ID: 932439256

View in Genome Browser
Species Human (GRCh38)
Location 2:71721495-71721517
Sequence TGGGAGAGCTGAGTTATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932439256_932439270 30 Left 932439256 2:71721495-71721517 CCCAAAATAACTCAGCTCTCCCA No data
Right 932439270 2:71721548-71721570 CACTCCTTCTCTTTCCCTCAGGG No data
932439256_932439262 0 Left 932439256 2:71721495-71721517 CCCAAAATAACTCAGCTCTCCCA No data
Right 932439262 2:71721518-71721540 ACCCCAGGCATTCCCAGGACTGG No data
932439256_932439259 -5 Left 932439256 2:71721495-71721517 CCCAAAATAACTCAGCTCTCCCA No data
Right 932439259 2:71721513-71721535 TCCCAACCCCAGGCATTCCCAGG No data
932439256_932439269 29 Left 932439256 2:71721495-71721517 CCCAAAATAACTCAGCTCTCCCA No data
Right 932439269 2:71721547-71721569 ACACTCCTTCTCTTTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932439256 Original CRISPR TGGGAGAGCTGAGTTATTTT GGG (reversed) Intergenic