ID: 932439260

View in Genome Browser
Species Human (GRCh38)
Location 2:71721514-71721536
Sequence TCCTGGGAATGCCTGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932439260_932439272 20 Left 932439260 2:71721514-71721536 CCCAACCCCAGGCATTCCCAGGA No data
Right 932439272 2:71721557-71721579 TCTTTCCCTCAGGGAACCCAAGG No data
932439260_932439270 11 Left 932439260 2:71721514-71721536 CCCAACCCCAGGCATTCCCAGGA No data
Right 932439270 2:71721548-71721570 CACTCCTTCTCTTTCCCTCAGGG No data
932439260_932439274 25 Left 932439260 2:71721514-71721536 CCCAACCCCAGGCATTCCCAGGA No data
Right 932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG No data
932439260_932439276 26 Left 932439260 2:71721514-71721536 CCCAACCCCAGGCATTCCCAGGA No data
Right 932439276 2:71721563-71721585 CCTCAGGGAACCCAAGGTCAGGG No data
932439260_932439269 10 Left 932439260 2:71721514-71721536 CCCAACCCCAGGCATTCCCAGGA No data
Right 932439269 2:71721547-71721569 ACACTCCTTCTCTTTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932439260 Original CRISPR TCCTGGGAATGCCTGGGGTT GGG (reversed) Intergenic