ID: 932432015

View in Genome Browser
Species Human (GRCh38)
Location 2:71681783-71681805
Sequence CCAGCCTACTTGGCTCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932432015 Original CRISPR CCAGCCTACTTGGCTCAAGT TGG Intronic
903111693 1:21140397-21140419 TCAGCCTCCTGGGTTCAAGTGGG + Intronic
903201710 1:21745470-21745492 TCAGCCTCCTGGGCTCAAGCTGG - Intronic
904456764 1:30652358-30652380 GCAGCCTAATTGGCTGATGTGGG + Intergenic
906060021 1:42942434-42942456 CCAGCCTACTTGCATTAAGGAGG - Intronic
907611234 1:55873526-55873548 CCAGCTATCTTGTCTCAAGTTGG - Intergenic
908387143 1:63653597-63653619 CCAGCCTTCTTCCCTCAGGTTGG + Intronic
910427696 1:87132608-87132630 CCAGGCTCCTTGGCTCCACTGGG + Intronic
911485629 1:98501477-98501499 CCACCCTTCCTGGGTCAAGTGGG - Intergenic
911508541 1:98784118-98784140 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
913541178 1:119822453-119822475 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
917024883 1:170631191-170631213 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
917060576 1:171033112-171033134 CCAGCCTCCCTGGCTCCAGCAGG + Intronic
917079057 1:171237653-171237675 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
917200250 1:172507096-172507118 TCATCCTTCTGGGCTCAAGTTGG + Intergenic
918168718 1:181975116-181975138 CCAGCCTTCCTGGCTCCAGCAGG - Intergenic
918746174 1:188203087-188203109 CCAGACTGCTTAGCTCATGTTGG + Intergenic
918802268 1:188986824-188986846 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
918934704 1:190906515-190906537 CCAGTCTTCTGGGCTCAATTTGG + Intergenic
918943161 1:191027174-191027196 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1064012840 10:11749054-11749076 CCAGCCGTCATGGCTGAAGTGGG - Intronic
1065255652 10:23864802-23864824 CCAGCCTACTCTGCACAATTTGG - Intronic
1065385588 10:25130232-25130254 ACAGGCTCCTTGCCTCAAGTGGG + Intergenic
1065984941 10:30940552-30940574 AAAGCCCAGTTGGCTCAAGTGGG + Intronic
1067051207 10:43022418-43022440 CCAGGCTCCTTGGCGCAACTGGG + Intergenic
1071684348 10:87738650-87738672 CCACCCAACTTGGCTCATGCTGG + Intronic
1071719315 10:88127391-88127413 CCATCCTACTTGTCTAACGTTGG - Intergenic
1074200947 10:111234679-111234701 CCAGACTAATTCCCTCAAGTCGG + Intergenic
1075172387 10:120127821-120127843 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1075846749 10:125551114-125551136 CCAGCCTACTTCCCTCCATTTGG + Intergenic
1076182299 10:128419600-128419622 GCAGCCTACTTGGCTCAGGGGGG + Intergenic
1076636776 10:131886164-131886186 CCAGCATGCGTGGGTCAAGTTGG + Intergenic
1080164901 11:29224798-29224820 CCAGCCTCTTTGGCTCCAGCTGG + Intergenic
1084608270 11:70185171-70185193 AGAGCCTACTTGGTTGAAGTCGG - Intronic
1084873022 11:72110339-72110361 CCAGCCTGCTAGACTCAAGGAGG - Exonic
1086497595 11:87420565-87420587 CCAGCCTACTAAGTTTAAGTAGG - Intergenic
1086771694 11:90774988-90775010 CCAGCCACCCTGGCTCCAGTAGG + Intergenic
1087353144 11:97059669-97059691 GCAGCCTGCTTGGCTGAAATTGG + Intergenic
1088004828 11:104927362-104927384 CCAGCCTCCCTGGCTCCAGCGGG - Intergenic
1088084463 11:105960476-105960498 CCAGCCTCCCTGGCTCCAGCAGG + Intronic
1088697709 11:112382689-112382711 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1089234695 11:117013390-117013412 CCTGCCTCCTGGGTTCAAGTGGG - Intronic
1091606883 12:1960344-1960366 CCAGCCTACTGTGCTTCAGTGGG - Intronic
1092628607 12:10354797-10354819 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1093413684 12:18896069-18896091 CCAGCCTCCCTGGCTCCAGCCGG + Intergenic
1093522487 12:20067059-20067081 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1094008823 12:25784978-25785000 CCAGCCCACTTGCCTCAGGTGGG + Intergenic
