ID: 932437753

View in Genome Browser
Species Human (GRCh38)
Location 2:71712647-71712669
Sequence GAGGAGTATGTAGGAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932437746_932437753 12 Left 932437746 2:71712612-71712634 CCTGAAGCTTTGCTGGGAATCCG No data
Right 932437753 2:71712647-71712669 GAGGAGTATGTAGGAAACACAGG No data
932437739_932437753 28 Left 932437739 2:71712596-71712618 CCCACTGAACCCAAGCCCTGAAG No data
Right 932437753 2:71712647-71712669 GAGGAGTATGTAGGAAACACAGG No data
932437745_932437753 13 Left 932437745 2:71712611-71712633 CCCTGAAGCTTTGCTGGGAATCC No data
Right 932437753 2:71712647-71712669 GAGGAGTATGTAGGAAACACAGG No data
932437748_932437753 -8 Left 932437748 2:71712632-71712654 CCGCCACATCCGTCCGAGGAGTA No data
Right 932437753 2:71712647-71712669 GAGGAGTATGTAGGAAACACAGG No data
932437743_932437753 18 Left 932437743 2:71712606-71712628 CCAAGCCCTGAAGCTTTGCTGGG No data
Right 932437753 2:71712647-71712669 GAGGAGTATGTAGGAAACACAGG No data
932437741_932437753 19 Left 932437741 2:71712605-71712627 CCCAAGCCCTGAAGCTTTGCTGG No data
Right 932437753 2:71712647-71712669 GAGGAGTATGTAGGAAACACAGG No data
932437740_932437753 27 Left 932437740 2:71712597-71712619 CCACTGAACCCAAGCCCTGAAGC No data
Right 932437753 2:71712647-71712669 GAGGAGTATGTAGGAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932437753 Original CRISPR GAGGAGTATGTAGGAAACAC AGG Intergenic
No off target data available for this crispr