ID: 932439257

View in Genome Browser
Species Human (GRCh38)
Location 2:71721496-71721518
Sequence TTGGGAGAGCTGAGTTATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932439257_932439262 -1 Left 932439257 2:71721496-71721518 CCAAAATAACTCAGCTCTCCCAA No data
Right 932439262 2:71721518-71721540 ACCCCAGGCATTCCCAGGACTGG No data
932439257_932439270 29 Left 932439257 2:71721496-71721518 CCAAAATAACTCAGCTCTCCCAA No data
Right 932439270 2:71721548-71721570 CACTCCTTCTCTTTCCCTCAGGG No data
932439257_932439269 28 Left 932439257 2:71721496-71721518 CCAAAATAACTCAGCTCTCCCAA No data
Right 932439269 2:71721547-71721569 ACACTCCTTCTCTTTCCCTCAGG No data
932439257_932439259 -6 Left 932439257 2:71721496-71721518 CCAAAATAACTCAGCTCTCCCAA No data
Right 932439259 2:71721513-71721535 TCCCAACCCCAGGCATTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932439257 Original CRISPR TTGGGAGAGCTGAGTTATTT TGG (reversed) Intergenic