ID: 932437288

View in Genome Browser
Species Human (GRCh38)
Location 2:71710004-71710026
Sequence AAGTCAAAGGGGAAGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932437288_932437297 14 Left 932437288 2:71710004-71710026 CCCTCCATCTTCCCCTTTGACTT No data
Right 932437297 2:71710041-71710063 CCAAAACACTTTGCTGAAATTGG No data
932437288_932437298 25 Left 932437288 2:71710004-71710026 CCCTCCATCTTCCCCTTTGACTT No data
Right 932437298 2:71710052-71710074 TGCTGAAATTGGTACTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932437288 Original CRISPR AAGTCAAAGGGGAAGATGGA GGG (reversed) Intergenic
No off target data available for this crispr