ID: 932439263

View in Genome Browser
Species Human (GRCh38)
Location 2:71721519-71721541
Sequence TCCAGTCCTGGGAATGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932439263_932439269 5 Left 932439263 2:71721519-71721541 CCCCAGGCATTCCCAGGACTGGA No data
Right 932439269 2:71721547-71721569 ACACTCCTTCTCTTTCCCTCAGG No data
932439263_932439277 26 Left 932439263 2:71721519-71721541 CCCCAGGCATTCCCAGGACTGGA No data
Right 932439277 2:71721568-71721590 GGGAACCCAAGGTCAGGGAGAGG No data
932439263_932439278 29 Left 932439263 2:71721519-71721541 CCCCAGGCATTCCCAGGACTGGA No data
Right 932439278 2:71721571-71721593 AACCCAAGGTCAGGGAGAGGTGG No data
932439263_932439276 21 Left 932439263 2:71721519-71721541 CCCCAGGCATTCCCAGGACTGGA No data
Right 932439276 2:71721563-71721585 CCTCAGGGAACCCAAGGTCAGGG No data
932439263_932439274 20 Left 932439263 2:71721519-71721541 CCCCAGGCATTCCCAGGACTGGA No data
Right 932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG No data
932439263_932439270 6 Left 932439263 2:71721519-71721541 CCCCAGGCATTCCCAGGACTGGA No data
Right 932439270 2:71721548-71721570 CACTCCTTCTCTTTCCCTCAGGG No data
932439263_932439272 15 Left 932439263 2:71721519-71721541 CCCCAGGCATTCCCAGGACTGGA No data
Right 932439272 2:71721557-71721579 TCTTTCCCTCAGGGAACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932439263 Original CRISPR TCCAGTCCTGGGAATGCCTG GGG (reversed) Intergenic
No off target data available for this crispr