1094054549 12:26256005-26256027 CCAGCCTCCCTGGCTCCAGCAGG - Intronic
1100316101 12:93446033-93446055 TCAACCTCCTGGGCTCAAGTGGG + Intergenic
1101066530 12:101027517-101027539 CCAGCCTCCCTGGCTCCAGCAGG - Intronic
1104348016 12:128020232-128020254 CCAGACTTCTTGGCTCCTGTGGG + Intergenic
1108144657 13:47463891-47463913 CCAGCCTCCTTGGCTCCATCAGG - Intergenic
1108957775 13:56182694-56182716 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1110790509 13:79582022-79582044 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1113122272 13:106936217-106936239 CCACCCTCCCTGCCTCAAGTAGG - Intergenic
1116355620 14:43924934-43924956 CCAGCCTAGGTGGACCAAGTGGG + Intergenic
1116560936 14:46377439-46377461 CCAGCCTTCCTGGCTTCAGTAGG + Intergenic
1118336493 14:64857464-64857486 CCCAGCTACTTGGCTGAAGTGGG + Intronic
1118530669 14:66701950-66701972 CCAGCCTCCCTGGCTCCAGGAGG - Intronic
1120915003 14:89702907-89702929 CCAGCTCCCTTGCCTCAAGTTGG - Intergenic
1121905708 14:97741104-97741126 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1122103194 14:99430027-99430049 CCAGCCTTGATGGCTCAAGATGG + Intronic
1122619806 14:103049282-103049304 CCGGCCTGCTTGGCTGAAGGAGG + Intronic
1123069709 14:105636514-105636536 CAAGCCCACTTGGGTCACGTGGG + Intergenic
1123088791 14:105732233-105732255 CAAGCCCACTTGGGTCACGTGGG + Intergenic
1123094729 14:105761556-105761578 CAAGCCCACTTGGGTCACGTGGG + Intergenic
1123724982 15:23092653-23092675 ACAGACTACTGGGCTCATGTGGG - Intergenic
1124452773 15:29811566-29811588 CCAGGGTACCTGGCTCAATTTGG - Intronic
1126284600 15:46996648-46996670 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1129682298 15:77664685-77664707 CCAGCCAACTTGGACCAGGTAGG - Intronic
1132261933 15:100433519-100433541 CCAGCCTCCTTGGCTCAATTGGG + Intronic
1140330331 16:74050126-74050148 CCAGCTTACTTACCTCAACTCGG + Intergenic
1142751224 17:1989054-1989076 CCAGCCTCCTTGCCGCAATTAGG - Intronic
1143850726 17:9809772-9809794 CCAGACTTCCTGGGTCAAGTGGG - Intronic
1146094698 17:29918098-29918120 TCAACCTCCTGGGCTCAAGTGGG - Intronic
1149590622 17:57827292-57827314 CCAGGCTACTGTGGTCAAGTCGG - Intergenic
1149870291 17:60174930-60174952 CCAGCCTCCCTGGCTGAAGGTGG - Intergenic
1151208558 17:72526715-72526737 ACAACCAACTTGGCTCCAGTTGG - Intergenic
1151500149 17:74483175-74483197 CCAGCCCCCTTGGTACAAGTTGG + Intronic
1152167820 17:78722396-78722418 GCAGGCCACTTGGCTCAAGGAGG - Intronic
1153801580 18:8675735-8675757 TCAGAGTACTTGGATCAAGTAGG - Intergenic
1155847787 18:30731232-30731254 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1156117670 18:33805779-33805801 CCAGACTGTTTGGCTCAAGTCGG - Intergenic
1156664573 18:39390072-39390094 CCAGCTTCCCTGGCTCCAGTAGG - Intergenic
1162182495 19:8879741-8879763 CCAGCCTACCCGGCTCTAGCAGG - Intronic
1162403192 19:10458230-10458252 CCAGCATGCTTGCCTCAAGATGG - Intronic
1163010431 19:14422033-14422055 CCAACCTCCTGGGCTCAAGAAGG - Intergenic
1163209294 19:15828805-15828827 CCAGACTTCTTGGCTCCTGTAGG - Intergenic
1163872150 19:19830989-19831011 CCAGCCTCCCTGGCTCTAGCAGG - Intergenic
1163886145 19:19966426-19966448 CCAGCCTCCCTGGCTCTAGCAGG + Intergenic
1163888323 19:19989052-19989074 CCAGCCTCCCTGGCTCTAGCAGG - Intergenic
927092471 2:19722541-19722563 CCAGCCTGCATGGCTCAGGTGGG - Intergenic
928757587 2:34545507-34545529 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
930234701 2:48877462-48877484 CCAGCCAACTTGGCTCAACCTGG - Intergenic
930545762 2:52765803-52765825 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
932432015 2:71681783-71681805 CCAGCCTACTTGGCTCAAGTTGG + Intronic
932826724 2:74948013-74948035 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
