ID: 932437376

View in Genome Browser
Species Human (GRCh38)
Location 2:71710577-71710599
Sequence CAGCTGTTCTGGATGTCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932437368_932437376 -7 Left 932437368 2:71710561-71710583 CCACCTGGCCTTTCCCCAGCTGT No data
Right 932437376 2:71710577-71710599 CAGCTGTTCTGGATGTCTAAGGG No data
932437361_932437376 18 Left 932437361 2:71710536-71710558 CCTGGCCCTGCCCACCGCGTCAC No data
Right 932437376 2:71710577-71710599 CAGCTGTTCTGGATGTCTAAGGG No data
932437369_932437376 -10 Left 932437369 2:71710564-71710586 CCTGGCCTTTCCCCAGCTGTTCT No data
Right 932437376 2:71710577-71710599 CAGCTGTTCTGGATGTCTAAGGG No data
932437364_932437376 8 Left 932437364 2:71710546-71710568 CCCACCGCGTCACTTCCACCTGG No data
Right 932437376 2:71710577-71710599 CAGCTGTTCTGGATGTCTAAGGG No data
932437363_932437376 12 Left 932437363 2:71710542-71710564 CCTGCCCACCGCGTCACTTCCAC No data
Right 932437376 2:71710577-71710599 CAGCTGTTCTGGATGTCTAAGGG No data
932437366_932437376 7 Left 932437366 2:71710547-71710569 CCACCGCGTCACTTCCACCTGGC No data
Right 932437376 2:71710577-71710599 CAGCTGTTCTGGATGTCTAAGGG No data
932437360_932437376 24 Left 932437360 2:71710530-71710552 CCTCTGCCTGGCCCTGCCCACCG No data
Right 932437376 2:71710577-71710599 CAGCTGTTCTGGATGTCTAAGGG No data
932437367_932437376 4 Left 932437367 2:71710550-71710572 CCGCGTCACTTCCACCTGGCCTT No data
Right 932437376 2:71710577-71710599 CAGCTGTTCTGGATGTCTAAGGG No data
932437362_932437376 13 Left 932437362 2:71710541-71710563 CCCTGCCCACCGCGTCACTTCCA No data
Right 932437376 2:71710577-71710599 CAGCTGTTCTGGATGTCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932437376 Original CRISPR CAGCTGTTCTGGATGTCTAA GGG Intergenic
No off target data available for this crispr