ID: 932439265

View in Genome Browser
Species Human (GRCh38)
Location 2:71721521-71721543
Sequence CATCCAGTCCTGGGAATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932439265_932439277 24 Left 932439265 2:71721521-71721543 CCAGGCATTCCCAGGACTGGATG No data
Right 932439277 2:71721568-71721590 GGGAACCCAAGGTCAGGGAGAGG No data
932439265_932439272 13 Left 932439265 2:71721521-71721543 CCAGGCATTCCCAGGACTGGATG No data
Right 932439272 2:71721557-71721579 TCTTTCCCTCAGGGAACCCAAGG No data
932439265_932439269 3 Left 932439265 2:71721521-71721543 CCAGGCATTCCCAGGACTGGATG No data
Right 932439269 2:71721547-71721569 ACACTCCTTCTCTTTCCCTCAGG No data
932439265_932439278 27 Left 932439265 2:71721521-71721543 CCAGGCATTCCCAGGACTGGATG No data
Right 932439278 2:71721571-71721593 AACCCAAGGTCAGGGAGAGGTGG No data
932439265_932439276 19 Left 932439265 2:71721521-71721543 CCAGGCATTCCCAGGACTGGATG No data
Right 932439276 2:71721563-71721585 CCTCAGGGAACCCAAGGTCAGGG No data
932439265_932439270 4 Left 932439265 2:71721521-71721543 CCAGGCATTCCCAGGACTGGATG No data
Right 932439270 2:71721548-71721570 CACTCCTTCTCTTTCCCTCAGGG No data
932439265_932439274 18 Left 932439265 2:71721521-71721543 CCAGGCATTCCCAGGACTGGATG No data
Right 932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932439265 Original CRISPR CATCCAGTCCTGGGAATGCC TGG (reversed) Intergenic