932981997 2:76680764-76680786 CCAGACTCCTTGCCTCAAGGTGG + Intergenic
933129473 2:78655119-78655141 CCATCCTCCTTGGCTCCAGCAGG - Intergenic
933237594 2:79882548-79882570 CCAGCCTCCCTGGCTCCAGCAGG + Intronic
933602554 2:84347881-84347903 CCAGCCTCCCTGGCTCTAGCAGG + Intergenic
934624798 2:95836856-95836878 CCAGCATCCTTGGCACAAGCTGG + Intergenic
934808777 2:97264558-97264580 CCAGCATCCTTGGCACAAGCTGG - Intergenic
934828728 2:97492604-97492626 CCAGCATCCTTGGCACAAGCTGG + Intergenic
936849096 2:116874051-116874073 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
937434187 2:121866768-121866790 CCTGGCCACTTGGCTCAAGGTGG + Intergenic
937931496 2:127208661-127208683 CCAGCCTCCCTGGCTCCAGCAGG - Intronic
939391112 2:141570711-141570733 CCAGCCTCCTTGGCTTCAGCAGG - Intronic
939808942 2:146808137-146808159 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
939828919 2:147049175-147049197 CTAGCCCTCTTGCCTCAAGTTGG - Intergenic
940273398 2:151915312-151915334 CCAGCCTCCCTGGCTCCAGCAGG + Intronic
940410720 2:153360525-153360547 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
941088566 2:161147165-161147187 CCAGCCTCCCTGGCTCCAGCAGG + Intronic
941694384 2:168535053-168535075 CCAGCCTCCCTGGCTCCAGCAGG + Intronic
942376105 2:175339639-175339661 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
943216531 2:185044398-185044420 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
944385106 2:199155116-199155138 CCAGCTTCCTTGGCTCCAGCAGG - Intergenic
944444448 2:199775385-199775407 CCAGCCTCCTTGCCTCAATTTGG - Intronic
944674535 2:202024033-202024055 CCAGCCTTCTCAGCACAAGTGGG + Intergenic
944992334 2:205252678-205252700 TCTGCCTACTTGGCTTAACTTGG - Intronic
945157202 2:206851749-206851771 CTAGAAAACTTGGCTCAAGTGGG + Intergenic
945798807 2:214398523-214398545 CTAGCCCACTTGGATCAAATGGG - Intronic
946367563 2:219258624-219258646 CCAGCCCACCTGGCTCATTTTGG + Intronic
1168819219 20:761946-761968 CCAGGTTGCCTGGCTCAAGTGGG + Intronic
1169995535 20:11552180-11552202 CCAGCCCCCTTGCCTCAGGTGGG - Intergenic
1170496592 20:16930943-16930965 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1171962574 20:31505297-31505319 TGAGCTTCCTTGGCTCAAGTTGG - Intergenic
1173091326 20:39974964-39974986 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1173467230 20:43292896-43292918 CCAGCCTCCTTATCTCAAGAGGG - Intergenic
1173613772 20:44389659-44389681 CCAGCCTATTTATATCAAGTGGG + Intronic
1174680084 20:52398313-52398335 CCAGCTCCCTTGGCTCAAGCTGG - Intergenic
1177511388 21:22091876-22091898 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1177517556 21:22175418-22175440 ACATCCTACATGGCTGAAGTAGG - Intergenic
1177878945 21:26669424-26669446 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1182457363 22:30460466-30460488 CCAGCCCCCTTGGATGAAGTGGG + Intronic
949119954 3:373458-373480 CCAGCCTCCCTGGCTCCAGCAGG + Intronic
950376544 3:12577027-12577049 TCAGCCTCCTGGGCTCAAGCAGG + Intronic
951454801 3:22878497-22878519 CCAGCTGCCTTGTCTCAAGTGGG + Intergenic
952349269 3:32518768-32518790 TCAAACTCCTTGGCTCAAGTTGG + Intergenic
952562009 3:34605580-34605602 CAAGCCCACTTGTCTCAACTGGG + Intergenic
952634001 3:35505405-35505427 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
954518958 3:51206011-51206033 CCATCCTCCTTGACTCAAATAGG + Intronic
955832134 3:63015700-63015722 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
955884479 3:63583288-63583310 CCAGACTTCTTGGCTCCTGTAGG + Intronic
957291333 3:78281587-78281609 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
957394729 3:79622490-79622512 CCAGCCTTCCTGGCTCCAGCAGG - Intronic
