ID: 932439261

View in Genome Browser
Species Human (GRCh38)
Location 2:71721515-71721537
Sequence GTCCTGGGAATGCCTGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932439261_932439276 25 Left 932439261 2:71721515-71721537 CCAACCCCAGGCATTCCCAGGAC No data
Right 932439276 2:71721563-71721585 CCTCAGGGAACCCAAGGTCAGGG No data
932439261_932439269 9 Left 932439261 2:71721515-71721537 CCAACCCCAGGCATTCCCAGGAC No data
Right 932439269 2:71721547-71721569 ACACTCCTTCTCTTTCCCTCAGG No data
932439261_932439274 24 Left 932439261 2:71721515-71721537 CCAACCCCAGGCATTCCCAGGAC No data
Right 932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG No data
932439261_932439270 10 Left 932439261 2:71721515-71721537 CCAACCCCAGGCATTCCCAGGAC No data
Right 932439270 2:71721548-71721570 CACTCCTTCTCTTTCCCTCAGGG No data
932439261_932439277 30 Left 932439261 2:71721515-71721537 CCAACCCCAGGCATTCCCAGGAC No data
Right 932439277 2:71721568-71721590 GGGAACCCAAGGTCAGGGAGAGG No data
932439261_932439272 19 Left 932439261 2:71721515-71721537 CCAACCCCAGGCATTCCCAGGAC No data
Right 932439272 2:71721557-71721579 TCTTTCCCTCAGGGAACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932439261 Original CRISPR GTCCTGGGAATGCCTGGGGT TGG (reversed) Intergenic