1018330421 6:162721575-162721597 GTCCTGCAGGAAAACTGGAATGG + Intronic
1018563450 6:165126387-165126409 GTTCAGTGGGAGGACTGAGAAGG + Intergenic
1019864822 7:3698107-3698129 GTCCTTTGGGAGGAAGGGGAGGG - Intronic
1022010971 7:26307986-26308008 ATCCTGTTGGAAGGCAGGGATGG - Intronic
1022096045 7:27142388-27142410 GTGCGGTGGGCAGCCTGGGAGGG - Intronic
1023415628 7:39929658-39929680 GTTCTGTCTGAAGACTGTGAGGG - Intergenic
1023577287 7:41641964-41641986 GTTGAATGGGAAGACTGGGAGGG + Intergenic
1024273840 7:47661397-47661419 GTCCTAGAGGAAGACTGGGGTGG + Exonic
1024481183 7:49864969-49864991 CTCCTGTGGGAAGAATGGGAGGG + Intronic
1026818002 7:73527163-73527185 GTGCTGTGGAAAGACAGGAAGGG - Intergenic
1027214548 7:76175385-76175407 TGCCTGTGGGGAGACTGGGCTGG + Intergenic
1028415789 7:90579205-90579227 GTCATGAGGGAATACAGGGAGGG + Intronic
1029115814 7:98236562-98236584 GTCCTGGGGGCAGCCTGGGGTGG - Intronic
1032538813 7:132686454-132686476 GTCCTATGGGCACACTGGGTGGG - Intronic
1033222833 7:139540124-139540146 GGACTGTGGGAAGCCTGGCAGGG - Intronic
1033488163 7:141812261-141812283 GGGCTCTGGGGAGACTGGGAAGG - Intergenic
1034122042 7:148636940-148636962 GGCCTGGTGGAAGACTAGGACGG - Intergenic
1034633027 7:152545418-152545440 GTCCTGTTGGGATGCTGGGAGGG - Intergenic
1035157789 7:156928369-156928391 TTCCTCTGGGAACACTGGGCTGG + Intergenic
1035286075 7:157808080-157808102 GTCCAGTGGGAAGACATGGGTGG - Intronic
1035492660 7:159293758-159293780 GAGCTGAGGGTAGACTGGGAGGG + Intergenic
1036685386 8:10905907-10905929 CTCCTGTGGGAAGGCGAGGACGG - Intronic
1038751285 8:30298341-30298363 ATCCTATGGAAAGACAGGGAAGG - Intergenic
1039992049 8:42496824-42496846 GGGCTGTGTGAAGACAGGGACGG + Intronic
1042985851 8:74582030-74582052 GTCCTGGAGGAAGAGTGTGAGGG + Intergenic
1043485966 8:80699832-80699854 GTCCAGTGGGCAGAGTGGGTGGG - Intronic
1043694424 8:83201911-83201933 GTTCTGAGTGAAGACTGGGTTGG + Intergenic
1044310691 8:90688631-90688653 TTCTAGTGGGATGACTGGGAAGG - Intronic
1047347108 8:124039126-124039148 GTCCTGTGAGAATGCTGGCAAGG - Intronic
1048261694 8:132950524-132950546 GCCCTGTGGGTAGTCAGGGAGGG - Intronic
1048290924 8:133181242-133181264 GTCCTGCGGGAACTCTGGGTTGG + Intergenic
1048655578 8:136531936-136531958 GTCCTGTGGCAAGACTGTTAAGG + Intergenic
1048887824 8:138922835-138922857 ATCCTGTGGGAAGGCTGGGTTGG + Intergenic
1049290176 8:141797622-141797644 TTCCTGTGGGAAGGCAGGGGAGG + Intergenic
1049444314 8:142623040-142623062 GTCCTGTGGTGAGACAAGGAGGG + Intergenic
1049573888 8:143381787-143381809 CGCCTGTGGGGAGACTTGGACGG - Exonic
1050328702 9:4523086-4523108 GAGCTGTGGGAAGACAGGGATGG - Intronic
1052139543 9:24962273-24962295 GTCTTGTTAGAAGAATGGGATGG + Intergenic
1053061907 9:35038446-35038468 GTCCTGATGGAAGACAGAGAAGG - Intergenic
1053289493 9:36870730-36870752 ATCCTGTGGGAAGTCTTGGCTGG + Intronic
1053466789 9:38314476-38314498 GTCGTGAGGGAATGCTGGGAGGG - Intergenic
1055602477 9:77934150-77934172 CTCCTGTGGGCGGGCTGGGAGGG - Intronic
1055907021 9:81306683-81306705 CTCGTGGGGGAAGAATGGGAGGG + Intergenic
1056273629 9:84971446-84971468 GTACTCTGGGAAGACTGAGGAGG + Intronic
1056329871 9:85512280-85512302 TTCCTGTGGGCTGACTGGGCTGG - Intergenic
1056794444 9:89647970-89647992 GTCCTGTGCAAACACAGGGATGG + Intergenic
1057306337 9:93914316-93914338 TTCCTGTGGGAAGATGGGTAGGG - Intergenic
1057617678 9:96606434-96606456 GTACTTTGGGAAGCCTGGGCAGG + Intronic
1059165507 9:112073060-112073082 GTCCTCAGGGAAGACTGTGCAGG - Intronic
1061714983 9:132513442-132513464 GTCCTCAGGGAAGACGGGGAGGG - Intronic
1062483542 9:136763303-136763325 GGCCTGTGGGAAGTTGGGGAGGG + Intronic
1185577500 X:1185596-1185618 GTACTTTGGGAAGGCTGGGCTGG - Intergenic
1186075803 X:5877038-5877060 GTCCTCTGGGAGGAATGGGGAGG - Intronic
1188792974 X:34426483-34426505 AGCCTGTGGGAACACTGTGAGGG - Intergenic
1188908880 X:35821222-35821244 GTTCTGTGGGACAACTGGGCTGG + Intergenic
1190288602 X:48976701-48976723 TTCCTGTGGGGTGACTGGGCTGG + Intronic
1190470875 X:50778069-50778091 GTCCAGCTGGAAGACTGGTATGG - Intronic
1192452503 X:71252941-71252963 GTCCTGAGGGAACCCTGGCATGG - Exonic
1192947150 X:75976636-75976658 GACTTGAGGGAAGAGTGGGAGGG - Intergenic
1193858027 X:86629339-86629361 GTCCTGTGGCAAGTCAGGGCTGG + Intronic
1194412985 X:93578620-93578642 GTACTCTGGGAAACCTGGGAAGG + Intergenic
1195405699 X:104510819-104510841 GCTCTGAGGCAAGACTGGGAAGG + Intergenic
1198766741 X:140087977-140087999 GCCCTGTGGGAAGACAGAGGTGG - Intergenic
1199056849 X:143306883-143306905 ATCCTGTGGGAACAGTGGAAGGG - Intergenic
1199065944 X:143418229-143418251 GCCCAGTCGGCAGACTGGGAGGG - Intergenic
1199216314 X:145263516-145263538 GTCCTGTGCCAAGGCTGGGGTGG - Intergenic
1199493481 X:148426987-148427009 GGCCTGTGGGAAGACAGACAAGG + Intergenic
1200212397 X:154352526-154352548 GGGCTGTGGGAAGCCTGGGGAGG - Intronic
1201140973 Y:11027675-11027697 GTCCTGTGAGAAGAAAGGAATGG - Intergenic