957535704 3:81500947-81500969 CCAGCCTTCTACCCTCAAGTAGG - Intronic
957630094 3:82707237-82707259 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
959031102 3:101300238-101300260 CCAGCCTCCCTGGCTCCAGCAGG + Intronic
960233434 3:115254930-115254952 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
962800419 3:138885524-138885546 TCAACCTCCTTGGCTCAAGGAGG + Intergenic
963461256 3:145617322-145617344 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
965379837 3:167974789-167974811 CCAGCCCCCTTGCCTCAAGATGG - Intergenic
966539642 3:181075197-181075219 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
967700377 3:192585559-192585581 CCAACCTCCTTGGGTCAAGCTGG - Intronic
970494287 4:16609510-16609532 CCAGCCTCCCTGGCTCCAGCAGG - Intronic
971489137 4:27192559-27192581 CCAGCCCACTCTGCTCACGTGGG + Intergenic
971853162 4:32010347-32010369 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
973584659 4:52377863-52377885 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
973614740 4:52667095-52667117 CCACCCTACTTGGCTAACTTAGG - Intergenic
973858438 4:55036550-55036572 CCAGCCCCCTTGCTTCAAGTTGG - Intergenic
974704203 4:65490414-65490436 CCGGGCTCCTGGGCTCAAGTCGG + Exonic
976538221 4:86242683-86242705 CCAGCCTCCCTGGCTCTAGCAGG + Intronic
977253047 4:94709834-94709856 ACAGTCTACTTGGCTCCACTTGG - Intergenic
979775426 4:124583369-124583391 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
980184642 4:129446397-129446419 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
981352811 4:143752340-143752362 CCAGCCTCCTTGGCTTCAGCTGG - Intergenic
983649506 4:170024630-170024652 CCAGACTATTTGGCTAAAATGGG + Intronic
984334999 4:178379261-178379283 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
984626122 4:182009563-182009585 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
987306805 5:16644925-16644947 CCCAGCTACTTGGCTCAGGTAGG - Intergenic
987399848 5:17463841-17463863 CCAGTCTCCTTGGCTCCAGCAGG + Intergenic
987829114 5:23073538-23073560 CCAGCCCTCTTGCCTCAATTTGG - Intergenic
987834709 5:23146270-23146292 CCAGCCTCCTTGGCTCCAGCAGG + Intergenic
987988585 5:25181277-25181299 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
989348225 5:40453753-40453775 CCAGTCTCCTTGGCTCCAGCAGG + Intergenic
990139095 5:52682522-52682544 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
992597289 5:78359921-78359943 CAAGGCTCCTTGGATCAAGTTGG + Intergenic
993712236 5:91237046-91237068 TCAGCCTACTTGGTTAAAATGGG - Intergenic
994276652 5:97846196-97846218 GCAGCCTAATGTGCTCAAGTAGG + Intergenic
1001428713 5:171642861-171642883 CCAGCCTGCTTGGCTCAGCAGGG - Intergenic
1005121051 6:22389811-22389833 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1008244256 6:49150802-49150824 CCAGCCTCCTTGGCTCCAGCCGG + Intergenic
1008773665 6:55009228-55009250 CCAGCCTCCCTGGCTCCAGAAGG + Intergenic
1010331273 6:74626612-74626634 CCAGCCTCCCTGGCTCTAGCAGG - Intergenic
1010483222 6:76379305-76379327 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1010945604 6:81970200-81970222 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1015660192 6:135566412-135566434 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1018673107 6:166195705-166195727 ACAGGCAACTTGGCTCAACTAGG - Intergenic
1019113539 6:169738140-169738162 CCAGCCTGCCTGGCTCCAGCAGG + Intergenic
1022634625 7:32120046-32120068 CCAGCCTCCCTGGCTCTAGCAGG - Intronic
1024244494 7:47458952-47458974 CCATCCTATCTGGCTAAAGTTGG - Intronic
1025908870 7:65811387-65811409 CCAGCCTCCTTCCCTCACGTAGG + Intergenic
1028048900 7:86158435-86158457 TCAGCCTCCCTGGCTCCAGTGGG - Intergenic
1028517973 7:91698874-91698896 CCAGCCTCCCTGGCTCCAGCAGG - Intronic
1029041447 7:97580382-97580404 CCAGCCTTCCTGGCTCCAGCAGG - Intergenic
1030646179 7:112064327-112064349 CCATCCTAGGTGGCTTAAGTGGG - Intronic
1030701578 7:112646933-112646955 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1031804574 7:126292656-126292678 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1032664773 7:134025060-134025082 CCAGCCTTCCTGGCTCATCTTGG + Intronic
1033879399 7:145862548-145862570 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1034316584 7:150138751-150138773 CCATCATTCATGGCTCAAGTTGG - Intergenic
1034790276 7:153961923-153961945 CCATCATTCATGGCTCAAGTTGG + Intronic
1035063786 7:156090909-156090931 CCTGCCTCCTTGGCTCCACTAGG + Intergenic
1036747201 8:11418245-11418267 CCTGCCTTCTTGCCTCAAGGAGG + Intronic
1038622440 8:29156846-29156868 TCAGCCTACTTGACACAACTTGG + Intronic
1038781427 8:30571513-30571535 CCAGCCCACCTGGCTGCAGTGGG + Intronic
1039293854 8:36127777-36127799 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1039402219 8:37279536-37279558 CCAGCCTTCGTGGCTCCAGCAGG - Intergenic
1044315763 8:90748794-90748816 CCAGCCTTCCTGGCTCCAGCAGG - Intronic
1044988893 8:97778008-97778030 ACAGCCAACAGGGCTCAAGTAGG - Intronic
1045755063 8:105533174-105533196 GCAGTCTACTTTGCTCCAGTGGG - Intronic
1047135366 8:122071819-122071841 CCAGCCTAATTTGCTCATGGTGG + Intergenic
1050630089 9:7549543-7549565 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1052546635 9:29888900-29888922 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1055096552 9:72420158-72420180 CCAACCTCCTGGGCTCAAGTGGG - Intergenic
1055395456 9:75869116-75869138 CCAGCCTCCTTGCCTCAATTTGG - Intergenic
1055615238 9:78065280-78065302 CAAGCCTACCTAGCTCAAATTGG - Intergenic
1055818852 9:80238373-80238395 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1058918052 9:109586626-109586648 CCAGCCCTCTTGCCTCAACTTGG - Intergenic
1059891585 9:118810520-118810542 TCAGCCTAGTTGGCTCAACTAGG + Intergenic
1186430920 X:9503583-9503605 CCAGCCTCCCTGGCTCTAGCAGG - Intronic
1188092147 X:25977063-25977085 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1188379638 X:29475277-29475299 CCTACATACTTGTCTCAAGTAGG - Intronic
1188884324 X:35531360-35531382 CCAGCCTCCCTGGCTCTAGCAGG - Intergenic
1189259587 X:39669013-39669035 CCAGCTTCCCTGCCTCAAGTTGG + Intergenic
1190113319 X:47609361-47609383 CCAGCCTCCTTGCCTCAATCTGG + Intronic
1190529595 X:51361587-51361609 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1192716433 X:73647518-73647540 CCAGCCTCCCTGGCTCCAGCAGG - Intronic
1192757381 X:74060702-74060724 CCAGCCTGCCTGTCTCAAGAAGG + Intergenic
1193048379 X:77076977-77076999 CCAGCCTCCCTGGCTCTAGCAGG + Intergenic
1193719525 X:84971502-84971524 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1193780799 X:85699024-85699046 CCATCCTACTTGGCTCCAGCAGG + Intergenic
1194058209 X:89163819-89163841 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1194286769 X:92020350-92020372 CCAGCCTCCCTGGCTCCAGCAGG - Intronic
1194523126 X:94942890-94942912 CCAGCCTCCATGGCTCCAGCAGG - Intergenic
1194804210 X:98307281-98307303 CCAGCATCCTTGCCTCAGGTTGG + Intergenic
1196517283 X:116628610-116628632 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1196607365 X:117671828-117671850 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1197049572 X:122042521-122042543 CCAGCCTCCTTGGCTCTAGCAGG + Intergenic
1198502055 X:137260026-137260048 CCAGCCTACTTGTCTTCACTGGG + Intergenic
1200604315 Y:5244910-5244932 CCAGCCTCCCTGGCTCCAGCAGG - Intronic
1200742026 Y:6864279-6864301 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic